Article

Identification of a gene encoding a bacteriophage-related integrase in a vap region of the Dichelobacter nodosus genome

Department of Biochemistry, Microbiology and Nutrition, University of New England, Armidale, N.S.W., Australia.
Gene (Impact Factor: 2.14). 09/1995; 162(1):53-8. DOI: 10.1016/0378-1119(95)00315-W
Source: PubMed

ABSTRACT

Dichelobacter nodosus is the principal causative agent of ovine footrot. Nucleotide (nt) sequences from the D. nodosus genome have been isolated and a series of overlapping lambda clones defining vap (virulence-associated protein) regions 1, 2 and 3 have been reported [Katz et al., J. Bacteriol. 176 (1994) 2663-2669]. In the present study, the limits of the virulence-associated (va) DNA around vap regions 1 and 3 were determined by dot-blot hybridization experiments using plasmid subclones to probe genomic DNA from the D. nodosus virulent strain A198 and the benign strain C305. This va region was found to be approx. 11.9 kb in length, and to be interrupted by a short DNA segment which is also found in the benign D. nodosus strain. Sequence analysis of the entire region revealed an ORF, intA, which is very similar to the integrases of bacteriophages phi R73, P4 and Sf6. Bacteriophages phi R73 and P4 integrate into the 3' ends of tRNA genes, with the integrase genes adjacent to the tRNA genes. A similar arrangement was found in the D. nodosus va region. A 19-bp nt sequence was found to be repeated at the ends of the va region, and may represent the bacteriphage attachment site. These findings suggest that D. nodosus may have acquired these DNA sequences by the integration of a bacteriophage, or an integrative plasmid that contains a bacteriophage-related integrase gene. The high similarity of the D. nodosus integrase to integrases from coliphages suggests that these va sequences may be transferred between distantly related bacteria.(ABSTRACT TRUNCATED AT 250 WORDS)

0 Followers
 · 
4 Reads
  • Source
    • "Comparative analysis of DNA from virulent and benign strains has led to the identification of a series of genetic elements that integrate into the D. nodosus chromosome. These include the intA (Katz et al., 1991, 1992, 1994; Cheetham et al., 1995; Billington et al., 1996), intB (Bloomfield et al., 1997), intC (Bloomfield et al., 1997) and intD elements (Tanjung et al., 2009), each of which contains an integrase gene. A fifth integrated element, the virulencerelated locus, vrl (Katz et al., 1991; Haring et al., 1995; Billington et al., 1999), lacks an integrase gene. "
    [Show abstract] [Hide abstract]
    ABSTRACT: The Gram-negative anaerobe Dichelobacter nodosus is the causative agent of footrot in sheep. Different strains of D. nodosus cause disease of differing severities, ranging from benign to virulent. Virulent strains have greater twitching motility and secrete proteases that are more thermostable than those secreted by benign strains. We have identified polynucleotide phosphorylase (PNPase) as a putative virulence regulator and have proposed that PNPase expression is modulated by the adjacent integration of genetic elements. In this study, we compared PNPase activity in three virulent and four benign strains of D. nodosus and found that PNPase activity is lower in virulent strains. We disrupted the pnpA gene in three benign D. nodosus strains and two virulent strains and showed that deletion of the S1 domain of PNPase reduced catalytic activity. In all but one case, deletion of the PNPase S1 domain had no effect on the thermostability of extracellular proteases. However, this deletion resulted in an increase in twitching motility in benign, but not in virulent strains. Reconstruction of the pnpA gene in two mutant benign strains reduced twitching motility to the parental level. These results support the hypothesis that PNPase is a virulence repressor in benign strains of D. nodosus.
    Full-text · Article · Oct 2009 · FEMS Microbiology Letters
  • Source
    • "In addition, the maintenance of the intA, intC and intD elements may be co-ordinately controlled, since these shared genes are involved in the maintenance of mobile genetic elements. Another feature in common with the intA element is the presence at the extreme right-hand end of the intD element of three copies of a 102 bp repeat, which is found in several positions in the intA element [7]. This repeat may have a role in rearrangements of sequences in the intA element [23] "
    [Show abstract] [Hide abstract]
    ABSTRACT: The Gram-negative anaerobic pathogen Dichelobacter nodosus is the principal causative agent of footrot in sheep. The intA, intB and intC elements are mobile genetic elements which integrate into two tRNA genes downstream from csrA (formerly glpA) and pnpA in the D. nodosus chromosome. CsrA homologues act as global repressors of virulence in several bacterial pathogens, as does polynucleotide phosphorylase, the product of pnpA. We have proposed a model in which virulence in D. nodosus is controlled in part by the integration of genetic elements downstream from csrA and pnpA, altering the expression of these putative global regulators of virulence. We describe here a novel integrated genetic element, the intD element, which is 32kb in size and contains an integrase gene, intD, several genes related to genes on other integrated elements of D. nodosus, a type IV secretion system and a putative mobilisation region, suggesting that the intD element has a role in the transfer of other genetic elements. Most of the D. nodosus strains examined which contained the intD gene were benign, with intD integrated next to pnpA, supporting our previous observation that virulent strains of D. nodosus have the intA element next to pnpA.
    Full-text · Article · Apr 2009 · Anaerobe
  • Source
    • "All three sequences differed for the first 51 nt, and were identical after this point, suggesting that the att site is found 189 nt upstream of the integrase gene. This is the approximate position of the att sites of the intA, intB and intC elements of D. nodosus [4] [8] and of bacteriophages such as P4 [33] [34]. The att site for DinoHI was defined as the 20 nt sequence TTTGTATGATGTGGGCATCA from DinoHI (GenBank accession no EU048235, bold in Fig. 4) which shows 90% identity at the left junction (attL, upstream from intP) and 80% identity at the right junction (attR, Fig. 4B "
    [Show abstract] [Hide abstract]
    ABSTRACT: The Gram-negative anaerobic pathogen Dichelobacter nodosus carries several genetic elements that integrate into the chromosome. These include the intA, intB, intC and intD elements, which integrate adjacent to csrA and pnpA, two putative global regulators of virulence and the virulence-related locus, vrl, which integrates into ssrA. Treatment of D. nodosus strains with ultraviolet light resulted in the isolation of DinoHI, a member of the Siphoviridae and the first bacteriophage to be identified in D. nodosus. Part of the DinoHI genome containing the packaging site is found in all D. nodosus strains tested and is located at the end of the vrl, suggesting a role for DinoHI in the transfer of the vrl by transduction. Like the intB element, the DinoHI genome contains a copy of regA which has similarity to the repressors of lambdoid bacteriophages, suggesting that the maintenance of DinoHI and the intB element may be co-ordinately controlled.
    Full-text · Article · Feb 2008 · The Open Microbiology Journal
Show more