ArticlePDF Available

A common nonsense mutation results in ??-actinin-3 deficiency in the general population [1]

DOI:10.1038/7675
Authors:
Kathryn N. North
Kathryn N. North
Kathryn N. North
  • This person is not on ResearchGate, or hasn't claimed this research yet.
Nan Yang at Huazhong Agricultural University
Nan Yang
Duangrurdee Wattanasirichaigoon at Mahidol University
Duangrurdee Wattanasirichaigoon
Michelle Mills
Michelle Mills
Michelle Mills
  • This person is not on ResearchGate, or hasn't claimed this research yet.
Show all 6 authorsHide
Download full-text PDF
Read full-text
Download citation

Abstract

The -actinins are actin-binding proteins encoded by a multigene family. In skeletal muscle, they are a major structural component of the Z-lines that anchor the actin-containing thin filaments and maintain the spatial relationship between myofilaments1. In humans, two genes (ACTN2 and ACTN3) encode the closely related -actinin-2 and -actinin-3 skeletal muscle isoforms2. ACTN2 is expressed in all skeletal muscle fibres, whereas expression of ACTN3 is limited to a subset of type 2 (fast) fibres3. We have previously demonstrated absence of -actinin-3 in muscle biopsies from several patients with muscular dystrophy3. A follow-up study identified additional -actinin-3-negative biopsies from neuromuscular patients with other known diseases, suggesting that this deficiency was not the primary cause of muscle weakness4. Subsequently, we screened muscle specimens with dystrophic (118 specimens), myopathic (74), neurogenic (20) and normal (55) features (Fig. 1a-d). Although these biopsies contained normal -actinin-2 expression, deficiency of -actinin-3 was identified by immunocytochemistry and western blot in 51 of 267 cases (19%), a finding not associated with any particular histopathological or clinical phenotype. To ascertain whether -actinin-3 deficiency was associated with mutations of ACTN3, we used an RT-PCR approach to amplify mRNA isolated from diagnostic muscle biopsies. Using primer pairs AB16/AB9 (5´−GATGGTTATGCAGCCCGAGG−3´ and 5´−AGCAACGCCCGCACCTCCT−3´) and AB8/AB1 (5´−TGCACGAAGCCTGGACCC−3´ and 5´−AGAGAGGGATCTTTATTCAG−3´), we PCR-amplified two overlapping fragments encompassing bases 24-2,852 of ACTN3 mRNA (ref. 2). Initially, we focused on one family with two affected male siblings with congenital muscular dystrophy and complete deficiency of -actinin-3. Sequencing of ACTN3 cDNA from the proband identified two changes relative to controls and the previously determined sequence M86407. These were an AG transition at nt 1,586 in exon 15, changing a glutamine (CAG) to an arginine (CGG) at residue 523 (Q523R), and a CT transversion at position 1,747 in exon 16, converting an arginine to a stop codon at residue 577 (R577X; Fig. 1e-g). Direct sequencing of genomic DNA from the proband and the affected sibling confirmed homozygosity for both point mutations. Subsequent testing of the parents and two unaffected siblings revealed that these phenotypically normal individuals had the same genotype as the proband and were thus homozygous for the ACTN3 577X nonsense mutation.
Content uploaded by Duangrurdee Wattanasirichaigoon
Author content
All content in this area was uploaded by Duangrurdee Wattanasirichaigoon on Jun 07, 2014
Content may be subject to copyright.
correspondence
nature genetics • volume
21 •
april
1999
353
T
he α-actinins are actin-binding
proteins encoded by a multigene
family. In skeletal muscle, they are a
major structural component of the Z-
lines that anchor the actin-containing
thin filaments and maintain the spatial
relationship between myofilaments
1
. In
humans, two genes (ACTN2 and ACTN3)
encode the closely related α-actinin-2
and α-actinin-3 skeletal muscle iso-
forms
2
. ACTN2is expressed in all skeletal
muscle fibres, whereas expression of
ACTN3 is limited to a subset of type 2
(fast) fibres
3
. We have previously demon-
strated absence of α-actinin-3 in muscle
biopsies from several patients with mus-
cular dystrophy
3
. A follow-up study iden-
tified additional α-actinin-3−negative
biopsies from neuromuscular patients
with other known diseases, suggesting
that this deficiency was not the primary
cause of muscle weakness
4
. Subsequently,
we screened muscle specimens with dys-
trophic (118 specimens), myopathic (74),
neurogenic (20) and normal (55) features
(Fig. 1a−d). Although these biopsies con-
tained normal α-actinin-2 expression,
deficiency of α-actinin-3 was identified
by immunocytochemistry and western
blot in 51 of 267 cases (19%), a finding
not associated with any particular histo-
pathological or clinical phenotype. To
ascertain whether α-actinin-3 deficiency
was associated with mutations of ACTN3,
we used an RT-PCR approach to amplify
mRNA isolated from diagnostic muscle
biopsies. Using primer pairs AB16/AB9
(5´–GATGGTTATGCAGCCCGAGG–3´
and 5´–AGCAACGCCCGCACCTCCT–3´)
and AB8/AB1 (5´–TGCACGAAGCCTG-
GACCC–3´ and 5´–AGAGAGGGATCTT-
TATTCAG–3´), we PCR-amplified two
overlapping fragments encompassing
bases 24−2,852 of ACTN3 mRNA (ref. 2).
Initially, we focused on one family with
two affected male siblings with congeni-
tal muscular dystrophy and complete
deficiency of α-actinin-3. Sequencing of
ACTN3 cDNA from the proband identi-
fied two changes relative to controls and
the previously determined sequence
M86407. These were an A→G transition
at nt 1,586 in exon 15, changing a gluta-
mine (CAG) to an arginine (CGG) at
residue 523 (Q523R), and a C→T trans-
version at position 1,747 in exon 16, con-
verting an arginine to a stop codon at
residue 577 (R577X; Fig. 1e−g). Direct
sequencing of genomic DNA from the
proband and the affected sibling con-
firmed homozygosity for both point
mutations. Subsequent testing of the par-
ents and two unaffected siblings revealed
that these phenotypically normal indi-
viduals had the same genotype as the
proband and were thus homozygous for
the ACTN3577X nonsense mutation.
The R577X change creates a novel DdeI
site (Fig. 1h). An additional 125 biopsies
for which matched DNA samples were
available were tested for α-actinin-3
expression and ACTN3 genotype (48 α-
actinin-3−deficient and 77 α-actinin-3−
positive biopsies with a mixture of
histological and clinical phenotypes).
Homozygosity for the stop codon at posi-
tion 577 was identified in 46 of 48 (96%)
cases in which α-actinin-3 staining was
negative. In the two remaining cases, the
genotype was 577R/577X; however, fibre
typing of both muscle biopsies demon-
strated a type 1 fibre predominance, with
less than 5% type 2 fibres. Thusα-actinin-
3 deficiency in these two discordant cases
is likely a secondary phenomenon due to
loss of type 2 fibres
5
. There was no signifi-
cant difference in the frequency of
homozygous null genotypes among
patients with dystrophic, myopathic, neu-
rogenic or normal biopsies, and α-
actinin-3 deficiency did not alter
A common nonsense mutation
results in α-actinin-3 deficiency
in the general population
Fig. 1 Molecular analysis of α-actinin-3 genes and proteins. Indirect immunofluorescence (a−c) and western-
blot analysis (d) of human skeletal muscle (quadriceps muscle biopsy with normal histology) using affinity
purified antibodies (5B) specific for α-actinin-3 (a,c; refs 3,8) and mouse myosin heavy chain (fast, MY32)
specific for type 2 fibres (b). Methodology as described in North and Beggs
3
. Normal expression of α-actinin-
3 is restricted to type 2 (fast) fibres (a) as indicated by double staining with MY32 (b). Corresponding fibres
in each section are indicated by the same symbol. c, Complete deficiency of α-actinin-3 in a patient homozy-
gous for the stop codon in exon 16 (577X). d, Western-blot analysis of α-actinin-3 in skeletal muscle from
individuals with normal α-actinin-3 expression (genotype 577R/577X; lanes 1,3) and α-actinin-3 deficiency
(genotype 577X/577X; lanes 2,4). α-actinin-3 migrates at approximately 100 kD. The ACTN3 577X allele
encodes a truncated 66-kD protein, which is thought to be incapable of dimerization
10
. Since the anti-α-
actinin-3 5B antibody is directed towards the amino terminus of the protein
3,8
, it should detect the trun-
cated protein if it is stable. All individuals homozygous for the stop codon demonstrated complete absence
of detectable α-actinin-3 by immunocytochemistry, and there was no evidence of the truncated protein in
577R/X or 577X/X individuals on western blots. e,f,g,h, DNA sequence and restriction endonuclease analysis
of ACTN3 exon 16 demonstrating the three possible ACTN3 genotypes at position 577. Products were either
directly sequenced (e−g) or subjected to DdeI digestion and agarose gel electrophoresis (h).
e
f
g
h
d
b
a
c
© 1999 Nature America Inc. • http://genetics.nature.com
© 1999 Nature America Inc. • http://genetics.nature.com
correspondence
354 nature genetics • volume
21 •
april
1999
fibre-type distribution in control muscle.
None of the 77 α-actinin-3−positive
biopsies were from 577X homozygotes
(53 were heterozygous and the remaining
24 individuals were homozygous ‘wild
type’ 577R/577R). These data suggest that
hereditary α-actinin-3 deficiency is com-
mon and may not be associated with an
abnormal neuromuscular phenotype.
To determine the frequency and ethnic
distribution of the ACTN3 577X allele in the
general population, we genotyped an addi-
tional 485 DNA samples. The relative allele
frequency of 577X ranged from 0.22±0.05
to 0.52±0.04 in ethnic populations from
Asia and the Americas, Australasia, Africa
and Europe (data not shown). Approxi-
mately 16% of the world population are
predicted to have congenital deficiency of
α-actinin-3, suggesting that other factor(s)
likely compensate for its absence at the Z
lines of skeletal muscle fast fibres.
Individuals genotyped for R577X were
also genotyped for Q523R (which creates
a novel MspI site). Fifteen 523Q/577X and
thirteen 523R/577R halotypes were
detected among the 674 alleles from 337
subjects who were homozygous for at least
one of the loci. The remaining ACTN3
haplotypes were all either 523Q/577R or
523R/577X. Tests for linkage disequilib-
rium
6
, using maximum likelihood esti-
mates of haplotype frequencies, were
significant in all populations (P<10
–5
,
except in a small Bantu sample where
P<0.05). Thus, 577X likely results from a
single mutational event and not from
multiple independent mutations in differ-
ent chromosomal backgrounds. Although
we can not rule out some subtle selective
pressure keeping these alleles together, it
appears unlikely that the 577X protects
against a deleterious effect of 523R, as all
13 individuals with 523R/577R haplotypes
(including one of the authors) were phe-
notypically normal.
The high allelic frequency of ACTN3
577X in the general population demon-
strates that this stop codon is a non-path-
ogenic polymorphism in humans.
Absence of a structural protein caused by
homozygosity for a null mutation cannot
be assumed to be disease-related without
additional family and population data.
These findings should also prompt re-
evaluation of previous studies describing
apparent loss of fast-fibre α-actinin in
patients with Duchenne muscular dystro-
phy
5
. The high frequency of α-actinin-3
deficiency and absence of an obvious asso-
ciated disease phenotype suggests that α-
actinin-3 is functionally redundant in
humans. Although mouse studies have
identified a number of genes whose
homozygous null mutant phenotypes are
apparently normal, genetic redundancy is
not a well-characterized phenomenon in
humans
7
. We propose that α-actinin-2,
which is structurally and functionally
highly similar to α-actinin-3 (Table 1;
refs 2,8), is able to compensate for α-
actinin-3 absence in type 2 (fast) fibres.
On the other hand, ACTN3 has been
highly conserved over a long period of
evolutionary time, implying a constraint
on evolutionary rate imposed by contin-
ued functioning of the gene (Table 1). The
force-generating capacity of type-2 mus-
cle fibres at high velocity, the speed and
tempo of movements and the capacity of
an individual to adapt to exercise training
are all genetically influenced
9
. Although
we have not yet identified any subtle phe-
notypes associated with α-actinin-3 defi-
ciency, ACTN3 genotype may be one of
the factors that influence normal variation
in muscle function, both within patient
groups (that is, as a disease-modifying
locus) and in the general population.
Acknowledgements
We thank S. Kim and H.-Q. Tong for technical
assistance, M. Ettore for help with ACTN3
genotyping and P. Gunning, L. Kunkel and J.
Scharf for their suggestions and critical reading
of the manuscript. The authors acknowledge a
gift of anonymous DNA samples from D. Bing
and R. Houranieh at the Boston Center for
Blood Research. This work was supported by an
RACP Glaxo Wellcome Australia Fellowship to
K.N.N. and by grants from the Muscular
Dystrophy Association and the National
Institutes of Health (NIAMS R01 AR44345
and K02 AR02026) to A.H.B.
Kathryn N. North
1,2
, Nan Yang
1
,
Duangrurdee Wattanasirichaigoon
3
,
Michelle Mills
1
, Simon Easteal
4
& Alan H. Beggs
3
1
Neurogenetics Research Unit, Royal Alexandra
Hospital for Children, Sydney, N.S.W., Australia.
2
Department of Paediatrics and Child Health,
University of Sydney, Sydney, N.S.W., Australia.
3
Genetics Division, Children’s Hospital, Harvard
Medical School, Boston, Massachusetts, USA.
4
Human Genetics Group, John Curtin School of
Medical Research, Australian National
University, Canberra, A.C.T., Australia.
Correspondence should be addressed to K.N.N.
(e-mail: kathryn@nch.edu.au).
1. Blanchard, A., Ohanian, V. & Critchley D. J. Muscle
Res. Cell Motil. 10, 280–289 (1989).
2. Beggs, A.H. et al. J. Biol. Chem. 267, 9281–9288
(1992).
3. North, K.N. & Beggs, A.H. Neuromuscul. Disord. 6,
229–235 (1996).
4. Vainzof, M. et al. Neuropediatrics 28, 223–228
(1997).
5. Minetti, C., Ricci, E. & Bonilla, E. Neurology 41,
1977–1981 (1991).
6. Slatkin, M. & Excoffier, L. Heredity 76, 377–383
(1996).
7. Cooke, J. et al. Trends Genet. 13, 360–364 (1997).
8. Chan, Y.-m. et al. Biochem. Biophys. Res. Comm.
248, 134–139 (1998).
9. Simoneau, J.-A. & Bouchard, C. in Paediatric
Anaerobic Performance (ed. Van Praagh, E.) 5−21
(Human Kinetics Publishers, Champaign, Illinois,
1998).
10. Flood, G., Rowe, A.J., Critchley, D.R. & Gratzer, W.B.
Eur. Biophys. J. 25, 431–435 (1997).
11. Li, W.-H. J. Mol. Evol. 36, 96–99 (1993).
12. Kimura, M. J. Mol. Evol. 16, 111–120 (1980).
Table 1 • Sequence conservation of α-actinin genes
Gene chk Actn2 hum ACTN2 hum ACTN3 hum ACTN4
chk Actn2 2.9±0.4 14.2±0.9 14.9±0.9
hum ACTN2 117.6±10.2 13.6±0.9 14.8±0.9
hum ACTN3 261.2±88.1 143.7±19.5 17.3±1.0
hum ACTN4 230.1±53.3 146.4±20.2 98.0±10.6
Numbers of nucleotide substitutions, and their standard errors, per 100 synonymous sites (above diago-
nal) and per 100 nonsynonymous sites (below diagonal) between indicated α-actinin genes (estimated as
described
11
, with correction for multiple substitution using the two parameter method
12
). chk
Actn2=X13874; hum ACTN2=M86406; hum ACTN3=M86407; hum ACTN4=D89980. The substitution rate
per nonsynonymous site
11
between human (hum) ACTN2 and ACTN3 is 1.43, whereas the rate per syn-
onymous site is only 0.14. Similar results are obtained for the comparison between both human and
chicken (chk) ACTN2 genes. This implies that the proteins encoded by both genes have evolved very
slowly since their divergence.
© 1999 Nature America Inc. • http://genetics.nature.com
© 1999 Nature America Inc. • http://genetics.nature.com
... The variant of the ACTN3 R577X gene is recognized as a nonsense mutation, specifically occurring in codon 577 of exon 16, where the arginine codon production is altered to a premature stop codon through the translation at nucleotide position 1747 (North et al. 1999). Homozygosity for the prevalent polymorphism of a single null nucleotide in the ACTN3 gene causes full deficiency of the a-actinin-3 protein in the estimated 18% of humans all over the world (North et al. 1999). ...
... The variant of the ACTN3 R577X gene is recognized as a nonsense mutation, specifically occurring in codon 577 of exon 16, where the arginine codon production is altered to a premature stop codon through the translation at nucleotide position 1747 (North et al. 1999). Homozygosity for the prevalent polymorphism of a single null nucleotide in the ACTN3 gene causes full deficiency of the a-actinin-3 protein in the estimated 18% of humans all over the world (North et al. 1999). The null and wild-type mutations for the ACTN3 R577X variant are characterized by X and R alleles, respectively. ...
... The null and wild-type mutations for the ACTN3 R577X variant are characterized by X and R alleles, respectively. The R allele codes ACTN3 gene producing aactinin-3 protein, while the X allele contains a series of changes that completely stops the production of the functional a-actinin-3 protein (North et al. 1999). MacArthur et al. (2007) stated that losing ACTN3 protein alters the metabolism of skeletal muscle to aerobic metabolism with higher efficiency. ...
ACTN3 R577X variant: could it be a determinant of sports performance in elite athletes in a Turkish population?
Article
Full-text available
  • Jun 2022
ACTN3 gene, which encodes α-actinin-3 and actin-binding protein, has been found to be associated with strong athletic performance, especially among track and field athletes. Therefore, in this study, our aim was to compare the allelic and genotype frequencies of the ACTN3 R577X variant among elite athletes specialized in different branches, and nonathletic controls in Turkey. In the present study, 316 subjects, including 168 athletes and 148 sedentary controls were genotyped for the ACTN3 R577X variant. Genotyping was conducted by polymerase chain reaction (PCR) method. Additionally, we evaluated the groups by dividing them as females and males. There were 48 females and 120 males in the athletes group, and 43 females and 105 males in the control group. Genetic associations were evaluated by chi-squire test or Fisher’s exact test. There was a significant difference between the athletes and controls in terms of the ACTN3 R577X variant. ACTN3 RR and XX genotypes increased in the controls compared to the athletes, while RX genotype was higher in the athletes than the controls (P = 0.030). Then we evaluated the groups by separating them as females and males. Genotype distribution of the ACTN3 R577X differed between the male athletes and the male controls (P = 0.046). ACTN3 R577X RX genotype increased in the male athletes compared to the male control (P = 0.046). But ACTN3 R577X genotype and allele distribution was not significant between female athletes and female control group (P > 0.05). As far as we know, this study is the largest series examining the ACTN3 R577X variant in Turkish athletes. Our results support that the ACTN3 R577X variant has a heterozygous advantage in athletic performance in the Turkish population. However, epigenetic, gene–gene and gene–environment interactions affects athlete performance should not be forgotten.
... Around 16% of humans lack α-actinin-3, due to a homozygosity for a common polymorphism in the ACTN3 gene. This single gene polymorphism has been subject to strong positive selection during the last 50,000-60,000 years corresponding to the migration of modern humans from the African continent [1,2]. Intriguingly, two recent publications suggest that a major positive selection pressure may have been the fact that the α-actinin-3 polymorphism improves an individual's cold acclimatisation [3,4]. ...
... Fast-twitch muscles express their own isoform of α-actinin, α-actinin-3. Globally, ~ 1.6 billion people have a polymorphism (R577X) in the ACTN3 gene which means they cannot produce the protein α-actinin-3 in their fasttwitch muscles [2]; in these people, α-actinin-2 is upregulated to (partially) compensate for the loss. We have generated an Actn3KO mouse model to study the morphological and contractile consequences of the absence of α-actinin-3 from fast-twitch muscles. ...
Absence of the Z-disc protein α-actinin-3 impairs the mechanical stability of Actn3KO mouse fast-twitch muscle fibres without altering their contractile properties or twitch kinetics
Article
Full-text available
  • Jun 2022
Background A common polymorphism (R577X) in the ACTN3 gene results in the complete absence of the Z-disc protein α-actinin-3 from fast-twitch muscle fibres in ~ 16% of the world’s population. This single gene polymorphism has been subject to strong positive selection pressure during recent human evolution. Previously, using an Actn3KO mouse model, we have shown in fast-twitch muscles, eccentric contractions at L0 + 20% stretch did not cause eccentric damage. In contrast, L0 + 30% stretch produced a significant ~ 40% deficit in maximum force; here, we use isolated single fast-twitch skeletal muscle fibres from the Actn3KO mouse to investigate the mechanism underlying this. Methods Single fast-twitch fibres are separated from the intact muscle by a collagenase digest procedure. We use label-free second harmonic generation (SHG) imaging, ultra-fast video microscopy and skinned fibre measurements from our MyoRobot automated biomechatronics system to study the morphology, visco-elasticity, force production and mechanical strength of single fibres from the Actn3KO mouse. Data are presented as means ± SD and tested for significance using ANOVA. Results We show that the absence of α-actinin-3 does not affect the visco-elastic properties or myofibrillar force production. Eccentric contractions demonstrated that chemically skinned Actn3KO fibres are mechanically weaker being prone to breakage when eccentrically stretched. Furthermore, SHG images reveal disruptions in the myofibrillar alignment of Actn3KO fast-twitch fibres with an increase in Y-shaped myofibrillar branching. Conclusions The absence of α-actinin-3 from the Z-disc in fast-twitch fibres disrupts the organisation of the myofibrillar proteins, leading to structural weakness. This provides a mechanistic explanation for our earlier findings that in vitro intact Actn3KO fast-twitch muscles are significantly damaged by L0 + 30%, but not L0 + 20%, eccentric contraction strains. Our study also provides a possible mechanistic explanation as to why α-actinin-3-deficient humans have been reported to have a faster decline in muscle function with increasing age, that is, as sarcopenia reduces muscle mass and force output, the eccentric stress on the remaining functional α-actinin-3 deficient fibres will be increased, resulting in fibre breakages.
... The human ACTN3 gene encodes α-actinin-3, an actin-binding protein with a structural role at the sarcomeric Z-line in glycolytic (type II, fast-twitch) muscle fibres, and plays an important role in muscle metabolism regulation [127]. A common genetic SNP at codon 577 of ACTN3 (rs1815739) results in the replacement of arginine (R) with a stop codon (X) [128]. The R allele is the normal functional version of the gene, whereas the X allele contains a sequence change that completely stops production of a functional protein [128]. ...
... A common genetic SNP at codon 577 of ACTN3 (rs1815739) results in the replacement of arginine (R) with a stop codon (X) [128]. The R allele is the normal functional version of the gene, whereas the X allele contains a sequence change that completely stops production of a functional protein [128]. Therefore, ACTN3 knockout (KO) mouse exhibit reduced muscle mass, mainly due to the decreased diameter of fast muscle fibres, significant decrease in grip strength, higher endurance and a shift towards increased activity of the mitochondrial oxidative metabolism compared with wild-type mice [129,130]. ...
Genetic characteristics of competitive swimmers: a review
Article
Full-text available
A successful swimming performance is a multi-factorial accomplishment, resulting from a complex interaction of physical, biomechanical, physiological and psychological factors, all of which are strongly affected by the special medium of water as well as by genetic factors. The nature of competitive swimming is unique, as most of the competitive events last less than four minutes. Yet training regimens have an endurance nature (many hours and many kilometres of swimming every day), which makes it impossible to classify swimming by definitions of aerobic-type or anaerobic-type events, as in track and field sports. Therefore, genetic variants associated with swimming performance are not necessarily related to metabolic pathways, but rather to blood lactate transport (MCT1), muscle functioning (IGF1 axis), muscle damage (IL6) and others. The current paper reviews the main findings on the leading 12 genetic polymorphisms (located in the ACE, ACTN3, AMPD1, BDKRB2, IGF1, IL6, MCT1, MSTN, NOS3, PPARA, PPARGC1A, and VEGFR2 genes) related to swimming performance, while taking into consideration the unique environment of this sport.
... ACTN3 encodes for alpha-actinin-3, a protein expressed in type-II muscle fibers, and that has been associated with performance phenotype, including speed, exercise adaptation, exercise recovery, and sporting injury risk [33]. In particular, the R577X (rs1815739), found in our proband, is considered a common polymorphism due to its frequency, even if it causes an alpha-actinin-3 deficiency [34]. It has been estimated that X allele frequency has been positively selected due to humans' migration from Africa to Eurasia, thus suggesting that alpha-actinin-3 deficiency may be beneficial [35]. ...
Combined aCGH and Exome Sequencing Analysis Improves Autism Spectrum Disorders Diagnosis: A Case Report
Article
Full-text available
Background and Objectives: The development and standardization of genome-wide technologies able to carry out high-resolution, genomic analyses in a cost- and time-affordable way is increasing our knowledge regarding the molecular bases of complex diseases like autism spectrum disorder (ASD). ASD is a group of heterogeneous diseases with multifactorial origins. Genetic factors seem to be involved, albeit they remain still largely unknown. Here, we report the case of a child with a clinical suspicion of ASD investigated by using such a genomic high-resolution approach. Materials and Methods: Both array comparative genomic hybridization (aCGH) and exome sequencing were carried out on the family trio. aCGH was performed using the 4 × 180K SurePrint G3 Human CGH Microarray, while the Human All Exon V7 targeted SureSelect XT HS panel was used for exome sequencing. Results: aCGH identified a paternally inherited duplication of chromosome 7 involving the CNTNAP2 gene, while 5 potentially clinically-relevant variants were identified by exome sequencing. Conclusions: Within the identified genomic alterations, the CNTNAP2 gene duplication may be related to the patient’s phenotype. Indeed, this gene has already been associated with brain development and cognitive functions, including language. The paternal origin of the alteration cannot exclude an incomplete penetrance. Moreover, other genomic factors may act as phenotype modifiers combined with CNTNAP2 gene duplication. Thus, the case reported herein strongly reinforces the need to use extensive genomic analyses to shed light on the bases of complex diseases.
... In addition, ACTN3 is attached to the other sarcomeric proteins, such as desmin (Seto et al., 2011) and is exclusively expressed in the type II muscle fibers while another isoform, ACTN2, occurs in all the fiber types (Mills et al., 2001). The occurrence of a non-sense polymorphism in the ACTN3 gene at position 1,747 of exon 16 converts the 577 residual into a stop codon (R577X), which results in the synthesis of a non-functional form of the ACTN3 and an upregulation of ACTN2 synthesis in the type II muscle fibers (North et al., 1999;Virel and Backman, 2004). ...
The Impact of ACTN3 Gene Polymorphisms on Susceptibility to Exercise-Induced Muscle Damage and Changes in Running Economy Following Downhill Running
Article
Full-text available
  • Nov 2021
This study aimed to investigate if ACTN3 gene polymorphism impacts the susceptibility to exercise-induced muscle damage (EIMD) and changes in running economy (RE) following downhill running. Thirty-five healthy men were allocated to the two groups based on their ACTN3 gene variants: RR and X allele carriers. Neuromuscular function [knee extensor isometric peak torque (IPT), rate of torque development (RTD), and countermovement, and squat jump height], indirect markers of EIMD [muscle soreness, mid-thigh circumference, knee joint range of motion, and serum creatine kinase (CK) activity], and RE (oxygen uptake, minute ventilation, blood lactate concentration, and perceived exertion) for 5-min of running at a speed equivalent to 80% of individual maximal oxygen uptake speed were assessed before, immediately after, and 1–4 days after a 30-min downhill run (−15%). Neuromuscular function was compromised ( P < 0.05) following downhill running with no differences between the groups, except for IPT, which was more affected in the RR individuals compared with the X allele carriers immediately (−24.9 ± 6.9% vs. −16.3 ± 6.5%, respectively) and 4 days (−16.6 ± 14.9% vs. −4.2 ± 9.5%, respectively) post-downhill running. EIMD manifested similarly for both the groups except for serum CK activity, which was greater for RR (398 ± 120 and 452 ± 126 U L –1 at 2 and 4 days following downhill running, respectively) compared with the X allele carriers (273 ± 121 and 352 ± 114 U L –1 at the same time points). RE was compromised following downhill running (16.7 ± 8.3% and 11 ± 7.5% increases in oxygen uptake immediately following downhill running for the RR and X allele carriers, respectively) with no difference between the groups. We conclude that although RR individuals appear to be more susceptible to EIMD following downhill running, this does not extend to the changes in RE.
... Intriguingly, this suggests that the R577X polymorphism can have an age related ameliorating effect on muscle pathology in the dystrophinopathies. The polymorphism in the ACTN3 gene occurs in an estimated ∼16% of people worldwide (11,12) resulting in an absence of the protein α-actinin-3 from the Z-discs of fast-twitch fibres. α-Actinin-3 is localized to the Z-discs of fasttwitch muscle fibres cross-linking the actin filaments of adjoining sarcomeres and interacts with a host of metabolic and signalling proteins (13). ...
Loss of α-actinin-3 confers protection from eccentric contraction damage in fast-twitch EDL muscles from aged mdx dystrophic mice by reducing pathological fibre branching
Article
  • Nov 2021
The common null polymorphism (R577X) in the ACTN3 gene is present in over 1.5 billion people worldwide and results in the absence of the protein α-actinin-3 from the Z-discs of fast-twitch skeletal muscle fibres. We have previously reported that this polymorphism is a modifier of dystrophin deficient Duchenne Muscular Dystrophy. To investigate the mechanism underlying this we use a double knockout (dk)Actn3KO/mdx (dKO) mouse model which lacks both dystrophin and sarcomere α-actinin-3. We used dKO mice and mdx dystrophic mice at 12 months (aged) to investigate the correlation between morphological changes to the fast-twitch dKO EDL and the reduction in force deficit produced by an in vitro eccentric contraction protocol. In the aged dKO mouse we found a marked reduction in fibre branching complexity that correlated with protection from eccentric contraction induced force deficit. Complex branches in the aged dKO EDL fibres (28%) were substantially reduced compared to aged mdx EDL fibres (68%) and this correlates with a graded force loss over three eccentric contractions for dKO muscles (~35% after first contraction, ~ 66% overall) compared to an abrupt drop in mdx upon the first eccentric contraction (~73% after first contraction, ~ 89% after three contractions). In dKO protection from eccentric contraction damage was linked with a doubling of SERCA1 pump density the EDL. We propose that the increased oxidative metabolism of fast-twitch glycolytic fibres characteristic of the null polymorphism (R577X) and increase in SR Ca2+ pump proteins reduces muscle fibre branching and decreases susceptibility to eccentric injury in the dystrophinopathies.
The mechanosensitive ion channel PIEZO1 is expressed in tendons and regulates physical performance
Article
  • Jun 2022
How mechanical stress affects physical performance via tendons is not fully understood. Piezo1 is a mechanosensitive ion channel, and E756del PIEZO1 was recently found as a gain-of-function variant that is common in individuals of African descent. We generated tendon-specific knock-in mice using R2482H Piezo1 , a mouse gain-of-function variant, and found that they had higher jumping abilities and faster running speeds than wild-type or muscle-specific knock-in mice. These phenotypes were associated with enhanced tendon anabolism via an increase in tendon-specific transcription factors, Mohawk and Scleraxis, but there was no evidence of changes in muscle. Biomechanical analysis showed that the tendons of R2482H Piezo1 mice were more compliant and stored more elastic energy, consistent with the enhancement of jumping ability. These phenotypes were replicated in mice with tendon-specific R2482H Piezo1 replacement after tendon maturation, indicating that PIEZO1 could be a target for promoting physical performance by enhancing function in mature tendon. The frequency of E756del PIEZO1 was higher in sprinters than in population-matched nonathletic controls in a small Jamaican cohort, suggesting a similar function in humans. Together, this human and mouse genetic and physiological evidence revealed a critical function of tendons in physical performance, which is tightly and robustly regulated by PIEZO1 in tenocytes.
Nonsense Mutations in Eukaryotes
Article
  • May 2022
Integration of Genetic and Phenotyping Data for Sports Medicine
Chapter
  • Apr 2022
Sports medicine has had considerable success in different domains, including injury prevention, disease treatment, and patient recovery. By integrating genetic and phenotype data, this research is primarily utilized to promote the development of sports medicine. Recently, studies have begun to focus on the genetic basis of sports phenotypes, and they have discovered genetic variation underlying these traits. The relationships between genetic variation and phenotype changes in sports medicine, as well as genetic models and databases connected to sports medicine, are examined in detail in this chapter. Furthermore, in the future, exercise prescriptions could be based on this comprehensive analysis and contribute to the creation of personalized healthcare, based on individual differences in genotypes and phenotypes of different populations.
ACTN3 genotype influences masseter muscle characteristics and self‐reported bruxism
Article
  • Nov 2021
Objectives Main aim of the study was to explore the association between genetic polymorphisms in ACTN3 and bruxism. Secondary objectives included masseter muscle phenotypes assessment between bruxers and non-bruxers and according to genetic polymorphisms in ACTN3. Materials and Methods 54 patients undergoing orthognathic surgery for correction of their malocclusion were enrolled. Self-reported bruxism and Temporomandibular disorders status were preoperatively recorded. Saliva samples were used for ACTN3 genotyping. Masseter muscle samples were collected bilaterally at the time of orthognathic surgery to explore the muscle fiber characteristics. Results There were significant differences in genotypes for rs1815739 (R577X nonsense) (P = 0.001), rs1671064 (Q523R missense) (P = 0.005), and rs678397 (intronic variant) (P = 0.001) between bruxers and non-bruxers. Patients with self-reported bruxism presented a larger mean fiber area for types IIA (P = 0.035). The mean fiber areas in individuals with the wild-type CC genotype for rs1815739 (R577X) were significantly larger for type IIA fibers [1394.33 μm² (572.77 μm²)] than in those with the TC and TT genotypes [832.61 μm² (602.43 μm²) and 526.58 μm² (432.21 μm²) (P = 0.014). Similar results for Q523R missense and intronic variants. Conclusions ACTN3 genotypes influence self-reported bruxism in patients with dentofacial deformity through specific masseter muscle fiber characteristics.
Cloning and characterization of two human skeletal muscle alpha-actinin genes located on chromosomes 1 and 11
Article
Full-text available
  • Jun 1992
Conserved sequences of dystrophin, beta-spectrin, and alpha-actinin were used to plan a set of degenerate oligonucleotide primers with which we amplified a portion of a human alpha-actinin gene transcript. Using this short clone as a probe, we isolated and characterized full-length cDNA clones for two human alpha-actinin genes (ACTN2 and ACTN3). These genes encode proteins that are structurally similar to known alpha-actinins with approximately 80% amino acid identity to each other and to the previously characterized human nonmuscle gene. ACTN2 is the human homolog of a previously characterized chicken gene while ACTN3 represents a novel gene product. Northern blot analysis demonstrated that ACTN2 is expressed in both skeletal and cardiac muscle, but ACTN3 expression is limited to skeletal muscle. As with other muscle-specific isoforms, the EF-hand domains in ACTN2 and ACTN3 are predicted to be incapable of binding calcium, suggesting that actin binding is not calcium sensitive. ACTN2 was mapped to human chromosome 1q42-q43 and ACTN3 to 11q13-q14 by somatic cell hybrid panels and fluorescent in situ hybridization. These results demonstrate that some of the isoform diversity of alpha-actinins is the result of transcription from different genetic loci.
Unbiased estimation of the rates of synonymous and nonsynonymous substitution
Article
  • Mar 1993
The current convention in estimating the number of substitutions per synonymous site (K S ) and per nonsynonymous site (K A ) between two protein-coding genes is to count each twofold degenerate site as one-third synonymous and two-thirds nonsynonymous because one of the three possible changes at such a site is synonymous and the other two are nonsynonymous. This counting rule can considerably overestimate theK S value because transitional mutations tend to occur more often than transversional mutations and because most transitional mutations at twofold degenerate sites are synonymous. A new method that gives unbiased estimates is proposed. An application of the new and the old method to 14 pairs of mouse and rat genes shows that the new method gives aK S value very close to the number of substitutions per fourfold degenerate site whereas the old method gives a value 30% higher. Both methods give aK A value close to the number of substitutions per nondegenerate site.
Human Skeletal Muscle-Specific α-Actinin-2 and -3 Isoforms Form Homodimers and Heterodimersin Vitroandin Vivo
Article
  • Jul 1998
α-actinins belong to a family of actin-binding and crosslinking proteins and are expressed in many different cell types. Multiple isoforms of α-actinin are found in humans and are encoded by at least four distinct genes. Human skeletal muscle contains two sarcomeric isoforms, α-actinin-2 and -3. Previous studies have shown that the α-actinins function as anti-parallel homodimers but the question of heterodimer formation between two different isoforms expressed in the same cell type has not been explored. To address this issue, we expressed both α-actinin-2 and -3in vitroand were able to detect their interaction by both blot overlay and co-immunoprecipitation methods. We were also able to demonstrate the presence of heterodimersin vivoin human skeletal muscle and in COS-1 cells transiently transfected with both isoforms. Our results clearly demonstrate the potential for α-actinin isoforms to form heterodimers which might have unique functional characteristics.
Further analysis of the role of spectrin repeat motifs in α-actinin dimer formation
Article
  • May 1997
Protein constructs consisting of repeats 1–4, repeats 1–3 and repeats 2–4 of the rod domain of chicken α-actinin were expressed as fusion proteins in Escherichia coli. Based on the evidence of circular dichroism spectra and cooperative thermal unfolding profiles both truncated rod fragments were judged to have assumed the native structural fold. The thermal stabilities were in both cases significantly lower than that of the intact rod (repeats 1–4). Analyses by sedimentation equilibrium and velocity provided further evidence to show that fragment 1–4 is entirely dimeric in the concentration range of these experiments, resembling therefore the rod domain isolated by proteolytic digestion of native α-actinin. Fragment 2–4, and probably also 1–3, show concentration-dependent association, with dissociation constants, estimated by sedimentation equilibrium, in the 1–10 µM range. Thus, in confirmation of earlier work, all four repeats are re-quired to generate a maximally stable anti-parallel dimer (Kd∼10 pM), suggesting the presence of binding sites in all of them to allow for aligned pairing.
The structure and function of ??-actinin
Article
  • Jan 1989
Progressive depletion of fast alpha-actinin-positive muscle fibers in Duchenne muscular dystrophy
Article
  • Jan 1992
In normal human muscle, a monoclonal antibody against alpha-actinin recognizes an isoform that is only expressed in a population of fast fibers histochemically identified as type IIb or fast-twitch glycolytic. Immunohistochemical studies of muscle biopsies from patients with Duchenne muscular dystrophy (DMD) showed that the number of alpha-actinin-positive type IIb fibers was essentially normal in preclinical patients. Symptomatic patients between the ages of 3 and 5 years showed depletion of these fibers, which were not seen in patients older than 5 years. ATPase histochemistry showed that a few type IIb fibers were present in muscle from symptomatic DMD patients but lacked the fast isoform of alpha-actinin. The data suggest that type IIb fibers are affected early in DMD.
The structure and function of alpha-actinin
Article
  • Sep 1989
A Simple Method for Estimating Evolutionary Rate of Base Substitutions Through Comparative Studies of Nucleotide Sequences
Article
  • Jan 1981
Some simple formulae were obtained which enable us to estimate evolutionary distances in terms of the number of nucleotide substitutions (and, also, the evolutionary rates when the divergence times are known). In comparing a pair of nucleotide sequences, we distinguish two types of differences; if homologous sites are occupied by different nucleotide bases but both are purines or both pyrimidines, the difference is called type I (or "transition" type), while, if one of the two is a purine and the other is a pyrimidine, the difference is called type II (or "transversion" type). Letting P and Q be respectively the fractions of nucleotide sites showing type I and type II differences between two sequences compared, then the evolutionary distance per site is K = -(1/2) ln [(1-2P-Q) square root of 1-2Q]. The evolutionary rate per year is then given by k = K/(2T), where T is the time since the divergence of the two sequences. If only the third codon positions are compared, the synonymous component of the evolutionary base substitutions per site is estimated by K'S = -(1/2) ln (1-2P-Q). Also, formulae for standard errors were obtained. Some examples were worked out using reported globin sequences to show that synonymous substitutions occur at much higher rates than amino acid-altering substitutions in evolution.
Testing for linkage disequilibrium in genotypic data using the Expectation-Maximization algorithm
Article
We generalize an approach suggested by Hill (Heredity, 33, 229-239, 1974) for testing for significant association among alleles at two loci when only genotype and not haplotype frequencies are available. The principle is to use the Expectation-Maximization (EM) algorithm to resolve double heterozygotes into haplotypes and then apply a likelihood ratio test in order to determine whether the resolutions of haplotypes are significantly nonrandom, which is equivalent to testing whether there is statistically significant linkage disequilibrium between loci. The EM algorithm in this case relies on the assumption that genotype frequencies at each locus are in Hardy-Weinberg proportions. This method can accommodate X-linked loci and samples from haplodiploid species. We use three methods for testing significance of the likelihood ratio: the empirical distribution in a large number of randomized data sets, the X2 approximation for the distribution of likelihood ratios, and the Z2 test. The performance of each method is evaluated by applying it to simulated data sets and comparing the tail probability with the tail probability from Fisher's exact test applied to the actual haplotype data. For realistic sample sizes (50-150 individuals) all three methods perform well with two or three alleles per locus, but only the empirical distribution is adequate when there are five to eight alleles per locus, as is typical of hypervariable loci such as microsatellites. The method is applied to a data set of 32 microsatellite loci in a Finnish population and the results confirm the theoretical predictions. We conclude that with highly polymorphic loci, the EM algorithm does lead to a useful test for linkage disequilibrium, but that it is necessary to find the empirical distribution of likelihood ratios in order to perform a test of significance correctly.
Deficiency of a skeletal muscle isoform of ??-actinin-3 in merosin-positive congenital muscular dyrophy
Article
A subset of patients with congenital muscular dystrophy (CMD) are deficient for the extracellular matrix protein, merosin. Although the aetiology of merosin-positive CMD is as yet unknown, abnormalities of other structural muscle-specific proteins are likely to be involved. The alpha-actinins are actin-binding proteins related to dystrophin. We studied expression of the skeletal muscle isoforms of alpha-actinin (alpha-actinin-2 and alpha-actinin-3) in muscle biopsies from 12 patients with pure CMD (including one with a merosin abnormality), two with unclassified CMD and central nervous system (CNS) involvement, and three with other neuromuscular disorders. Four specimens exhibited deficient alpha-actinin-3 staining by immunofluorescence and/or Western blot analysis. In one, this pattern may be a secondary consequence of marked type 1 fibre predominance, but the other three biopsies contained abundant type 2 fibres where alpha-actinin-3 is normally expressed. Three alpha-actinin-3-deficient patients had pure CMD and presented in the newborn period with muscle weakness, hypotonia and arthrogryposis. The fourth had a dystrophic muscle biopsy and CNS involvement. These results suggest that deficiency of alpha-actinin-3 may be a marker for a subset of patients with CMD. It remains to be determined whether the deficiency of alpha-actinin-3 reflects ACTN3 gene mutations or is a secondary phenomenon.