Content uploaded by Edward J Louis
Author content
All content in this area was uploaded by Edward J Louis
Content may be subject to copyright.
The EMBO Journal Vol.18 No.9 pp.2538–2550, 1999
Limitations of silencing at native yeast telomeres
Fiona E.Pryde and Edward J.Louis
1
Department of Biochemistry, University of Oxford, South Parks Road,
Oxford OX1 3QU, UK
1
Corresponding author
e-mail: elouis@worf.molbiol.ox.ac.uk
Silencing at native yeast telomeres, in which the sub-
telomeric elements areintact,isdifferent fromsilencing
at terminal truncations. The repression of URA3
inserted in different subtelomeric positions at several
chromosome ends was investigated. Many ends exhibit
very little silencing close to the telomere, while others
exhibit substantial repression in limited domains.
Silencing at native ends is discontinuous, with maximal
repression found adjacent to the ARS consensus
sequence in the subtelomeric core X element. The
level of repression declines precipitously towards the
centromere. Mutation of the ARS sequence or an
adjacent Abf1p-binding site significantly reduces
silencing. The subtelomeric Y9 elements are resistant
to silencing along their whole length, yet silencing can
be re-established at the proximal X element. Deletion
of PPR1, the transactivator of URA3, and SIR3 over-
expression do not increase repression or extend
spreading of silencing to the same extent as with
terminally truncated ends. sir1∆ causes partial de-
repression at X-ACS, in contrast to the lack of effect
seen at terminal truncations. orc2-1 and orc5-1 have
no effect on natural silencing yet cause derepression
at truncated ends. X-ACS silencing requires the prox-
imity of the telomere and is dependent on SIR2, SIR3,
SIR4 and HDF1. The structures found at native yeast
telomeres appear to limit the potential of repressive
chromatin.
Keywords: native telomeres/proto-silencers/silencing/
X elements/Y9 elements
Introduction
Epigenetic ‘silencing’ of genes occurs at a number of
different genomic locations in the yeast Saccharomyces
cerevisiae: the silent mating-type loci HML and HMR,
close to telomeres, and within the tandem rDNA array (see
Sherman and Pillus, 1997; Lustig, 1998). Transcriptional
repression appears to be due to a specialized chromatin
structure in these regions. Several proteins are involved
in repressive chromatin, including the histones H3 and
H4, their associated acetylases and deacetylases, the silent
information regulators SIR1–SIR4 and the yeast origin
recognition complex (ORC). Some proteins have roles in
all of the domains, while others are more specific to
particular regions (reviewed in Sherman and Pillus, 1997).
Silencing at telomeres, or telomere position
2538
© European Molecular Biology Organization
effect (TPE),was first described using a terminal truncation
that places URA3 adjacent to a newly formed TG
1–3
tract,
resulting in a deletion of all of the subtelomeric sequences
normally found at yeast chromosome ends (Gottschling
et al., 1990). The best studied of these is at ADH4 on
chromosome VII-L. The main features of silencing at this
truncation and others of a similar nature include variegated
expression; repression spreading continuously from the
terminus, diminishing with increasing distance from the
terminus; dependence on many of the genetic components
of silencing at HML and HMR; lack of dependence on
SIR1; sensitivity to the overexpression of SIR3 and other
silencing factors; and sensitivity to loss of the URA3
transactivating factor PPR1 (Gottschling et al., 1990;
Aparicio et al., 1991; Renauld et al., 1993; Aparicio and
Gottschling, 1994). Several models have been proposed
to explain TPE. Most involve the interaction of Sir2p/3p/
4p complexes with Rap1p at the TG
1–3
, and with phased
nucleosomes in the adjacent sequences (Grunstein, 1997,
1998; Wotton and Shore, 1997). Propagation of Sir3p and
subsequently other silencing factors along the adjacent
sequences, and the lability of this chromatin state, result
in the variegated expression of genes in the vicinity.
Recent work indicates a role for non-homologous end-
joining proteins (Hdf1p, Hdf2p, Rad50p, Mre11p and
Xrs2p) in TPE (Boulton and Jackson, 1998; Laroche et al.,
1998) and/or telomere maintenance (Porter et al., 1996;
Gravel et al., 1998; Nugent et al., 1998; Polotnianka
et al., 1998).
Native chromosome ends in S.cerevisiae have a number
of subtelomeric repeat elements, which vary between ends
and strains. These include the Y9 element, several small
elements designated subtelomeric repeats (STRs) A, B, C
and D, and the 473 bp core X element (Louis et al., 1994;
Pryde et al., 1995). Core X is the only repeat sequence
that is found at all ends and, interestingly, it contains
several potentially functional sequences. These include an
ACS (ARS consensus sequence, the binding site for the
yeast ORC) in all cases, and an Abf1p-binding site at 31
out of 32 ends. These are two of the three elements found
at the HM silencers, with the third element (Rap1p-binding
sites) being found within the telomeric repeat sequences
nearby. In addition to the known elements of HM silencers,
there are also binding sites forthe telomere-binding protein
Tbf1p in the STR elements (Brun et al., 1997).
The question remains as to the nature of telomeric
silencing at native ends. Is it the same as that observed
with modified truncated ends or, given the presence of
core X, is it perhaps more like that found at the HM loci?
A number of genes involved in carbon source utilization,
such as the SUC, MAL and MEL gene families, are
subtelomeric in location and are expressed (reviewed in
Pryde and Louis, 1997). Previous studies in this laboratory
found very little, if any, silencing within the Y9 elements
Natural silencing at yeast telomeres
(Louis and Haber, 1990; Louis, 1995). However, a recent
study suggests that natural telomeric silencing can occur
(Vega-Palas et al., 1997, 1998). A Ty-5 element that is
located 1.8 kb from the telomere of chromosome III-L is
expressed at very low levels in wild-type strains, with the
repression being SIR3 dependent.
The work presented here describes the nature of telo-
meric silencing at native ends. URA3 was introduced at
several subtelomeric locations on different chromosome
ends and levels of silencing determined at each of these
locations. The effects of mutations within the core X-ACS
and Abf1p-binding site are determined and the role of SIRs,
ORC2, ORC5 andHDF1 areexamined. In conjunction with
Fourel et al. (1999), we can conclude that there are proto-
silencers in the native subtelomeric regions that limit
the domain and level of repressive chromatin at yeast
telomeres, as well as potential insulating elements.
Results
Substantial silencing is seen at some ends which
do not have a Y
9
element, while others exhibit
little repression
A series of isogenic strains was created, in which URA3
was integrated into the subtelomeric region of a number
of chromosome ends which do not have a Y9 element
(hereafter termed X-only ends). In each case, URA3 is
orientated such that transcription proceeds towards the
telomere. Transcriptional repression of the marker gene
was determined by measuring the fraction of cells that
were able to grow on plates containing 5-fluoro-orotic
acid (5-FOA). Cells that are expressing the URA3 gene
product are killed when grown on 5-FOA, thus selecting
for those cells in which the gene is not functioning (Boeke
et al., 1984). Only those 5-FOA-resistant colonies that
were able to grow when replica plated onto media lacking
uracil, confirming that the resistance phenotype was due
to silencing rather than mutation of the URA3 gene, were
counted. Telomeric repression was also measured in a
control strain containing URA3 at a terminally truncated
chromosome VII-L. The average frequency of silencing
observed in this strain was 58%, which is similar to that
observed in previous studies (Gottschling et al., 1990;
Renauld et al., 1993).
The levels of silencing observed at each chromosomal
position are presented in Figure 1A and B. Also plotted
on Figure 1A are the frequencies of 5-FOA resistance
observed at V-R and VII-L in previous studies (taken
from Gottschling et al., 1990; Renauld et al., 1993) and
the gradients of repression at each end. The V-R and
VII-L ends are truncated and lack native subtelomeric
sequences. The results indicate that there are two classes
of telomeric silencing at X-only ends. Three out of six
ends (X-R, IV-L and III-R) which have URA3 integrated
at position 1 displayed levels of silencing of ,1%
(Figure 1B). At position 1, the promoter is ~1.75 kb
centromere-proximal to the TG
1–3
sequence and ~1 kb
centromere-proximal to the core X-ACS sequence. How-
ever, at the remaining three ends (XIII-R, XI-L and II-R),
levels of silencing at this position are ~100-fold higher,
similar to the levels observed at terminal truncations. A
high level of repression is also seen on chromosome XIV-
2539
R when URA3 is integrated at position 2, indicating that
this end is also a member of the strongly silenced class.
There is a limited domain of repression centering
on the X-ACS
In contrast to silencing at truncated ends, the region of
repression at native telomeres is very limited, with silenc-
ing being maximal at position 1 (the X-ACS). 5-FOA
resistance is undetectable at position 3 with weakly
silenced ends, and either very low (,0.002%) or undetect-
able at position 4, with strongly silenced ends (Figure 1A
and B). At terminal truncations, there is a log-linear drop
in silencing of ~1–2 orders of magnitude per kilobase
from the peak of silencing towards the centromere, in
both wild-type and ppr1∆ strains (see Figure 1A). At
native ends, there is a much more precipitous drop. For
example, at XI-L it is 4–5 orders of magnitude per
kilobase, such that silencing becomes undetectable by 2
kb from the X-ACS. This was true even when the URA3
promoter was weakened using a ppr1∆ mutation (see
below and Figure 2C).
Ends with both core X and Y
9
elements also
exhibit silencing near the X-ACS, with low levels
of repression throughout the Y
9
element
A series of isogenic strains was created in which URA3
was integrated at several positions on Y9-containing
chromosome ends (hereafter termed X–Y9 ends); within
the Y9 element itself and at increasing distances internal
to the element. The relationship between the location of
the URA3 reporter gene and levels of silencing is presented
in Figure 1C.
In most strains, frequencies of 5-FOA resistance of
,1% were observed when URA3 was integrated at the
X-ACS. The level decreases with increasing distance
centromere-proximal to core X, and is undetectable by
position 4. The only exception is chromosome IX-L,
which displayed a level of silencing at X-ACS similar to
that observed at strongly silenced X-only ends. This end
is different from all other X–Y9 ends in that it contains a
short stretch of mitochondrial intron DNA at the junction
between core X and the Y9 element, instead of the STR
elements which normally are found within this region
(Louis and Haber, 1991).
Little or no silencing was observed when URA3 was
integrated immediately internal to the TG
1–3
telomere
repeat sequences, placing the promoter ~1 kb from the
telomere (position 9). This structure is essentially the
same as the VII-L terminal truncations previously studied,
with the exception of the presence of the native subtelo-
meric sequences. Frequencies of 5-FOA resistance were
low (,0.01%) or undetectable when the marker gene was
integrated at several other positions within the Y9 element.
Similar results were observed at a number of Y9-containing
ends, including IX-L. This indicates that the strong tran-
scriptional repression seen at IX-L is restricted to the
region immediately centromere-proximal to core X and
that Y9 elements are protected from strong repression.
X-ACS silencing is dependent on sequences within
the core X element
Core X elements contain two of the three sequences found
within HM silencers, namely the ARS consensus sequence
F.E.Pryde and E.J.Louis
and Abf1p-binding site. In order to determine if these
sequences are required for repression at native telomeres,
silencing was measured in isogenic strains carrying either
intact or mutated core X elements, in the strain which
contains URA3 adjacent to the X-ACS of chromosome
XI-L. The mutations introduced an NdeI restriction site
into the ACS or an SphI site into the Abf1p-binding site.
Disabling the core X element significantly affected levels
of silencing, with theAbf1p-binding sitemutation resulting
in a 26-fold reduction in repression, and mutation of the
ACS reducing silencing by two orders of magnitude
(Figure 2A).
Under the hypothesis that proteins essential for native
silencing bind to core X, we tested whether large numbers
of extrachromosomal core X elements could titrate these
proteins and reduce levels of silencing. A high copy
2540
number plasmid containing core X and STR sequences
from XI-L (pFEP33) was transformed into strains con-
taining URA3 either at the X-ACS on XI-L or at a
terminally truncated VII-L end. Increased dosage of core X
caused no differences in levels of silencing between the
wild-type and plasmid-carrying strains in either case (data
not shown).
One subtelomeric region appears to be
inaccessible to transplacement recombination in a
SIR-dependent manner
Initial attempts to integrate URA3 into the core X–STR
junction (position 5) resulted in no correct transformants.
Those transformants that were recovered included conver-
sion of the ura3∆ to URA3 and integration at a number
of genomic locations with rearrangements. This problem
Natural silencing at yeast telomeres
was overcome by transforming into a sir3::kanMX4 strain
and subsequently mating with a SIR3 wild-type strain, by
protoplast fusion. SIR3
1
segregants were obtained for
measurement of silencing. Frequencies of silencing at the
X–STR junction were slightly lower than, but of the same
order as, those observed at the X-ACS at any particular
end (Figure 1B and C). Again, both strong and weak
silencing were observed at X-only ends (Figure 1B, XI-L
versus IX-R).
X-ACS silencing is dependent on SIR1 as well as
on SIR2, -3 and -4
Mutations in SIR2, -3 and -4 completely abolish silencing
at HML, HMR and terminally truncated telomeres (Rine
and Herskowitz, 1987; Aparicio et al., 1991). Mutations
in SIR1 result in partial derepression at the HM loci (Rine
et al., 1979) but have no effect at truncated telomeres
(Aparicio et al., 1991). However, telomeric silencing is
improved when Sir1p is targeted to the telomere (Chien
et al., 1993). The involvement of the Sir proteins in
native telomeric silencing was determined by measuring
frequencies of 5-FOA resistance in isogenic wild-type or
sir∆ strains. These strains contain URA3 integrated at the
X-ACS on chromosome XI-L. Mutations in SIR2 and
SIR4 completely abrogated silencing, within the limits of
the assay (0.00005%), whilst the sir3∆ mutation reduced
Fig. 1. Silencing measured at native subtelomeric locations. For measurement of silencing, cells were grown on non-selective plates and 10-fold
serial dilutions plated onto synthetic complete medium (SC) and medium containing 5-FOA. Examples are presented in Figure 3. The structure of
the subtelomeric region and the locations of the URA3 insertions are shown for X-only and X–Y9 ends. Data points are connected for ends that have
URA3 insertions at most locations. (A) Silencing at the left end of XI (vertical bars) is compared with previous TPE studies at terminal truncations
(Gottschling et al., 1990; Renauld et al., 1993). Maximal repression is seen at the XI-L X-ACS and 500 bp centromere-proximal to this location.
Repression is reduced towards the telomere and drops off precipitously towards the centromere compared with artificial truncations. The gradient of
repression at XI-L (solid line) is significantly steeper than those at terminal truncations (dashed lines). (B) Eight different X-only ends were marked
at various locations with URA3. They appear to fall into two classes, with one set exhibiting substantial repression at the X-ACS region, as with XI-
L. The other set exhibit ,1% silencing, with repression again being maximal at the X-ACS. (C) X–Y9 ends were marked at the same locations as
the X-only ends, as well as at several sites within the Y9 element. Very little repression is seen within Y9s even adjacent to the terminus. Silencing
increases near the X-ACS as seen in X-only ends. The left end of IX, which has an unusual subtelomeric structure at the X–Y9 junction, exhibits
substantial silencing at the X-ACS, 7.5 kb from the terminus, while exhibiting very little within the Y9 element, indicating discontinuous silencing at
this native end. SIR3 overexpression increases silencing within the core X domain at XV-R, but the spread of repressive chromatin is limited (see
text and Figure 2D).
2541
the level of silencing by 2.5310
4
-fold (Figure 2A). Unlike
the terminal truncations, sir1∆ also caused slight derepres-
sion, reducing the level of silencing by ~2-fold (Figure
2A), as seen by Fourel et al. (1999). Although the absolute
5-FOA resistance values are variable over different experi-
ments, a 2-fold reduction was observed consistently
between wild-type and sir1∆ pair-wise measurements. The
sir1∆ and sir3∆ mutations were also introduced into the
VII-L truncated strain. In agreement with previous studies,
sir1∆ had no effect on silencing, while sir3∆ caused
complete loss of repression (Figure 2A).
X-ACS silencing is dependent on HDF1 but not on
ORC2 and ORC5
HDF1, the yeast homologue of mammalian KU70,is
involved in the maintenance and subnuclear organization
of telomeres (Porter et al., 1996; Laroche et al., 1998;
Nugent et al., 1998). It has been shown recently that
mutation of HDF1 results in a disruption of telomere
architecture in yeast, with the foci being spread randomly
throughout the nucleus rather than at their normal peri-
pheral locations (Laroche et al., 1998). Silencing of URA3
at the X-ACS on XI-L was measured in isogenic wild-
type and hdf1∆ strains. The deletion reduced silencing by
~5310
3
-fold (Figure 2B), indicating that HDF1 is required
for native telomeric silencing. It caused a similar level of
F.E.Pryde and E.J.Louis
derepression at a terminally truncated VII-L end, as has
been reported previously (Boulton and Jackson, 1998;
Gravel et al., 1998; Laroche et al., 1998; Polotnianka
et al., 1998).
Silencing was also measured in a series of isogenic
wild-type, orc2-1 or orc5-1 strains containing URA3
integrated at position 1 on chromosome XI-L. Neither of
the ORC mutations had a significant effect on silencing
atnative telomeres(seeFigure 2B).However, as previously
reported (Fox et al., 1995), orc2-1 and orc5-1 mutations
resulted in severe derepression in strains containing the
VII-L truncation.
2542
ppr1 mutation and SIR3 overexpression have
variable effects on native telomeric silencing
Previous studies utilizing terminal truncations have shown
that a ppr1∆ mutation enhances telomeric repression of
URA3 by ~10
2
-to10
3
-fold, and extends the spread of
silencing (Renauld et al., 1993; Aparicio and Gottschling,
1994). To determine if native telomeric silencing was
affected in the same way, a ppr1∆ version of a strain in
which URA3 is integrated at position 4 on XI-L was
constructed. The ppr1∆ mutation did not extend the
spread of repression, with 5-FOA resistance still being
undetectable at position 4, which places the promoter only
Natural silencing at yeast telomeres
1.5 kb proximal to the region of maximal repression
(Figure 2C). The ppr1∆ mutation was also introduced into
strains which contain URA3 immediately internal to the
telomere (position 9) or adjacent to the X-ACS (position 1)
on XV-R. The level of silencing measured at position 9
remained at ~0.001%, but at position 1 it increased to
10% (data not shown).
Overexpression of SIR3 has been shown to significantly
increase silencing close to the telomere (up to 1.5310
5
-
fold), and to extend silencing (.1%) to 16–22 kb from
the telomere at a truncated end (Renauld et al., 1993),
indicating that silencing would be measurable up to 35 kb
from the end. To determine whether increased dosage of
SIR3 could extend silencing at native telomeres, a high
copy number plasmid carrying SIR3 (YEpSIR3) was
introduced initially into strains which contained URA3 at
positions 5 or 4 on XI-L. SIR3 overexpression increased
the frequency of 5-FOA resistance by 2-fold at position 5,
the X–STR junction, and from undetectable to 0.4% at
position 4 (Figure 2C). 5-FOA resistance was also
measured in a ppr1∆ version of the latter strain, with the
same level of repression being detected. Extrapolation of
this frequency from the point of maximum repression
indicates that silencing would be undetectable by 7 kb
from the telomere. SIR3 overexpression therefore does
not spread silencing at strongly silenced native ends to
the same extent as at terminal truncations.
YEpSIR3 was also introduced into a series of strains
in which URA3 is located at varying positions on XV-R,
aY9-containing end (Figures 1C and 2D). Within the
Fig. 2. The genetic requirements of native silencing. Silencing at the X-ACS on XI-L was measured in strains which carried mutations of the ACS-
or Abf1p-binding site in core X. Silencing was also measured in sir1∆, sir2∆, sir3∆, sir4∆, hdf1∆, orc2-1 and orc5-1 genetic backgrounds and
compared with the VII-L terminal truncation in the same backgrounds. The effect of ppr1∆ and SIR3 overexpression was also determined at various
locations. (A) Mutation of the ACS or Abf1p-binding site reduce native silencing by up to two orders of magnitude, with the ACS mutation having
the greater effect. As with the previous TPE studies, native silencing requires SIR2, SIR3 and SIR4. In contrast to the artificial truncations (VII-L),
native silencing is also affected by a mutation in SIR1, which reduces silencing by 2-fold. (B) Silencing at both ends was greatly reduced in the
hdf1∆ background. Native silencing is not affected by the orc2-1 and orc5-1 mutations, while artificial TPE is severely affected in these strain
backgrounds. (C) Increased expression of SIR3 and deletion of PPR1 had little effect on silencing at XI-L. SIR3 overexpression increases the level
of silencing seen at IX-R, a weakly silenced end, but not to the same extent as is seen at terminal truncations. (D) SIR3 overexpression greatly
increases the level of silencing seen at a number of positions on XV-R (an X–Y9 end), and at position 4 on IX-L, although again not to the same
extent as with terminal truncations. Silencing within the Y9 element remains ,1%. Native ends are more resistant to propagation of the repressive
state than previously seen in terminal truncation studies.
2543
Y9 element, SIR3 overexpression increased silencing,
although the frequency of 5-FOA resistance remained
,1%. However, when URA3 was located at the X–STR
junction or adjacent to the X-ACS, silencing increased to
the level that is seenat strongly silenced ends. At position 4
(placing the URA3 promoter 9.5 kb from the telomere, 2
kb from the X-ACS), SIR3 overexpression increased
5-FOA resistance to ~1%. Extrapolation of this frequency
from the point of maximum repression at core X indicates
that the region of detectable silencing would be extended
to 15 kb from the telomere, 7.5 kb from X-ACS. SIR3
overexpression had a similar effect at IX-R, a weakly
silenced X-only end, and IX-L, the strongly silenced
X–Y9 end (see Figure 2C and D).
The X element does not silence independently of
the telomere
It was determined whether the X element could act
independently as a silencer and promote silencing of genes
located at internal locations. PCR fragments containing
the XI-L core X and associated STR sequences, marked
with URA3, were targeted to either LYS4 or LEU2, placing
core X ~400 or 100 kb from the telomere, respectively.
At LYS4, the X element was integrated in the same
orientation with respect to the telomere as it is at the ends,
with the X-ACS centromere proximal to the Abf1p-
binding site. At LEU2, core X was integrated in either
the same or opposite orientation with respect to the
telomeres. In all three cases, 5-FOA-resistant colonies
were undetectable (data not shown).
F.E.Pryde and E.J.Louis
Discussion
Much of what is known about silencing at yeast telomeres
has been determined using terminal truncations of a
specific end, with a tract of newly synthesized TG
1–3
formed adjacent to a marker gene. This has been a valuable
tool for determining a great deal about telomere biology
and chromosome architecture; however, nothing about the
function of silencing or the extent of silencing on a whole
genome level has been elucidated. There are several
paradoxes concerning silencing at yeast telomeres. One is
that the chromosome ends are utilized for gene amplific-
ation in certain situations, and it seems counterproductive
to increase expression by amplification while at the same
time repressing these genes. TPE is highly variable and
unstable, and there does not appear to be any regulation
of the silenced state, unlike that at HML and HMR. What
would be the advantage of silencing if within a few
generations the culture derived from a silenced cell gives
rise to a large fraction of expressing cells and vice versa?
Another paradox is the previous observations that markers
embedded in a subtelomeric Y9 element were not subject
to silencing (Louis, 1995), while markers more proximal
had silencing enhanced if there was an adjacent Y9
(Renauld et al., 1993). This may indicate that some
subtelomeric elements are resistant to silencing without
affecting the adjacent regions.
In this study, we look at the properties of silencing at
native chromosome ends in order to address some of these
paradoxes. Our results show that there is silencing at
native chromosome ends but the domains and levels of
silencing are different from those for artificial terminal
truncations. Native telomeric silencing also differs from
that seen at HML and HMR.
Some ends exhibit very little silencing while
others have substantial silencing
Since core X is structurally similar to the E and I sites of
HML and HMR, we might expect to see high levels of
silencing in this region. In X-only ends, there appear to
be two classes of silencing, with maximal repression
occurring at the X-ACS. Some of these ends exhibit
substantial repression of URA3 adjacent to the core
X-ACS, with levels at least as high as those seen for the
VII-L terminal truncation. Another set of ends exhibit
lower levels at this position (,1% of a culture silenced).
In X–Y9 ends, this location generally exhibits ,1% of
the culture being silenced, with one exception, IX-L,
which is discussed more fully below. The differences are
not an artefact of transformation since multiple trans-
formants were obtained for most locations, with similar
levels of repression being observed for each set of trans-
formants. It is unclear as to why there are two classes of
ends, one of which is protected from high levels of
transcriptional repression. One possibility is that transcrip-
tion of a nearby gene is preventing the spread of silent
chromatin at the weakly silenced ends. However, there is
no correlation between the distance of the closest open
reading frame (ORF) to the telomere and levels of URA3
repression. A second possibility could be the presence of
anti-silencing elements at some ends. The STR elements
have been found to prevent silencing from propagating
proximally at an artificial VII-L truncation (Fourel et al.,
2544
1999). This effect could be ascribed to the binding of
Tbf1p. All of the ends which were marked in this study
were therefore compared for the presence of binding sites
for a number of telomeric proteins, including Rap1p and
Tbf1p. No major differences were found between the two
classes of ends in terms of the number or location of
binding sites. It is possible that there are yet to be identified
anti-silencing elements centromere-proximal to core X at
some ends.
The domain of silencing around the X-ACS is
constrained, with silencing being dependent on
sequences within core X
In both X-only and X–Y9 ends, the levels of silencing
decrease both proximally and distally to the X-ACS (see
Figure 1A–C). This is in contrast to the models of
repression in which the repressive chromatin is propagated
continuously from the telomere. Inaddition, theprecipitous
drop of 4.5–5 orders of magnitude in silencing per kilobase
seen at native ends contrasts sharply with the 1–2 orders
of magnitude per kilobase drop seen in previous studies
with VII-L and V-R terminal truncations. It appears that
there is establishment of a silenced domain at the X-
ACS, which is more limited than that seen for terminal
truncations. This may be due to the similarity of core X
to the E and I silencers of the truly repressed HML and
HMR loci. Indeed, mutation of either the ACS or the
Abf1p-binding site within the core X element led to a
reduction in silencing at the XI-L X-ACS marked end,
with the ACS mutation having the greater effect. This
observation indicates that silencing at native ends involves
the interaction of proteins with the core X element.
Previous studies have shown that the inclusion of the X
element on a plasmid containingtelomere repeat sequences
improved plasmid segregation by ~3 fold. Mutation of the
Abf1p-binding site resulted in a partial reduction of the
increase in stability. Mutation of the ACS converts core
X from a segregation-enhancing element to one which
interferes with plasmid segregation (Enomoto et al., 1994).
It has been shown that the yeast Ty-5 retrotransposons
integrate preferentially within or adjacent to the HM
silencers and adjacent to the X-ACS (Zou et al., 1996),
suggesting a similarity between the chromatin in each of
these domains. Most of the subtelomeric Ty-5s, or their
long terminal repeats (LTRs), lie within 0.8 kb of the
X-ACS, with the remainder falling within 1.5 kb. This
observation supports the proposal that there is a limited
domain of silencing at native ends, centering on the
X-ACS. The SIR3-dependent repression of Ty-5-1 (Vega-
Palas et al., 1997, 1998) is consistent with these results
since its promoter lies 0.75 kb from the III-L X-ACS,
within the domain of repression.
Despite this similarity to HML and HMR in structure
and limitations of repression, the silencing seen at native
ends is still variegated in the sense that the cells appear
to be unstable in their ON or OFF states and can switch
between states.
The silencing at X-ACS requires the proximity of
the telomere
In order to test whether the X region has autonomous
silencing activity, the URA3-marked X-ACS from the
strongly silenced XI-L end, along with flanking sequences
Natural silencing at yeast telomeres
Fig. 3. Measurement of repression of URA3 at various locations. Ten-fold serial dilutions of cells were plated onto SC media and medium containing
5-FOA.
including all of the STR elements, was inserted at internal
locations on two chromosomes. In all cases, there was no
measurable repression. Unlike the E and I elements, the
X region is not a silencer in its own right and requires
the proximity of the telomere. This could be due to the
presence of Rap1p at the telomeres but not at the internal
X regions. Core X had been shown to behave as a proto-
silencer at HML in conjunction with HML-I (Fourel
et al., 1999).
Y
9
s are resistant to silencing
Repression within Y9s was either very low (a maximum
of 0.1% of a culture being 5-FOA resistant) or undetectable
at all the locations studied. Minimal repression was even
observed adjacent to the Y9-ACS or at the terminus of
the Y9 element, with URA3 the same distance from the
TG
1–3
as in the terminal truncations. At IX-L, where
repression at the X-ACS is at the same level as the
strongly silenced class of X-only ends, the Y9 is still
resistant to silencing. Previous studies have shown that
Sir2p co-precipitates with Y9 DNA (Gotta et al., 1997).
These results would therefore suggest that the binding of
Sir proteins to the Y9 element is not sufficient to promote
high levels of silencing at native ends. Alternatively, Sir
proteins may not bind to all Y9 elements and the ends
which were studied here may be those that lack the
proteins, although this seems less likely. The ACS in Y9s
is different from the one in core X in that it lies in the
opposite orientation, and has no associated Abf1p-binding
site. The distal end of Y9s contain a potential Tbf1p-
binding site which may act as an anti-silencer. The flanking
of Y9 elements by anti-silencing sequences could therefore
2545
explain their resistance to repression. However, this would
not account for the low level of silencing seen within the
Y9 element at IX-L, as this end lacks most of the STR
sequences (Louis and Haber, 1991). This loss of potential
STR-associated anti-silencers may, however, explain the
high levels of repression seen at the X-ACS of this end.
The pattern of silencing seen at X–Y9 ends further
indicates that repression at native ends is discontinuous,
with repressive chromatin being able to assemble centro-
mere-proximal to a region that is expressed. The strong
repression observed at the IX-L X-ACS indicates that the
low level of silencing observed at the X-ACS of most
X–Y9 ends is not due to the distance of the marker from
the telomere. Overexpression of SIR3 has less of an effect
on silencing when URA3 is embedded in the Y9 element
than when it is not. This again suggests that sequences
embedded within Y9s are protected from high levels of
repression, whilst stronger silencing can establish telo-
mere-distal, at the X-ACS. A similar discontinuity in
silencing has been noted by Fourel et al. (1999) who have
observed the expression of a TRP gene adjacent to the
telomere, while a URA3 gene more distal to the terminus
was repressed.
The genetic control of native telomere silencing is
different from other silencing
Native silencing has some of the same genetic components
as artificial TPE, such as derepression of the XI-L highly
silenced end by sir2∆, sir3∆, sir4∆ and hdf1∆. However,
unlike artificial TPE, the sir3∆ mutation does not com-
pletely abrogate silencing. It has also been observed that
sir3∆ does not completely derepress the HMR locus in
F.E.Pryde and E.J.Louis
Fig. 4. A model for formation of repressive chromatin at native telomeres. Previous models propose that interactions of Sir complexes with histones
and Rap1p cause telomeric DNA to fold back on itself, creating core heterochromatin. This core heterochromatin is able to spread on overexpression
of SIR3. The new model proposes that it is the interaction of telomere-associated Rap1p–Sir complexes with proteins bound to core X that forms a
tight domain of repressive chromatin at native telomeres. The Y9 elements are excluded from this domain. Overexpression of SIR3 can enhance
interactions within the domain but only extends the spread of silent chromatin by several kilobases.
Y55 strains (E.Louis, personal observations). In addition
sir1∆ appears to have an effect on native silencing
(2-fold derepression) while having no effect on the VII-L
truncation construct. The effect of the X-ACS mutation
and the involvement of SIR1 suggest that native silencing
may involve the ORC, which has an important role in
silencing at HML and HMR (see Loo and Rine, 1995).
The ORC has been shown to have a role in artificial TPE
(Fox et al., 1997), which is surprising given that the
artificial telomere constructs used in such studies lack the
ORC-binding sites which normally are present in native
subtelomeres (within the core X and Y9 elements). It has
been proposed that the presence of the ORC bound to an
adjacent chromosome end may be sufficient to promote
silencing at a truncated end. As was previously reported,
orc2-1 and orc5-1 result in derepression at the VII-L
terminal truncation. Surprisingly, they had no effect on
the highly repressed XI-L X-ACS marked end, although
2546
a similar decrease in repression to that seen with the sir1∆
mutation was expected. This paradox has yet to be
resolved. Models of altered concentrations of silencing
factors, or the association of truncated telomeres with
native telomeres, cannot explain these data. It is also
unclear how SIR1 might be acting at native telomeres if
it is not being tethered by the ORC, as is the case at HML
and HMR (Chien et al., 1993; Triolo and Sternglanz,
1996; Fox et al., 1997). Two classes of ORC5 alleles have
been identified, which are either silencing or replication
defective. The two types of alleles complement, suggesting
that different ORC species function at different origins
within the genome (Dillin and Rine, 1997). These results
could therefore be explained by an alternative ORC species
functioning at the X-ACS.
Silencing at native ends is less sensitive than artificial
TPE to weakened marker promoters and to increased
expression of SIR3. Although increased expression of
Natural silencing at yeast telomeres
Table I. Oligonucleotides used for insertion of URA3 at various locations
Positions based on XI-L
1S1ATATTAAGGAACTTTAAGTTAATGATACCATGATAGTATTAAGACgcttttcaattcaattcatc
S2 AAATATTCTATTCTTCAACCATAATACATAAACACACTTAATTGCaaatcattacgaccgagatt
2S1CTGAAAATATCAAAATTTCTGGGTTGCGATAGTTTTTGTGTAACCgcttttcaattcaattcatc
S2 TTATTGTTGATAGAACACTAACCCTTCAGCTTTATTTCTGGTTACaaatcattacgaccgagatt
3S1AAGGACGGTATCTACACTATCGCAAATTAGAGACAAACGCCAATTgcttttcaattcaattcatc
S2 TATTTTGTTCGTTAATTTTCAATGTCTATGGAAACCCGTTCGTAAaaatcattacgaccgagatt
4S1GTTACAATTTTATTTTTATCATACACGATTCTTTGAACATCAACTgcttttcaattcaattcatc
S2 GCAATTACGTAATTGTAGCCGCTGAAGGCGGATGGTATTGAGAGAaaatcattacgaccgagatt
5S1ATGGCATGTGATGTGTTGGTGGGATTAGAGTGGTAGGGTAAGTATgcttttcaattcaattcatc
S2 CCCTCCATATTGAAACGTTAACAAATAATCGTAAATAATACACATaaatcattacgaccgagatt
Positions based on XV-R
1S1ATTAAGGAACTTTTACGTTAATGACGTCATGGTAGTGCTCGTACTgcttttcaattcaattcatc
S2 AAATATTCCATTCTTCAACAATAATACATAAACATATTGACTTGAaaatcattacgaccgagatt
2S1AAACCCAAAATAGAAACTTCTCTTTTGCGTCACTGTTCTGGAAAAgcttttcaattcaattcatc
S2 TATTGCTTATTGGACATACCCTATTAGCTTTATTACCATGCACCCaaatcattacgaccgagatt
3S1GCCGCTGCTCCAGCCACTACCACTCTATCTCCATCTGACGAAAGAgcttttcaattcaattcatc
S2 AGCTCTGATATCGGAGACGTAAACACCCAATTCGACCAAGTTGACaaatcattacgaccgagatt
4S1TTTTTCAGCTTTCTGATTAATCTCTTCGGTTTAAATTTTTTAGCAgcttttcaattcaattcatc
S2 GATTTGATACCAACCGCGTTATAAGGGTTACTAGAAAGTAATAGCaaatcattacgaccgagatt
5S1TACGGCATGTGGTGGTAGGGTAAGTATATGTGTATTATTTACGATgcttttcaattcaattcatc
S2 CACCATACTGTTGTTCTACCCACCATGTTGAAACGTTAACAAATGaaatcattacgaccgagatt
6S1ACGTAGATGAGCTATCGATTTTTTCTGCATACCAAGCAAGTTTACgcttttcaattcaattcatc
S2 ATAGATCACGCTTCAGCCGCTCTGTGTCGACTTTCTTTTCGCCAGaaatcattacgaccgagatt
7S1TTAGCCCTCTTTGAAATTGAACCAGAGTCGAAGGCCATTGTAGTTgcttttcaattcaattcatc
S2 TCTCCAAGAGCAGGCCAATTCTTCCACTTCGTTGGTTGTGCTTGCaaatcattacgaccgagatt
8S1GTATTTCACTGTTTTGATTTAGTGTTTGTTGCACGGCAGTAGCGAgcttttcaattcaattcatc
S2 CTTTTTATAGATTGTCTTTTTATCCTACTCTTTCCCACTTGTCTCaaatcattacgaccgagatt
9S1AGAACAGGGTTTCATTTTCATTTTTTTTTTTTAATTTCGGTCAGAgcttttcaattcaattcatc
S2 CTCTCACATCTACCTCTACTCTCGCTGTCATACCTTACCCGGCTTaaatcattacgaccgagatt
S1 is the centromere proximal side and S2 is the distal side of the site of insertion. Lower case bases are the sequences homologous to URA3.
Table II. Oligonucleotides used for complete ORF replacement by kanMX4
HDF1 S1 ATGATTTGTTAAGTGACTCTAAGCCTGATTTTAAAACGGGAATATTcgtacgctgcaggtcgac
S2 AAATATTGTATGTAACGTTATAGATATGAAGGATTTCAATCGTCTAtcgatgaattcgagctcg
SIR1 S1 GAATTTGGGCACATGTGACCCGGAATGTATATTGAGTAATATAAGAcgtacgctgcaggtcgac
S2 CACCCGCTTATATGTTGGTATCCATAACTGATAATCTTACCAACTAtcgatgaattcgagctcg
SIR2 S1 TAGACACATTCAAACCATTTTTCCCTCATCGGCACATTAAAGCTGGcgtacgctgcaggtcgac
S2 ATTGATATTAATTTGGCACTTTTAAATTATTAAATTGCCTTCTACAtcgatgaattcgagctcg
SIR3 S1 AGAGGTTTAAGAAAGTTGTTTTGTTCTAACAATTGGATTAGCTAAAcgtacgctgcaggtcgac
S2 GTACATAGGCATATTTATGGCGGAAGTGAAAATGAATGTTGGTGGAtcgatgaattcgagctcg
SIR4 S1 AAGGAAGCTTCAACCCACAATACCAAAAAAGCGAAGAAAACAGCCAcgtacgctgcaggtcgac
S2 AACAGGGTACACTTCGTTACTGGTCTTTTGTAGAATGATAAAAAGAtcgatgaattcgagctcg
S1 is the upstream end and S2 is the downstream end of the genes. Lower case bases are the sequences homologous to the pFA6a-kanMX4.
SIR3 has a significant effect at weakly silenced X-only
ends and X–Y9 ends, the increase in repression is still
orders of magnitude less than that seen with terminal
truncations. The spread of repressive chromatin appears
to be being blocked. In general, ppr1∆ strains do not
exhibit an increased repression, indicating that resistance
to spread of silencing at native ends is not due to the
transcription factors of the marker gene blocking repressive
chromatin.
The sequences at HMR and HML are resistant to
integration due to either the inability of sequences to
recombine or the lack of expression of inserted sequences
(R.Borts, personal communication). In contrast, most telo-
meric sequences are easily targeted by transformation,
with the exception of the X–STR junction. This resistance
to transplacement into the X–STR junction was relieved
in sir3∆ strains, where theinsertion of URA3 at the junction
was easily recovered. However, in SIR3 derivatives of
the X–STR insertions, the level of silencing was no higher
2547
than that seen at the X-ACS. It is possible that the URA3
insertion altered the chromatin structure at this location
such that it now exhibits variegated expression rather than
complete repression.
Model for repression at native telomeres
Previous studies have mapped Sir2p, Sir3p and Sir4p
along telomeric heterochromatin and have shown the
association of these proteins with telomeric DNA to reflect
the gradient in silencing observed at truncated telomeres
(Hecht et al., 1996; Strahl-Bossinger et al., 1997). Models
to explain artificial TPE (reviewed in Grunstein, 1998)
propose that the folding back of telomeric DNA allows
interaction between Sir protein complexes bound to Rap1p,
and those associated with the more internal histones (see
Figure 4). These complexes form core heterochromatin
which can spread through interactions between Sir3p and
the histones. A similar looping model has been proposed to
explain silencing in Drosophila, with interactions between
F.E.Pryde and E.J.Louis
Table III. Oligonucleotides used for confirming sir1::kanMX4 and
hdf1::kanMX4
HDF1 A1 ACAACAGGTCACTTCTGCAAG
A4 GGGACCCACAAAGTAATTGTC
SIR1 A1 CCTCAAGCGAATGGTGGATTCCTT
A4 TTAACGGTACTACAGTACGGCTCG
kanMX4 K2 TTCAGAAACAACTCTGGCGCA
K3 CATCCTATGGAACTGCCTCGG
Polycomb group proteins leading to the formation of a
core silencing complex (reviewed in Pirrotta, 1997). The
results presented here indicate that these interactions alone
are not sufficient for silencing at native telomeres, since
Y9 elements are resistant to high levels of repression and
the domain of silencing is limited at all native ends. In
an alternative model, we propose that silencing at native
ends requires the interaction of telomere-associated Rap1p/
Sir2p,3p,4p complexes with proteins bound at core X,
leading to the formation of a region of highly repressive
chromatin. The folding process required for these inter-
actions to occur may account for the physical inaccessi-
bility observed at the X–STR junction. The folding back
of the telomere would also result in the looping out of
the Y9 elements, removing them from the condensed
region (Figure 4). In most cases, the presence of a
Y9 element causes a low level of silencing at the X-ACS.
This is presumably due to a weakening of the protein
interactions at core X, although the reason behind this has
yet to be determined. Unlike artificial TPE, the core
heterochromatin is limited in its ability to spread internally.
Overexpression of SIR3 increases the level of repression
at weakly silenced ends to that of strongly silenced ends,
within the core X domain, possibly by enhancing the
interactions at core X. However, in all cases, the domain
of repression can be extended by only a few kilobases as
opposed to the tens of kilobases seen with terminal
truncations. The structures found at native telomeres
prevent the propagation of silent chromatin as seen at
terminal truncations. The question as to why some X-only
ends are resistant to high levels of silencing remains to
be answered. It is possible that those ends which exhibit
minimal silencing are not bound by an ORC, or are bound
by a different ORC species that is not competent for
repression. As discussed above, there may also be anti-
silencing elements at some ends.
Is native telomere silencing for repression or is it
architectural?
It seems unlikely that the function of TPE is for repression
of nearby genes, due to the instability of the repressive
state and the fact that the subtelomeric region is used for
gene amplification in some circumstances. It is possible
that repression is in fact secondary to the true role of the
sequences and proteins involved in silencing, such as in
the nuclear localization of the telomeres. A barrier to
recombination between sequences at telomeric and internal
locations has been found (A.C.Timbrell, T.C.Huckle,
A.P.Underwood, D.E.Eyre, H.C.Gorham, R.H.Borts and
E.J.Louis, unpublished). A structure involving the proteins
bound to telomeric and subtelomeric sequences may result
in such a barrier and, indeed, HDF2, the yeast KU80
homologue, was recovered in a screen for genes involved
2548
in the separation of telomeric and internal domains
(A.C.Timbrell, T.C.Huckle, A.P.Underwood, D.E.Eyre,
H.C.Gorham, R.H.Borts and E.J.Louis, unpublished). The
possible connection between the recombinational barrier,
nuclear architecture and silencing is seen in the disruption
of telomeric localization (Laroche etal., 1998) and abroga-
tion of silencing in hdf1∆ strains.
Materials and methods
Plasmid constructions
Plasmid pEL89H contains the terminal HindIII fragment from the left
arm of chromosome XI, subcloned into the polylinker of pGEM3Z
f
(–).
Plasmid pFEP22 was created by ligating an oligonucleotide containing
a BglII and a SalI restriction site (upstream oligo, 59-AATTAGATCTGT-
CGACGT-39; downstream oligo, 59-AATTACGTCGACAGATCT-39)
into the MunI site of pEL89H. The BglII site lies 59 to the SalI site in
pFEP22. A BamHI-linkered URA3 fragment was ligated into the BglII
site of pFEP22, creating plasmid pFEP24.
Plasmid pFEP33 was constructed by the insertion of a core X
PCR fragment, carrying BglII linkers, into the BamHI site of plasmid
YEpFAT10 (Runge et al., 1989). Plasmid pFA6a-kanMX4 (Wach et al.,
1994) was used for the disruption of SIR1–4 and HDF1. Plasmids
YEpSIR3 (Renauld et al., 1993) and p∆PPR1::HIS3 (Renauld et al.,
1993) were used for the ppr1∆ and SIR3 overexpression studies,
respectively.
PCR amplification of URA3
Unless otherwise indicated, URA3-marked strains (see Figure 1) were
created using a PCR amplification method based on that of Baudin et al.
(1993). PCR fragments were generated using primers as indicated in
Table I. PCR amplification was performed in a total volume of 50 µl,
containing 100 ng of plasmid pFEP24, 200 µM of each dNTP, 5 µlof
103 reaction buffer [160 mM (NH
4
)
2
SO
4
, 670 mM Tris–HCl pH 8.8,
0.1% Tween-20], 1.5 mM MgCl
2
,1µM of each primer and 2.5 U of
Biotaq polymerase.The reaction conditions were: 2 min at 94°C followed
by 30 cycles of 30 s at 94°C, 30 s at 55°C and 1 min 30 s at 72°C. In
the final cycle, the extension step was 2 min.
Mutation of sequences within core X
NdeI and SphI restriction sites were introduced into the core X ARS
consensus sequence and Abf1p-binding site, respectively, using the
Stratagene QuikChange™ Site-Directed Mutagenesis Kit. Oligonucleo-
tides were as follows: ACS-NdeI, GTTGAAGAGTAGAATATTCATAT-
GTTTAGGTAATTTTAGTGG and its complement; AbfI-SphI, GCT-
GAGGCAAGTGCCGTGCATGCTGATGTGAGTGCATCG and its
complement. Plasmid pFEP24 was used as template.
Disruption of SIR1–4 and HDF1 (yKu70) with kanMX4
SIR1–4, and HDF1 were disrupted with kanMX4 by the method of Wach
et al. (1994). PCR fragments were generated using primers as indicated
in Table II. Reaction volumes and conditions were as above, using
plasmid pFA6a-kanMX4 as the template. All kanMX4-containing trans-
formants were selected on plates containing 400 mg/l G418. SIR1- and
HDF1-disrupted strains were confirmed by colony PCR as described
below, and SIR2, -3 and -4 disruptions by loss of mating type.
Verification of sir1::kanMX and hdf1::kanMX transformants
by colony PCR
Correct disruption of SIR1 and HDF1 was confirmed by colony PCR
using flanking oligonucleotides (A1 and A4) in combination with internal
oligos (K2 and K3) from kanMX4 (Table III). A small amount of cells
were picked from a fresh overnight colony on a YEPD plate into 5 µl
of H
2
O and overlaid with a drop of mineral oil. The mixture was heated
at 95°C for 3.5 min prior to adding the remainder of the reaction mix
(see PCR amplification of URA3) to a total volume of 50 µl. Reaction
conditions were as described above, but with an annealing temperature
of 58°C.
Measurement of silencing
Haploid cells were grown for 2–3 days on complete synthetic media at
30°C. Single colonies were resuspended in 100 µlofH
2
O and 10-fold
serial dilutions made. Then 10 µl of each dilution was plated onto
complete synthetic media and medium containing 5-FOA. For the SIR3
Natural silencing at yeast telomeres
and core X overexpression studies, the cells were plated onto media
lacking leucine to maintain the plasmids. The percentage of cells giving
rise to 5-FOA-resistant colonies after 2–3 days growth at 30°C was
calculated. Examples from a number of the strains used in this study
are presented in Figure 3. In addition, for the sir1∆ studies, single
colonies as described above were resuspended in 350 µlofH
2
O and
10-fold serial dilutions made. Then 100 µl of these cell suspensions
were spread onto complete synthetic media and medium containing
5-FOA. This gave more accurate measurements of the percentage of
5-FOA-resistant colonies.
Yeast methods and strains
URA3 was inserted at the X-ACS of IX-L, XI-L and XIII-R by
transformation ofthe S288C strain FYBL1-8B (MATa,ura3∆851, leu2∆1,
his3∆200, lys2∆202) with 1 µgofSacI-digested pFEP24. URA3 was
integrated at this and all other subtelomeric locations by transformation
with appropriate PCR fragments (Table I). Strains containing terminal
truncations at VII-L were created by transformation of FYBL1-8B with
pADH-UCAIV (Gottschling et al., 1990), digested with EcoRI and SalI.
All transformations were performed using a modified lithium acetate
procedure (Gietz et al., 1992).
Mating of SIR3::kanMX4 strains by protoplast fusion
Initial spheroplasting was carried out as described previously (Larin
et al., 1996). Subsequent protoplast fusion was performed according to
Curran and Bugeja (1996).
Other methods
The chromosomal location of the integrated URA3 was confirmed by
CHEF gel and Southern analysis. Genomic DNA was prepared in agarose
plugs for electrophoresis by CHEF as previously described (Louis,
1998). Chromosomes were separated in a 1% agarose gel using standard
conditions. DNA for Southern analysis was prepared as previously
described (Borts et al., 1986), and digested with StuI. In both analyses,
DNA was transferred onto Hybond N
1
and probed with fluorescein-
labelled (Amersham) URA3. Transformants were verified further by
crossing with strains marked with URA3 at known ends. The resultant
diploids were sporulated, dissected and the segregation of URA3
determined.
Acknowledgements
The authors would like to thank Rhona Borts and other members of the
laboratory for helpful discussion and comments, E
´
ric Gilson for discus-
sion and sharing unpublished results, Bernard Dujon for the parental
strains, and Dan Gottschling and Virginia Zakian for providing several
of the plasmids used in this study. This work was funded by The
Wellcome Trust.
References
Aparicio,O.M. and Gottschling,D.E. (1994) Overcoming telomeric
silencing: a trans-activator competes to establish gene expression in
a cell cycle-dependent way. Genes Dev., 8, 1133–1146.
Aparicio,O.M., Billington,B.L. and Gottschling,D.E. (1991) Modifiers
of position effect are shared between telomeric and silent mating type
loci in S.cerevisiae. Cell, 66, 1279–1287.
Baudin,A., Ozier,K.O., Denouel,A., Lacroute,F. and Cullin,C. (1993) A
simple and efficient method for direct gene deletion in Saccharomyces
cerevisiae. Nucleic Acids Res., 21, 3329–3330.
Boeke,J.D., Lacroute,F. and Fink,G.R. (1984) A positive selection for
mutants lacking orotidine-59-phosphate decarboxylase activity in yeast:
5-fluoro-orotic acid resistance. Mol. Gen. Genet., 197, 345–346.
Borts,R.H., Lichten,M. and Haber,J.E. (1986) Analysis of meiosis-
defective mutations in yeast by physical monitoring of recombination.
Genetics, 113, 551–567.
Boulton,S.J. and Jackson,S.P. (1998) Components of the Ku-dependent
non-homologous end-joining pathway are involved in telomeric length
maintenance and telomeric silencing. EMBO J., 17, 1819–1828.
Brun,C., Marcand,S. and Gilson,E. (1997) Proteins that bind to double-
stranded regions of telomeric DNA. Trends Cell Biol., 7, 317–324.
Chien,C.T., Buck,S., Sternglanz,R. and Shore,D. (1993) Targeting of
SIR1 protein establishes transcriptional silencing at HM loci and
telomeres in yeast. Cell, 75, 531–41.
Curran,B.P.G. and Bugeja,V.C. (1996) Protoplast fusion in
2549
Saccharomyces cerevisiae. In Evans,I.H. (ed.), Methods in Molecular
Biology: Yeast Protocols. Humana Press, NJ, pp. 45–50.
Dillin,A. and Rine,J. (1997) Separable functions of ORC5 in replication
initiation and silencing in Saccharomyces cerevisiae. Genetics, 147,
1053–1062.
Enomoto,S., Longtine,M.S. and Berman,J. (1994) Enhancement of
telomere–plasmid segregation by the X-telomere associated sequences
in S.cerevisiae involves SIR2, SIR3, SIR4 and ABF1. Genetics, 136,
757–767.
Fourel,G., Revardel,E., Koering,C.E. and Gilson,E. (1999) Cohabitation
of insulators and silencing elements in yeast subtelomeric regions.
EMBO J., 18, 2522–2537.
Fox,A.F., Ehrenhofer-Murray,A.E., Loo,S. and Rine,J. (1997) The origin
recognition complex, SIR1 and the S phase requirement for silencing.
Science, 276, 1547–1551.
Fox,C.A., Loo,S., Dillin,A. and Rine,J. (1995) The origin recognition
complex has essential functions in transcriptional silencing and
chromosomal replication. Genes Dev., 9, 911–924.
Gietz,D., St John,A., Woods,R.A. and Schiestl,R.H. (1992) Improved
method for high efficiency transformation of intact yeast cells. Nucleic
Acids Res., 20, 1425.
Gotta,M., Strahlbolsinger,S., Renauld,H., Laroche,T., Kennedy,B.K.,
Grunstein,M. and Gasser,S.M. (1997) Localization of Sir2p: the
nucleolus as a compartment for silent information regulators. EMBO J.,
16, 3243–3255.
Gottschling,D.E., Aparicio,O.M., Billington,B.L. and Zakian,V.A. (1990)
Position effect at S.cerevisiae telomeres: reversible repression of Pol II
transcription. Cell, 63, 751–762.
Gravel,S., Larrivee,M., Labrecque,P. and Wellinger,R.J. (1998) Yeast Ku
as a regulator of chromosomal DNA end structure. Science, 280,
741–744.
Grunstein,M. (1997) Molecular model for telomeric heterochromatin in
yeast. Curr. Biol., 9, 383–387.
Grunstein,M. (1998) Yeast heterochromatin: regulation of its assembly
and inheritance by histones. Cell, 93, 325–328.
Hecht,A., Strahl-Bolsinger,S. and Grunstein,M. (1996) Spreading of
transcriptional repressor SIR3 from telomeric heterochromatin. Nature,
383, 92–96.
Larin,Z., Monaco,A.P. and Lehrach,H. (1996) Generation of large insert
YAC libraries. In Markie,D. (ed.), Methods in Molecular Biology:
YAC Protocols. Humana Press, NJ, pp. 1–11.
Laroche,T., Martin,S.G., Gotta,M., Gorham,H.C., Pryde,F.E., Louis,E.J.
and Gasser,S.M. (1998) Mutations of yeast Ku genes disrupt the
subnuclear organization of telomeres. Curr. Biol., 8, 653–656.
Loo,S. and Rine,J. (1995) Silencing and heritable domains of gene
expression. Annu. Rev. Cell. Dev. Biol., 11, 519–548.
Louis,E.J. (1995) The chromosome ends of Saccharomyces cerevisiae.
Yeast, 11, 1553–1573.
Louis,E.J. (1998) Whole chromosome analysis. In Tuite,M.F. and
Brown,A.J.P. (eds), Methods in Microbiology: Yeast Gene Analysis.
Academic Press, London, UK, pp. 15–32.
Louis,E.J. and Haber,J.E. (1990) Mitotic recombination among
subtelomeric Y9 repeats in Saccharomyces cerevisiae. Genetics, 124,
547–559.
Louis,E.J. and Haber,J.E. (1991) Evolutionarily recent transfer of a
group I mitochondrial intron to telomere regions in Saccharomyces
cerevisiae. Curr. Genet., 20, 411–415.
Louis,E.J., Naumova,E.S., Lee,A., Naumov,G. and Haber,J.E. (1994)
The chromosome end in yeast: its mosaic nature and influence on
recombinational dynamics. Genetics, 136, 789–802.
Lustig,A.J. (1998) Mechanisms of silencing in Saccharomycescerevisiae.
Curr. Opin. Genet. Dev., 8, 233–239.
Nugent,C.I., Bosco,G., Ross,L.O., Evans,S.K., Salinger,A.P., Moore,J.K.,
Haber,J.E. and Lundblad,V. (1998) Telomere maintenance is dependent
on activities required for end repair of double-strand breaks. Curr.
Biol., 8, 657–660.
Pirrotta,V. (1997) Chromatin-silencing mechanisms on Drosophila
maintain patterns of gene expression. Trends Genet., 13, 314–318.
Polotnianka,R.M., Li,J. and Lustig,A.J. (1998) The yeast Ku heterodimer
is essential for protection of the telomere against nucleolytic and
recombinational activities. Curr. Biol., 8, 831–834.
Porter,S.E., Greenwell,P.W., Ritchie,K.B. and Petes,T.D. (1996) The
DNA-binding protein Hdf1p (a putative Ku homologue) is required
for maintaining normal telomere length in Saccharomyces cerevisiae.
Nucleic Acids Res., 24, 582–585.
Pryde,F.E. and Louis,E.J. (1997) Saccharomyces cerevisiae telomeres. a
review. Biochemistry, 62, 1232–1241.
F.E.Pryde and E.J.Louis
Pryde,F.E., Huckle,T.C. and Louis,E.J. (1995) Sequence analysis of the
right end of chromosome XV in Saccharomyces cerevisiae: an insight
into the structural and functional significance of sub-telomeric repeat
sequences. Yeast, 11, 371–382.
Renauld,H., Aparicio,O.M., Zierath,P.D., Billington,B.L.,Chhablani,S.K.
and Gottschling,D.E. (1993) Silent domains are assembled
continuously from the telomere and are defined by promoter distance
and strength and by SIR3 dosage. Genes Dev., 7, 1133–1145.
Rine,J. and Herskowitz,I. (1987) Four genes responsible for a position
effect on expressionfrom HML andHMR in Saccharomyces cerevisiae.
Genetics, 116, 9–22.
Rine,J., Strathern,J.N., Hicks,J.B. and Herskowitz,I. (1979) A suppressor
of mating type locus mutations in Saccharomyces cerevisiae: evidence
for and identification of cryptic mating type loci. Genetics, 93,
877–901.
Runge,K.W. and Zakian,V.A. (1989) Introduction of extra telomeric
DNA sequences into Saccharomyces cerevisiae results in telomere
elongation. Mol. Cell. Biol., 9, 1488–1497.
Sherman,J.M. and Pillus,L. (1997) An uncertain silence. Trends Genet.,
13, 308–313.
Strahl-Bolsinger,S., Hecht, A, Luo,K. and Grunstein,M. (1997) SIR2 and
SIR4 interactions differ in core and extended telomeric heterochromatin
in yeast. Genes Dev., 11, 83–93.
Triolo,T. and Sternglanz,R. (1996) Role of interactions between the
origin recognition complex and SIR1 in transcriptional silencing.
Nature, 381, 251–253.
Vega-Palas,M.A., Venditti,S. and Di Mauro,E. (1997) Telomeric
transcriptional silencing in a natural context. Nature Genet., 15,
232–233.
Vega-Palas,M.A., Venditti,S. and Di Mauro,E. (1998) Heterochromatin
organization of a natural yeast telomere—changes of nucleosome
distribution driven by the absence of Sir3p. J. Biol. Chem., 273,
9388–9392.
Wach,A., Brachat,A., Pohlmann,R. and Philippsen,P. (1994) New
heterologous modules for classical or PCR-based gene disruptions in
Saccharomyces cerevisiae. Yeast, 10, 1793–808.
Wotton,D. and Shore,D. (1997) Novel Rap1p-interacting factor, Rif2p,
cooperates with Rif1p to regulate telomere length in Saccharomyces
cerevisiae. Genes Dev., 11, 748–760.
Zou,S., Ke,N., Kim,J.M. and Voytas,D.F. (1996) The Saccharomyces
retrotransposon Ty5 integrates preferentially into regions of silent
chromatin at the telomeres and mating loci. Genes Dev., 10, 634–645.
Received November 10, 1998; revised and accepted March 2, 1999
2550
