ArticlePDF Available

Expression of cannabinoid receptors and their gene transcripts in human blood cells

Authors:

Abstract and Figures

1. This study shows that the human cannabinoid receptors and their gene transcripts can be analyzed in blood samples when combined with polymerase chain reaction. The results also demonstrate that the expression of the cannabinoid receptors is dependent on gender and ethnic background. 2. Normal human volunteers who do not use marijuana have genes that encode for the marijuana (cannabinoid) receptor proteins. 3. Primer pairs from CB1 and CB2 cDNA coding region sequences showed identical amplified DNA band sizes in both DNA-PCR and reverse PCR, with human templates. This suggests that the CB1 and CB2 genes are intronless at least in their coding regions. 4. An advantage of the coding region being intronless may be that the expression of these genes will have one major RNA processing event to skip, thus making the conditions of their expression relatively quick and simple. This advantage may have implications related to the biological functions of these proteins. 5. We therefore concluded that the existence of human cannabinoid receptors and genes along with the discovery of endogenous cannabinoids (endocannabinoids) may be useful markers in elucidating the role(s) and mechanism(s) of action of cannabinoids.
Content may be subject to copyright.
ELSEVIER
Prcg. Neu?-c#sychopharmacol. &Bid psychint. 1999, Vol. 23, pp. 1063-1077
Copyright 0 1999 Elsevier Science Inc.
Printed in the USA. All rights reserved
0278-5846/99/$+x front matter
PII 80278-5845(98)08052-4
mPREBsIOR OF CABBABIBOID BEcxPToRs A?m
THEIR GENE TRABSCBIPTS IB HUMAB BLOOD CELLS
EMMANUEL S. 0NAIV11~2, GAUTAM CHAUDHURi4, ASLI S.
ABAC15, MONICA PARKER3, DONALD H. MANIER’, PETER
R. MARTIN112 AND JOHN R. HUBBARD115
Department of ‘Psychiatry, 2Pharmacology and 3Cell Biology,
Vanderbilt University School of Medicine, Nashville, TN, USA
4Department of Microbiology, Meharry Medical College,
Nashville, TN, USA
‘Department of Veterans Affairs Medical Center, Nashville,
TN, USA
(Final form, July 1999)
Abstract
Onaivi, Emmanuel S., Gautam Chaudhuri, Ask S. Abaci, Monica Parker, Donald H. Manier,
Peter R. Martin and John R. Hubbard: Expression of cannabinoid receptors and their gene
transcripts in human blood cells. Prog. Neuro-Psychopharmacol. & Biol. Psychiat.
19%,2& pp. 1063-1077.81999 Elswier Science Inc.
1. This study shows that the human cannabinoid receptors and their gene transcripts can be
analyzed in blood samples when combined with polymerase chain reaction. The results
also demonstrate that the expression of the cannabinoid receptors is dependent on
gender and ethnic background. 1063
1064 E.S. Onaivi ei al.
2. Normal human volunteers who do not use marijuana have genes that encode for the
marijuana (cannabinoid) receptor proteins.
3. Primer pairs from CBI and CB2 cDNA coding region sequences showed identical
amplified DNA band sizes in both DNA-PCR and reverse PCR, with human templates.
This suggests that the CBI and CB2 genes are intronless at least in their coding regions.
4. An advantage of the coding region being intronless may be that the expression of these
genes will have one major RNA processing event to skip, thus making the conditions of
their expression relatively quick and simple. This advantage may have implications
related to the biological functions of these proteins.
5. We therefore concluded that the existence of human cannabinoid receptors and genes
along with the discovery of endogenous cannabinoids (endocannabinoids) may be useful
markers in elucidating the role(s) and mechanism(s) of action of cannabinoids.
m: cannabinoid receptors, cannabinoid receptor genes, gender differences, genetic
variation, human blood, marijuana, polymerase chain reaction,
. .
Abbrewatlons: acquired immune deficiency syndrome (AIDS), cannabinoid receptor subtype
1 (CBI), cannabinoid receptor subtype 2 (CB2), deoxyribonucleic acid (DNA),
electroconvulsive therapy (ECT), institutional review board (IRB), natural killer cells (NK),
polymerase chain reaction (per), polymorphonuclear neutrophils (PMN), Ribonucleic acid,
(RNA), urine drug screen (UDS).
Cannabis (including marijuana) is one of the most widely used drugs in the world.
Cannabinoids are constituents in the Cannabis sativa of which A’-tetrahydrocannabinol (A’-
THC) is the major psychoactive component. Endogenous cannabinoid ligands
(endocannabinoids) have been discovered in the human nervous system. The discovery of
endocannabinoids (Devane, 1992), and the genes encoding the cannabinoid receptors
(Matsuda et al., 1990, Munro et al., 1993 and Chakrabarti et al., 1995) suggest that the
cannabinoid system represents a previously unrecognized elaborate network in the human
peripheral and central nervous systems whose biological role is not well understood.
Although the physiologi& role or cannabinoids is largely unknown, a high conservation
between the genes encoding the human, rat, mouse, fish and bovine cannabinoid receptors
suggests an important biological function. As many of the actions of cannabinoids are
known to be receptor or non-receptor nrediated, understanding the neurochemistry,
regulation and molecular basis of cannabinoid receptor activities is of significant clinical and
scientific interest. A recent report demonstrated robust acute effects of marijuana on
subjective and physiological measures, including smooth pursuit eye tracking performance
which returned to baseline levels after 3.5 h. (Fant et al 1998). Such acute effects were not
Cannabinoid receptors and gene expression in human blood cells 1065
present the day following the smoking, indicating that the residual effects of smoking a
single marijuana cigarette are minimal (Fant et al 1998).
There is now a considerable body of evidence to suggest that cannabinoids may have a
number of medicinal uses: for the relief of pain in paraplegia, neuralgia and spasticity in
multiple sclerosis; as an appetite stimulant in treating AIDS patients with wasting disease,
cachexia; for the prevention of nausea and vomiting associated with cancer chemotherapy;
in glaucoma: as immunomodulators for autoimmune diseases, inflammation, allergies and
nephritis. In addition, the discovery of transporters and enzymes involved in the synthesis
and degradation of endocannabinoids and the cardiovascular effects of cannabinoids may
provide new therapeutic drug targets. The rapid progress in cannabinoid research and the
development of new research tools which has now transformed cannabis research into
mainstream science may contribute to understanding the mechanism(s) of action of
cannabinoids which has been slow to emerge.
Marijuana is frequently used for its effects of euphoria, relaxation and sensory changes.
The precise reason(s) for use varies with each individual (Hubbard et al., 1993). Previous
studies by us and others indicate that the expression of genes encoding cannabinoid
receptors can be evaluated in blood and brain samples in animals and humans (Bouaboula
et al., 1993 and Onaivi et al., 1996a). In human leukocytes the expression of cannabinoid
receptor mRNA has been reported to be lower than that found in brain tissue. The
message has, however, been detected in all subsets of leukocytes examined. The
message levels are greatest in S cells, followed sequentially by natural killer cells (NK),
polymorphonuclear neutrophils (PMN), T8 cells, monocytes and T4 cells. The objective of
this study was to evaluate the measurement of cannabinoid receptors in human, and to
determine the level of expression of cannabinoid receptor genes in blood samples of non-
marijuana using subjects for subsequent comparison to marijuana using subjects. We also
evaluated whether or not gender and ethnic background plays a role in the expression of
cannabinoid receptors and their transcripts in the human blood cells.
1066 E.S. Onaivi et al.
Methods
This report presents findings in white, black and Asian normal human controls from the
Vanderbilt University community. This study was approved by Vanderbilt IRB and informed
consent was obtained from participants. Twenty three healthy male and female subjects
who did not meet DSM-IV criteria (American Psychiatric Association, 1994) for alcohol or
marijuana dependence participated in the study. Subjects were excluded from participation
for non-substance-related AXIS 1 psychiatric disorder(s) other than adjustment disorders or
dysthymia and for severe AXIS 11 disorder, such as severe borderline personality disorder.
and RNA Isol&ton from Blood SarrtpLes
Blood samples were obtained for cannabinoid receptor (CBI) protein and mRNA (CBI
and CB2) determinations in leukocytes from each human subject. Blood (6 ml) was
collected in heparinzed tubes for immunoblotting and in TRIZOL LS Reagent solution (10
ml) (GIBCO BRL) for RNA isolation for northern blotting. Human RNA was isolated from
leucocytes according to the methods used by Lin et al., 1993. For the protein isolation from
blood samples for immunoanalysis using CBI polyclonal antibody, 2 ml of the blood was
centrifuged at 5000 rpm at 4% for 5 min and the supematant discarded. The pellet was
resuspended in 400 ul of lysis buffer containing protease inhibitors and homogenized. After
rinsing with 200 PI lysis bufffer into a tube, the homogenate was centrifuged at 15000 rpm
at 4OC for 15 min. The supernatant was aliquoted and stored at -80°C for immunoblotting.
Samples were prepared for immunoblotting using 50 11 of the homogenate and 2X
Laemille’s buffer and boiled for 10 min. After cooling, the mixture was centrifuged at 15000
rpm, at 4°C for 15 min and the supernatant used for Western blotting.
. . .
Reaction (PCR) and Riot Hybnr&&n
Probes for human CBI and CB2 for the northern blot analysis were obtained and
prepared. Human CBI receptor cDNA (clone # HFBCF53, ATCC; Genebank/EMBL #
M77952) was used as a probe. The cDNA insert was excised from the pBluescript SK-
clone with EcoR I that yielded two fragments of 2.15 kb and 0.6 kb. These fragments were
Cannabinoid receptors and gene expression in human blood cells 1067
Table 1
Oligodeoxyribonucleotide Primer Pairs Used For The Polymerase Chain Reaction
Primer Namea Positionb Nucleotide Sequences@‘->3’) Expected Size
Specific (bp) of the Amp
to cDNA lified Band”
CBI Fl 2344
Bl 591-571
CBI F2
B2
CBl F3
B3
CBI F4 1200-1222 GAGGAGCAAGGACCTGAGACATG
84 1438-1415 CCACMAAGCAGCAGCTCACAGAG 239
588-611
1100-l 078
853-874
1373-l 350
CB2 F5 5-28
B5 338-318
CB2 F6
B6
CB2 F7 464482
B6 914-894
CB2 F8 706-723
88 1134-1111
CB2 F5 5-28
88 1134-1111
1 l-34
914-894
TTGCAGACACCACCTTCCGTAC
AACCCCACCCAGTTTGAACAG 569
GGTTACAGCCTCCTTCACAGCTTC
TCATACACCATGATCGCAAGCAG 513
AGTGTGCTGCTGCTGTTCATTG
GCGATC-I-TAACGGTGCTCTTGATG 521
AGGAATGCTGGGTGACAGAGATAG
ACGCTGCCAATCTTCAGCAGG
GCTGGGTGACAGAGATAGCCAATG
TCTCCACTCCGTAGAGCATAG
GCATCATGTGGGTCCTCTC
TCTCCACTCCGTAGAGCATAG
CGAATGAGGCTGGATGTG
GGGAGTGAACTGATTTCTGACT-TG
AGGAATGCTGGGTGACAGAGATAG
GGGAGTGAACTGATTTCTGACT-TG
334
904
451
429
1130
“F = Forward primer; B = Reverse or backward primer. bThe ‘A’ of the protein initiation
codon, ATG, in the cDNA sequence is designated as 1. The length of the cDNA coding
regions of rat CBI and human CB2 are 1440 bp and 1134 bp, respectively. ‘The size of the
amplified band is given for a specific pair of forward and reverse primers.
1068 E.S. Onaivi et al.
purified from low melting point agarose gels with freeze-spin columns (Stratagene, La Jolla,
CA). The probe was radiolabeled with 32P using radom primer labeling method (Sambrook
et al., 1989) and was purified by Nick-spin columns (Pharmacia LKB Biotechnology,
Piscataway, NJ). Radiolabeled probe was denatured by boiling for IO min, followed by
rapid cooling in ice. The CB2 probe primer pair for PCR , Table 1, was designed from the
human CB2 gene sequence (Munro et al., 1993) using MacVector program (IBI-Kodak,
New Haven, CT). The forward primer sequence was 5’-
AGGAATGCTGGGTGACAGAGATAG-3’ and reverse or backward primer was 5’-
GGGAGTGAACTGATTTCTGACTTG-3’. The primer pair used for PCR with genomic DNA
(500 ng) as template for CBI was 5’-TTGCAGACACCACCTTCCGTAC-3’ as forward and
Y-CCACAAAAGCAGCAGCTCACAGAG-3’ as reverse primer. These oligonucleotide
primers were synthesized by the phosphoramidate method using the Applied Biosystem
Model 380A automated DNA synthesizer. The oligonucleotides were purified by
electrophoresis through a denaturing polyacrylamide gel, followed by Sep-Pak Cl8
(Waters, Millipore Corp., Milford, MA) reversed-phase column chromatography (Sambrook
et al., 1989). Human CB2 cDNA was amplified from total blood RNA (1 kg) using the above
forward and reverse primer pair into pCR-SCRIPT(+) plasmid (Stratagene, La Jolla, CA)
and the manufacturers kit reagents. The CB2 insert was cut out from purified recombinant
plasmid with Xba I/Barn H I and was used to probe the blots with amplified human CB2
cDNA fragments.
RNA (20 pg) was separated by electrophoresis through a 1% (w/v) agarose/ 6.7% (v/v)
formaldehyde gel in MOPS buffer [20 mM MOPS, pH 7.0, 5 mM sodium acetate, 1 mM
EDTA] (Sambrook et al., 1989). Separated RNA molecules were transferred to
nitrocellulose membranes (Schleicher & Schuell, Keene, NH) with 20 x SSC for northern
hybridization. The blots were neutralized and air dried. Blots were prehybridized using
standard protocols (Sambrook et al., 1989). Hybridization of the prehybridized blots with
the denatured radiolabeled probes was done at 42°C for 20 h in fresh prehybridization
solution with IO6 cpm of probe per ml. Blots were washed four times, 30 min each, at 55°C
with SSC buffer and 0.1% sodium dodecyl sulphate. Washed blots were exposed to Kodak
X-OMAT AR-5 film at room temperature for 20 h (Sambrook et al., 1989). Amplified DNA
fragments from agarose gels were transferred to Nytran nylon membrane (Schleicher &
Schuell, Keene, NH) following the alkaline transfer method (Sambrook et al., 1989). The
conditions for the Southern hybridization were identical to that described above for Northern
hybridization.
Cannabinoid receptors and gene expression in human blood cells 1069
Western Blotting
Equal amounts of protein were loaded and separated by 10% SDS-PAGE and then
transferred to nitrocellulose. The blots were blocked in freshly prepared PBS containing 3%
non fat milk for 20 minutes at 20-25°C with constant agitation. After incubation with a
rabbit-anti-human CBI antibody (Calbiochem, Cambridge, MA) for overnight at 4”C, a goat
anti-rabbit IgG linked to horseradish peroxidase (Amersham Life Science products,
Arlington HTs, IL) was added for additional 1.5 hr. Blots were developed using enhanced
chemiluminescence (Amersham Life Science products, Arlington HTs, IL). For quantitation,
films were scanned in Pharmacia LKB Ultroscan XL enhanced laser densitometer and the
results reported in relative units.
Results
ston and Analysis of Human CBI and CB2 Gene
The ethidium bromide stained agarose gel (2%) and the corresponding autoradiogram of
the blot that was hybridized with human CBI cDNA as a probe is shown in Figs. IA and 1 B.
This shows the PCR amplification of DNA segments from total genomic DNA isolated from
human leucocytes using the forward and reverse primer pair designed from rat CBl cDNA
sequence. The single band corresponding to the expected size of the coding region of the
CBI cDNA is indicated. Figures 2A and 2B represent the ethidium bromide stained
agarose gel (2%) (A and B) and the corresponding autoradiogram (A and B’) of the blot
hybridized with human CB2 cDNA as probe. The PCR amplification of DNA segments from
human blood and its autoradiogram is shown by (A and A) while the RT-PCR
autoradiogram is shown by (B an 8’). The insets in A’ and B’ shows the 48 h over exposure
in lanes 3 and 4.
n CR1 Cannabinoid Receotor Protein
Figures 3 and 4 represent the representative immunoblots from the blood of individual
White, Black and Asian individual controls. The CBI antibody recognized a 58 kDa protein
from the individuals and some other currently unknown bands were visible from the blot.
The relative levels of the cannabinoid receptor proteins as determined from densitometric
analysis appear to vary with gender and race. The relative levels of the 58 kDa CBI protein
1070 E.S. Onaivi et al.
from the male volunteers were, 47.4%; 39.0% and 13.6% for the White, Black and Asian
blood samples respectively as shown in Fig. 3. The relative levels of the Cl31 protein in the
male and female volunteers were 49.6%, 32.2% and 18.2% for the white and black females
in comparison to the black male blood samples respectively as shown in Fig. 4. Therefore
in both males and females, the cannabinoid receptors appear to vary by gender and
ethnicity, for example Fig. 3 show white male > black male > Asian male and Fig. 4 show
white female > black female > black male. The mean arbitrary values were analyzed by the
students t test.
Discussion
The emergence of novel research tools has accelerated cannabis research in the last
decade, more so than at any time in the thousands of years of marijuana use in human
history, Onaivi et al., 1996b and Matsuda, 1997 and Pertwee, 1997). Although, it is not yet
known why the cannabinoid system is so abundant in the nervous system, the analysis of
the receptor proteins and the genes encoding these cannabinoid receptors may shed some
light on the mode of action of cannabinoids, and the biological role of these genes in the
nervous system. In this study, we have analyzed both CBI and CB2 cannabinoid receptor
genes in normal humans who do not use marijuana. Furthermore, the authors compared
the expression of the cannabinoid receptor proteins in different human population according
to gender and ethnic background in Asians, blacks and whites.
. .
s of Cannabrnord Receptor lCB1 and CB7) Gene Struw
While rapid progress is being made in cannabis research, there is presently little in
literature on cannabinoid receptor genetics and its regulation. The present study is
therefore unique as it extends the analysis of gene structure and function to genes
encoding cannabinoid receptors in humans. These preliminary results on human marijuana
receptor gene expression indicate that human blood can be used to determine the
cannabinoid receptor gene expression when combined with polymerase chain reaction
(PCR). In addition, data from the Southern hybridizations of the blots from gels with the
human CBI and CB2 cDNA probe indicate the expected transcript size for CBI and CB2
genes and two unexpected additional bands for the CB2 receptor genes. Whether these
additional bands represent CB2 subtypes in human cells or are mere PCR artifacts remains
to be determined. The authors tested the hypothesis that if the amplified DNA fragment
Cannabinoid receptors and gene expression in human blood cells 1071
Fig 1. Analysis and the structure of human CBI gene. Ethidium bromide-stained agarose
gel (2%) (A) and the corresponding autoradiogram (B) of the blot hybridized with human
CBl cDNA as probe, showing PCR amplification of DNA segments from total genomic
DNA isolated from human leukocytes using primer pair designed from rat CBI cDNA
sequence. M: DNA size standards containing a mixture of HIND Ill-digested h- DNA and
Hae Illdigested fX174 RF DNA. The arrow heads in the figure indicate the highest size
DNA fragment (1.4 kb) of the fX174 RF DNA. The bands that follow (downwards) are 1 .l
kb, 0.9 kb, 0.6 kb, 0.31 kb, 0.28 kb, 0.28 kb, 0.27 kb, 0.23 kb, 0.19 kb, 0.12 kb and 0.07 kb
in size, respectively.
1072 E.S. Onaivi et ai.
Fig 2. Analysis and the structure of human CB2 gene. Ethidium bromide-stained agarose
gel (2%) (A and B) and corresponding autoradiogram (A’ and B’) of the blot hybridized with
human CB2 cDNA as probe, showing PCR amplification of DNA segments from human
blood DNA (A, A) and RNA (6, B’). The insets in A’ and B’ show the over exposed (48 h)
lanes 3 and 4. M: DNA size standards containing a mixture of Hind Ill-digested h -DNA
and Hae- Ill-digested fX174 RF DNA. The arrow heads in the figure A and B indicate the
highest size DNA fragment (1.4 kb) of the fX174 RF DNA. The bands that follow
(downwards)are 1.1 kb, 0.9 kb, 0.6 kb, 0.31 kb, 0.28 kb, 0.27 kb, 0.23 kb, 0.19 kb, 0.12 kb
and 0.07 kb in size, respectively. Lane 1: Primer pairs F5/B5; Lane 2: Primer pairs F6/B6;
Lane 3: Primer pairs F7/B6; Lane 4: Primer pairs F8/B8; Lane 5: Primer pairs F5/B8.
Cannabinoid receptors and gene expression in human blood cells 1073
Fig 3. lmmunoblots from human blood. lmmunoblots following the transfer to a
nitrocellulose membrane, blocked with blotto and the CBI antibody and goat anti-rabbit
IgG-HRP conjugate. lmmunoblots were detected by chemiluminescence. The CBI anti-
body recognized the expected 58 kDa protein of cannabinoid receptor subtype 1 in the
human blood shown by the arrow. The relative levels of the CBl receptor appear to vary
with race as the densitometric analysis indicated in lane C = 47.4%; lane B = 39.0% and
lane A = 13.6%, in white, black and Asian blood samples respectively.
ABC
Fig 4. lmmunoblots from human blood. lmmunoblots following the transfer to a
nitrocellulose membrane, blocked with blotto and the CBI antibody and goat anti-rabbit IgG-
HRP conjugate. lmmunoblots were detected by chemiluminescence. The CBI anti-body
recognized the expected 58 kDa protein of cannabinoid receptor subtype 1 in the human
blood shown by the arrow. The relative levels of the CBI receptor appear to vary with
gender as the densitometric analysis indicated in lane C = 49.6%; lane B = 32.2% and lane
A = 18.2% , in white female, black female and black male blood samples respectively.
1074 E.S. Onaivi et al.
sizes were identical with DNA and cDNA templates used for the PCR, then the genes are
intronless, otherwise, the intron location, size and structure can be determined. To this end
we used computer generated multiple primer pairs spanning the cDNA sequences of CBI
and CB2 genes to test whether DNA fragments amplified by these primer pairs were
identical with both the genomic DNA and cDNA template. The results suggest that the CBI
and CB2 genes are intronless at least in their coding regions. The data obtained with the
CBI is in agreement with those of Bouaboula et al., (1993). These workers using either
human genomic DNA or cDNA derived from brain RNA as template with the primers specific
for cannabinoid receptor gene showed single bands corresponding to the predicted length
for the cDNA, indicating that there is no intron in the amplified DNA segments.
In order to verify the intronlessness of the human CBI and CB2 genes, the authors
screened human genomic library. Five independent clones for CBI and two independent
clones for CB2 gene were isolated after screening of 300,000 plaques of the lambda EMBL-
3 library. All of those clones contained full length copy of the respective gene as was
revealed by restriction mapping, PCR and probing with 5’- or 3’- segments of the
corresponding cDNAs (data not shown). As expected, those clones contained intronless
genes. Cannabinoids are known to induce numerous behavioral alterations after smoking
marijuana or following THC administration (Onaivi et al., 1990, 1996b and Chakrabarti et al,
1998). This has led us to hypothesize that other subtypes of cannabinoid receptors exist in
the nervous system. Alternative splicing of the precursor mRNA is a possible mechanism
for generation of different subtypes of a receptor coded by multiple-exon gene (Green,
1991, Maniatis, 1991 and Rio, 1992). It is interesting to find that both of the presently
known subtypes of the cannabinoid receptors are coded by single-exon genes. There is, of
course, the possibility of these genes having intron(s) at the upstream or downstream non-
coding regions. We did not test this possibility but in other systems like the monoamines,
the dopamine Dl receptor gene is reported to have an intron at the 5’ non-coding region
(O’Dowd, 1993). The advantages or disadvantages of being intronless are subject to
speculation (Lambowitz and Belfcrt, 1993). One obvious advantage is that the expression
of these genes have one major RNA processing event to skip, thus making the conditions
of their expression relatively quick and simple. This advantage may have implications
related to the biological functions of these receptor proteins. Thus, the existence of genes
encoding cannabinoid receptors in human blood cells may also provide a molecular basis to
elucidate how cannabinoid compounds may mediate their immunologic, endocrine and
perhaps psychoactivity.
Cannabinoid receptors and gene expression in human blood cells
rmtors and Gene Fxpressron
1075
The present finding that the expression of cannabinoid receptors in humans varies
according to gender and ethnic differences among whites, blacks and Asian population is a
significant first finding if confirmed in a larger sample size. The implication and
physiological relevance of this finding are only speculative and premature if unconfirmed.
However, this is not surprising as numerous studies have linked genetic determinants and
differences to the neurobehavioral responses of abused drugs in man and animals (Le et
al., 1994 and Harada et al., 1996 ). For example genetic differences in alcohol and
compulsive drug taking behavior has been demonstrated in animals and man (Le et al.,
1994 and Harada et al., 1996 ). Genetic variation in some receptor and enzyme systems
e.g. cholecystokinin and serotonin IA receptors and liver enzymes, alcohol and aldehyde
dehydrogenase, may be associated with alcohol dependence due to the modified function
in physiological and behavioral responses (Thomasson et al., 1991 and Harada et al.,
1996). Thus the implication and relevance of the differential expression of cannabinoid
receptors in humans according to ethnic background remains to be determined. If it turns
out that these levels are relevant to the psychoactivity, toxicity and perhaps therapeutic
efficacy then determination of the expression of cannabinoids in human blood may be used
to predict the outcome of their actions. As endogenous cannabinoid ligands have also
been discovered, they may play important roles in the regulation and activation of the
cannabinoid genes and receptors in vivo.
Conclusion
This study indicates that both the genes encoding marijuana (cannabinoid) receptors and
the resultant cannabinoid receptor proteins can be analyzed from human blood when
combined with PCR. The present results also showed that the expression of the
cannabinoid receptors varies according to ethnic background. These findings support the
existence of an elaborate human cannabinoid system that could be exploited
therapeutically.
1076 ES. Onaivi et al.
This work was supported by grants from NHLBI KOI HL 03319 to ESO, DHM was
supported by NIMH grant MH 29228 (PI, Dr. Fridolin Suiser) and MH 52339 (PI, Dr.
Shelton), The authors also acknowledge the assistance of Dr. Barbara Fingleton for the
scanning of the immunoblots, MS Margaret Gilchrist, the clinical nurse specialist for
phelbotomy services, Dr. Amitabha Chakrabarti for technical support and the Vanderbilt
clinic for pharmacologic treatment of addiction.
American Psychiatric Association. (1994) Diagnostic and statistical manual of mental
disorders, 41h edition. Washington DC.
BOUABOULA, M., RINALDI, M., CARAYON, P., CARILLON, C., DELPECH, B., SHIRE, D.,
LE FUR, G AND CASELLAS, P. (1993) Cannabinoid receptor expression in human
leukocytes. Eur. J. Biochem. 214; 173-180.
CHAKRABARTI, A., EKUTA, J. E. AND ONAIVI, E. S. (1998) Neurobehavioral effects of
anandamide and cannabinoid receptor gene expression in mice. Brain Res. Bull. &
67-74.
CHAKRABARTI, A.. ONAIVI, E. S. AND CHAUDHURI, G. (1995) Cloning and sequencing
of a cDNA encoding the mouse brain-type cannabinoid receptor protein. DNA
Sequence 2 385388.
DEVANE, W. A., HANUS, L., BREUER, A., PERTWEE, R. G., STEVENSON, L. A.,
GRIFFIN, G., GIBSON, D., MANDELBAUM, A., ETINGER, A. AND MECHOULAM, R.
(1992) Isolation and structure of a brain constituent that binds to the cannabinoid
receptor. Science 258: 1946-l 949.
FANT, R. V., HEISHMAN, S. J., BUNKER, E. D. AND PICKWORTH, W. B. (1998) Acute
and residual effects of marijuana in humans. Pharmacol. Biochem. Behav. 6a; 777-784.
GREEN, M. R. (1991) Biochemical mechanisms of .constitutiv@ and regulated pre-mRNA
splicing. Ann. Rev. Cell Biol. Z; 559-599.
HARADA, S., OKUBO, T., TSUTSUMI, M., TAKASE, S. AND MURAMATSU, T. (1996)
Investigation of genetic risk factors associated with alcoholism. Alcohol. Clin. Experim.
Res. 251; 293A-296A.
HUBBARD, J. R., WORKMAN, E., MARCUS, L., FELKER, B., CAPELL, L., SMITH, J. AND
OVERSHIE, M. Differences in marijuana use across psychiatric diagnoses.. .Reasons
they use, the side effects they experience: Poster 837, The Future of VA Mental Health
Research: National Foundation for Brain Research, Washington, D.C., 1993.
LAMBOWITZ, A. M. AND BELFORT, M. (1993) lntrons as mobile genetic elements. Ann.
Rev. Biochem. 62; 587-622.
LE. A. D., KO, J., CHOW, S. AND QUAN, B. (1994) Alcohol consumption by C57BU6,
Balb/c and DBA/2 mice in a limited access paradigm. Pharmacol. Biochem. Behav. 4t;
375-378.
Cannabinoid receptors and gene expression in human blood cells 1077
LIN, L., GONG, Y., METCHETTE, K., CIMINO, G. D., HEARST, J. E. and ISSAACS, S. T.
(1993) in Diagnostic Molecular Microbiology: Principles and Applications. (DH, Persing
TF, Smith, FC, Tenover and TJ, White, (Eds). pp. 805-616. American Society for
Microbiology, Washington, D. C.
MANIATIS, T. (1991) Mechanisms of alternative pre-mRNA splicing. Science a 33-34.
MATSUDA, L. A. (1997) Molecular aspects of cannabinoid receptors. Crit. Rev. Neurob.
11; 143-166.
MATSUDA, L. A., LOLAIT, S. J., BROWNSTEIN, M. J., YOUNG, A. C. AND BONNER, T. I.
(1990) Structure of cannabinoid receptor and functional expression of the cloned cDNA.
Nature a 561564.
MUNRO, A., THOMAS, K. L. AND ABU-SHEAR, M. (1993) Molecular characterization of a
peripheral receptor for cannabinoids. Nature B 61-65.
O’DOWD, B. F. (1993) Structures of dopamine receptor. J. Neurochem. 6p; 804-816.
ONAIVI, E. S., CHAKRABARTI, A AND CHAUDHURI, G. (1996a) Cannabinoid receptor
genes. Prog. Neurobiol. 48; 275305.
ONAIVI, E. S., CHAKRABARTI, A., GWEBU, E. T. AND CHAUDHURI, G. (1996b)
Neurobehavioral effects of Ag-THC and cannabinoid (CBI) receptor gene expression in
mice. Behav. Brain Res. 22; 115-125.
ONAIVI, E. S., GREEN, M. R. AND MARTIN, B. R. (1990) Pharmacological
characterization of cannabinoids in the elevated plus-maze. J. Pharmacol. Exp. Ther.
a 1002-I 009.
PERTWEE, R. G. (1997) Pharmacology of cannabinoid CBI and CB2 receptors.
Pharmacol. Ther. 2 129-180.
Rio, D. C. (1992) RNA binding proteins, splice site selection, and alternative pm-mRNA
splicing. Gene Expression 2; 1-5.
SAMBROOK, J., FRITSCH, E. F. AND MANIATIS, T. (1989) Molecular cloning: A
laboratory manual. 2”” Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
New York.
THOMASSON, H. R., EDENBERG, H. J., CRABB, D. W., MAI, X. L., JEROME, R. E., LI, T.
K., WANG, S. P., LIN, Y. T., LU., R. B. and YIN, S. J. (1991) Alcohol and alcohol
dehydrogenase genotypes and alcoholism in Chinese men. American J. Human
genetics. 48; 677-681.
Inquires and reprint requests should be addressed to:
Dr. Emmanuel S. Onaivi
Department of Psychiatry (MCN-2125)
Vanderbilt University
Nashville, TN 37232
e-mail: Emmanuel.S.Onaivi@Vanderbilt.edu
... For example, CB1R is especially dense in the cerebral cortex, hippocampus, basal ganglia, cerebellum, and brain stem [29][30][31] despite also having function in hepatocytes 32 and adipocytes. 33,34 Despite CB2R being abundantly expressed throughout the periphery, 35 this receptor subtype also operates on glial cells such as astrocytes and microglia. 36,37 When it comes to the endocannabinoids, 2-AG exists in 170-times greater concentrations than AEA. ...
Chapter
Full-text available
Neurological crosstalk between the endocannabinoid and estrogen systems has been a growing topic of discussion over the last decade. Although the main estrogenic ligand, estradiol (E2), influences endocannabinoid signaling in both male and female animals, the latter experiences significant and rhythmic fluctuations in E2 as well as other sex hormones. This is referred to as the menstrual cycle in women and the estrus cycle in rodents such as mice and rats. Consisting of 4 distinct hormone-driven phases, the rodent estrus cycle modulates both endocannabinoid and exogenous cannabinoid signaling resulting in unique behavioral outcomes based on the cycle phase. For example, cannabinoid receptor agonist-induced antinociception is greatest during proestrus and estrus, when circulating and brain levels of E2 are high, as compared to metestrus and diestrus when E2 concentrations are low. Pain processing occurs throughout the cerebral cortex and amygdala of the forebrain; periaqueductal grey of the midbrain; and medulla and spine of the hindbrain. As a result, past molecular investigations on these endocannabinoid-estrogen system interactions have focused on these specific brain regions. Here, we will bridge regional molecular trends with neurophysiological evidence of how plasma membrane estrogen receptor (ER) activation by E2 leads to postsynaptic endocannabinoid synthesis, retrograde signaling, and alterations in inhibitory neurotransmission. These signaling pathways depend on ER heterodimers, current knowledge of which will also be detailed in this review. Overall, the aim of this review article is to systematically summarize how the cannabinoid receptors and endocannabinoids change in expression and function in specific brain regions throughout the estrus cycle.
... In fact, emerging evidence points to the existence of a functional crosstalk between microglia and circulating monocytes, which has been implicated in the response to social stress (80) and in the emergence of chronic pain (81) and neuroinflammation (82). It is thus plausible, although it remains to be demonstrated, that THC's impact on microglia might require CB 1 activation in monocytes (83,84) or other myeloid cells that might, for example, interrupt chemical communication with microglia. Consistent with this view, THC treatment lowered the numbers of monocytes in circulation and trafficking to the brain following LPS challenge ( Figure 6). ...
Article
Background During adolescence, microglia are actively involved in neocortical maturation while concomitantly undergoing profound phenotypic changes. As teenage years are also a time of experimentation with cannabis, we evaluated whether adolescence exposure to the drug’s psychotropic constituent, Δ⁹-tetrahydrocannabinol (THC), might persistently alter microglia function. Methods We administered THC (5 mg/kg, intraperitoneal) once daily to male and female mice from postnatal day (PND) 30 to PND44 and examined the transcriptome of purified microglia in adult animals (PND70 and PND120) under baseline conditions or following either of two interventions known to recruit microglia: lipopolysaccharide (LPS) injection and repeated social defeat (RSD). We used high-dimensional mass cytometry by time of flight to map brain immune cell populations after LPS challenge. Results Adolescence THC exposure produced in mice of both sexes a state of microglial dyshomeostasis which persisted until young adulthood (PND70) but receded with further aging (PND120). Key features of this state included broad alterations in genes involved in microglia homeostasis and innate immunity along with marked impairments in the responses to LPS and RSD-induced psychosocial stress. The endocannabinoid system was also dysfunctional. The effects of THC were prevented by coadministration of either a global CB1 receptor inverse agonist or a peripheral CB1 neutral antagonist and were not replicated when THC was administered in young adulthood (PND70-84). Conclusions Daily low-intensity CB1 receptor activation by THC during adolescence may disable critical functions served by microglia until young adulthood with potentially wide-ranging consequences for brain and mental health.
... Regional distribution of CB 2 R: CB 2 R was initially referred to as "peripheral cannabinoid receptors" due to their predominant expression in peripheral tissues including immune cells, spleen, tonsils, lymph nodes, liver, and the gastrointestinal tract (Galiègue et al., 1995;Onaivi et al., 1999) and the failure to detect CB 2 R in the CNS. However, more advanced techniques such as RNAscope ISH and fluorescence-activated cell sorting (FACS) followed by RT-PCR assays have unearthed CB 2 R expression in the CNS including the spinal cord (Nent, Nozaki, Schm€ ole, Otte, & Zimmer, 2019), brain stem (Van Sickle et al., 2005), hippocampus (Li & Kim, 2015), ventral tegmental area , and cerebellum (Gong et al., 2006). ...
Chapter
Cannabis legalization continues to progress in many US states and other countries. Δ⁹-tetrahydrocannabinol (Δ⁹-THC) is the major psychoactive constituent in cannabis underlying both its abuse potential and the majority of therapeutic applications. However, the neural mechanisms underlying cannabis action are not fully understood. In this chapter, we first review recent progress in cannabinoid receptor research, and then examine the acute CNS effects of Δ⁹-THC or other cannabinoids (WIN55212-2) with a focus on their receptor mechanisms. In experimental animals, Δ⁹-THC or WIN55212-2 produces classical pharmacological effects (analgesia, catalepsy, hypothermia, hypolocomotion), biphasic changes in affect (reward vs. aversion, anxiety vs. anxiety relief), and cognitive deficits (spatial learning and memory, short-term memory). Accumulating evidence indicates that activation of CB1Rs underlies the majority of Δ⁹-THC or WIN55121-2’s pharmacological and behavioral effects. Unexpectedly, glutamatergic CB1Rs preferentially underlie cannabis action relative to GABAergic CB1Rs. Functional roles for CB1Rs expressed on astrocytes and mitochondria have also been uncovered. In addition, Δ⁹-THC or WIN55212-2 is an agonist at CB2R, GPR55 and PPARγ receptors and recent studies implicate these receptors in a number of their CNS effects. Other receptors (such as serotonin, opioid, and adenosine receptors) also modulate Δ⁹-THC's actions and their contributions are detailed. This chapter describes the neural mechanisms underlying cannabis action, which may lead to new discoveries in cannabis-based medication development for the treatment of cannabis use disorder and other human diseases.
... The involvement of the endocannabinoid system in the regulation of the immune system was first described when a peripheral receptor for cannabinoids (cannabinoid 2 receptor (CB2r)) was identified and characterized in the macrophages found in the marginal zone of the spleen [35]. Human cannabinoid receptors and their gene transcripts were also identified in the blood samples from regular human volunteers who reported no prior use of marijuana [36]. Several reports using endocannabinoids, natural cannabinoids, and synthetic cannabinoids revealed a significant role of these compounds on inflammation and immunomodulation [37][38][39]. ...
Article
Full-text available
Substance use disorders are a group of diseases that are associated with social, professional, and family impairment and that represent a high socio-economic impact on the health systems of countries around the world. These disorders present a very complex diagnosis and treatment regimen due to the lack of suitable biomarkers supporting the correct diagnosis and classification and the difficulty of selecting effective therapies. Over the last few years, several studies have pointed out that these addictive disorders are associated with systemic and central nervous system inflammation, which could play a relevant role in the onset and progression of these diseases. Therefore, identifying different immune system components as biomarkers of such addictive disorders could be a crucial step to promote appropriate diagnosis and treatment. Thus, this work aims to provide an overview of the immune system alterations that may be biomarkers of various addictive disorders.
... In a study that investigated the regulation of cognition by circadian rhythm and sleep-wake cycle, it was reported that the amplitude of circadian modulation is higher in women than in men (Santhi et al., 2016). In addition, studies have reported that women show higher CBR1 protein expression (Onaivi et al., 1999) and are more susceptible to CBinduced visuospatial memory impairment and hemodynamic changes than men (Mathew et al., 2003). Female rats also demonstrate higher acquisition, Abdulrahim et al. ...
Article
Full-text available
Background Lipid profile and redox status play a role in brain (dys)functions. Cannabinoid and melatonergic systems operate in the brain and contribute to brain (patho)physiology, but their roles in the modulation of brain lipid and redox status are not well-known. We studied the effect of ethanol extract of Cannabis sativa (CS) and/or melatonin (M) on the lipid profile and anti-oxidant system of the rat brain. Methods We randomly divided twenty-four (24) female Wistar rats into 4 groups ( n = 6 rats each). Group 1 (control) received distilled water mixed with DMSO. Groups II–IV received CS (2 mg/kg), M (4 mg/kg), and co-administration of CS and M (CS + M) respectively via oral gavage between 8:00 am and 10:00 am once daily for 14 days. Animals underwent 12-h fasting after the last day of treatment and sacrificed under ketamine anesthesia (20 mg/kg; i.m). The brain tissues were excised and homogenized for assay of the concentrations of the total cholesterol (TC), triacylglycerol (TG), high-density lipoprotein cholesterol (HDL-C), nitric oxide (NO), malondialdehyde (MDA), and the activities of glucose-6-phosphate dehydrogenase (G6PD), glutathione reductase (GR), glutathione peroxidase (GPx), catalase (CAT), superoxide dismutase (SOD), and acetylcholinesterase (AChE). One-way analysis of variance (ANOVA) was used to compare means across groups, followed by the least significant difference (LSD) post-hoc test. Results CS and/or M did not affect the lipid profile parameters. However, CS increased the G6PD (from 15.58 ± 1.09 to 21.02 ± 1.45 U/L; p = 0.047), GPx (from 10.47 ± 0.86 to 17.71 ± 1.04 U/L; p = 0.019), and SOD (from 0.81 ± 0.02 to 0.90 ± 0.01 μM; p = 0.007), but decreased NO (from 9.40 ± 0.51 to 6.75 ± 0.21 μM; p = 0.010) and had no effect on MDA ( p = 0.905), CAT ( p = 0.831), GR ( p = 0.639), and AChE ( p = 0.571) in comparison with the control group. M augmented the increase in G6PD (from 21.02 ± 1.45 U/L to 27.18 ± 1.81 U/L; p = 0.032) and decrease in NO (from 6.75 ± 0.21 to 4.86 ± 0.13 μM; p = 0.034) but abolished the increase in GPx (from 17.71 ± 1.04 to 8.59 ± 2.06 U/L; p = 0.006) and SOD (from 0.90 ± 0.01 to 0.70 ± 0.00 μM; p = 0.000) elicited by CS in the rat brain in comparison with the CS group. Conclusions CS and M do not alter brain lipid profile. Our data support the contention that CS elicits an anti-oxidative effect on the brain tissue and that CS + M elicits a pro-oxidant effect in rat brain.
... More importantly, alterations of the ECS appears to be sex specific. For instance, women exhibit higher CB1 expression than males in human blood cells (Onaivi et al., 1999). Moreover, women and males respond differently to cannabinoids. ...
Thesis
Occidental countries currently face an epidemic of obesity and related diseases. As eating disorders and drug addiction are both complex pathologies inducing long-term neuroadaptations, we investigated common alterations induced by either sugar or cocaine intake in reward-related brain regions. We focused our research on the endocannabinoid and opioid systems, as both systems are expressed in the central nervous system and play a crucial role in drug reward and food intake. Overall, our results highlight the hippocampus as a highly involved brain site following cocaine use. Moreover, our work sheds light on epigenetic mechanisms regulating the endocannabinoid system. More importantly, we demonstrate that a binge-like intake of sucrose induced similar transcriptional adaptations to that of voluntary cocaine intake in the nucleus accumbens. These findings may pave the way to new therapeutic targets for addictive behaviors.
... The CB1 receptor density has been inversely correlated with anandamide and other endocannabinoid levels, implying that men had a high concentration of endogenous ligands, which might be a factor contributing not only to the increased risk of developing stressrelated disorders but also to symptom severity in women [40]. In blood samples, the availability of CB1 receptors is also higher in women than men [113]. In rodents, gonadal hormones (e.g., estradiol) regulate the CB1 receptor density [114], transcription [115], and signal transduction [116], which ultimately influences the content of endocannabinoids [117] and their CB1 receptor affinity [118]. ...
Article
Full-text available
Background: Posttraumatic stress disorder (PTSD) may stem from the formation of aberrant and enduring aversive memories. Some PTSD patients have recreationally used Cannabis, probably aiming at relieving their symptomatology. However, it is still largely unknown whether and how Cannabis or its psychotomimetic compound Δ9-tetrahydrocannabinol (THC) attenuates the aversive/traumatic memory outcomes. Here, we seek to review and discuss the effects of THC on aversive memory extinction and anxiety in healthy humans and PTSD patients. Methods: Medline, PubMed, Cochrane Library, and Central Register for Controlled Trials databases were searched to identify peer-reviewed published studies and randomized controlled trials in humans published in English between 1974 and July 2020, including those using only THC and THC combined with cannabidiol (CBD). The effect size of the experimental intervention under investigation was calculated. Results: At low doses, THC can enhance the extinction rate and reduce anxiety responses. Both effects involve the activation of cannabinoid type-1 receptors in discrete components of the corticolimbic circuitry, which could couterbalance the low "endocannabinoid tonus" reported in PTSD patients. The advantage of associating CBD with THC to attenuate anxiety while minimizing the potential psychotic or anxiogenic effect produced by high doses of THC has been reported. The effects of THC either alone or combined with CBD on aversive memory reconsolidation, however, are still unknown. Conclusions: Current evidence from healthy humans and PTSD patients supports the THC value to suppress anxiety and aversive memory expression without producing significant adverse effects if used in low doses or when associated with CBD. Future studies are guaranteed to address open questions related to their dose ratios, administration routes, pharmacokinetic interactions, sex-dependent differences, and prolonged efficacy.
Article
Full-text available
Studies investigating the psychosomatic effects of social isolation in animals have shown that one of the physiologic system that gets disrupted by this environment-affective change is the Endocannabinoid System. As the levels of endocannabinoids change in limbic areas and prefrontal cortex during stressful times, so is the subject more prone to fearful and negative thoughts and aggressive behavior. The interplay of social isolation on the hypothalamic-pituitary-adrenal axis and cannabinoid tone triggers a vicious cycle which further impairs the natural body's homeostatic neuroendocrine levels and provokes a series of risk factors for developing health complications. In this paper, we explore the psychosomatic impact of prolonged quarantine in healthy individuals, and propose management and coping strategies that may improve endocannabinoid tone, such as integration of probiotics, cannabidiol, meditation, and physical exercise interventions with the aim of supporting interpersonal, individual, and professional adherence with COVID-19 emergency public measures whilst minimizing their psycho-physical impact.
Article
Full-text available
Cannabinoids have been shown to protect the retina from ischemic/excitotoxic insults. The aim of the present study was to investigate the neuroprotective and anti-inflammatory properties of the synthetic cannabinoid (R)-WIN55,212-2 (CB1/CB2 receptor agonist) when administered acutely or subchronically in control and AMPA treated retinas. Sprague-Dawley rats were intravitreally administered (acutely) with vehicle or AMPA, in the absence or presence of (R)-WIN55,212-2 (10-7-10-4M) alone or in combination with AM251 [CB1 receptor antagonist/inverse agonist,10-4M] and AM630 (CB2 receptor antagonist,10-4M). In addition, AMPA was co-administered with the racemic (R,S)-WIN55,212 (10-4Μ). (R)-WIN55,212-2 was also administered subchronically (25,100 μg/kg,i.p.,4d) in control and AMPA treated rats. Immunohistochemical studies were performed using antibodies against the CB1R, and retinal markers for retinal neurons (brain nitric oxide synthetase, bNOS) and microglia (ionized calcium binding adaptor molecule 1, Iba1). ELISA assay was employed to assess TNFα levels in AMPA treated retinas. Intravitreal administration of (R)-WIN55,212-2 reversed the AMPA induced loss of bNOS expressing amacrine cells, an effect that was blocked by both AM251 and AM630. (R,S)WIN55,212 had no effect. (R)-WIN55,212-2 also reduced a) the AMPA induced activation of microglia, by activating CB2 receptors that were shown to be colocalized with Iba1+ reactive microglial cells, and b) TNFα levels in retina. (R)-WIN55,212-2 administered subchronically led to the downregulation of CB1 receptors at the high dose of 100 μg/kg(i.p.), and to the attenuation of the WIN55,212-2 induced neuroprotection of amacrine cells. At the same dose, (R)-WIN55,212-2 did not attenuate the AMPA induced increase in the number of reactive microglia cells, suggesting CB2 receptor downregulation under subchronic conditions. This study provides new findings regarding the role of CB1 and CB2 receptor activation by the synthetic cannabinoid (R)-WIN55,212-2, administered acutely or sub-chronically, on neuron viability and microglia activation in healthy and diseased retina.
Article
Background Cannabinoid receptor 1 (CB1) identification by western blot (WB) has generated a great deal of controversial data making the interpretation of the results difficult. Our purpose is to find the most adequate experimental conditions to detect CB1 by WB and immunoprecipitation (IP) as a first step towards the study of CB1 interactome. New Method We use CB1 knockout mice tissue as negative controls and describe appropriate sample handling conditions for CB1 detection by WB and IP from brain and cortical neuron cultures. Results Sample heating above 65 °C greatly impaired CB1 detection by WB, since it favored the formation of high molecular weight aggregates. We also show the convenience of using n-dodecyl−β−D–maltoside (DDM) as a detergent for the detection of CB1 by WB and, mostly, for IP. Comparison with Existing Method(s) We obtain consistent and specific CB1 detection by WB and IP using four different commercial antibodies and KO tissue for an accurate CB1 identification. We clarify the identification of the receptor in complex samples compared with the diverse and unclear results obtained using standard WB methods. Conclusions We establish experimental guidelines for the detection of CB1 by WB and the study of CB1 interacting proteins by IP. We propose a new interpretation of CB1 WB and IP data based on the folding and packing state of the protein and the detergent used. The standardization of the most advantageous conditions for coimmunoprecipitation (CoIP) would be a useful tool for the future study of the interactome of CB1.
Article
Full-text available
Arachidonylethanolamide, an arachidonic acid derivative in porcine brain, was identified in a screen for endogenous ligands for the cannabinoid receptor. The structure of this compound, which has been named "anandamide," was determined by mass spectrometry and nuclear magnetic resonance spectroscopy and was confirmed by synthesis. Anandamide inhibited the specific binding of a radiolabeled cannabinoid probe to synaptosomal membranes in a manner typical of competitive ligands and produced a concentration-dependent inhibition of the electrically evoked twitch response to the mouse vas deferens, a characteristic effect of psychotropic cannabinoids. These properties suggest that anandamide may function as a natural ligand for the cannabinoid receptor.
Article
Full-text available
Marijuana and many of its constituent cannabinoids influence the central nervous system (CNS) in a complex and dose-dependent manner. Although CNS depression and analgesia are well documented effects of the cannabinoids, the mechanisms responsible for these and other cannabinoid-induced effects are not so far known. The hydrophobic nature of these substances has suggested that cannabinoids resemble anaesthetic agents in their action, that is, they nonspecifically disrupt cellular membranes. Recent evidence, however, has supported a mechanism involving a G protein-coupled receptor found in brain and neural cell lines, and which inhibits adenylate cyclase activity in a dose-dependent, stereoselective and pertussis toxin-sensitive manner. Also, the receptor is more responsive to psychoactive cannabinoids than to non-psychoactive cannabinoids. Here we report the cloning and expression of a complementary DNA that encodes a G protein-coupled receptor with all of these properties. Its messenger RNA is found in cell lines and regions of the brain that have cannabinoid receptors. These findings suggest that this protein is involved in cannabinoid-induced CNS effects (including alterations in mood and cognition) experienced by users of marijuana.
Article
The differential sensitivity following the administration of delta 9-THC to 3 mouse strains, C57BL/6, DBA/2 and ICR mice, indicated that some of the neurobehavioral changes may be attributable to genetic differences. The objective of this study was to determine the extent to which the cannabinoid (CB1) receptor is involved in the observed behavioral changes following delta 9-THC administration. This objective was addressed by experiments using: (1) DNA-PCR and reverse PCR; (2) systemic administration of delta 9-THC, and; (3) intracerebral microinjection of delta 9-THC. The site specificity of action of delta 9-THC in the brain was determined using stereotaxic surgical approaches. The intracerebral microinjection of delta 9-THC into the nucleus accumbens was found to induce catalepsy, while injection of delta 9-THC into the central nucleus of amygdala resulted in the production of an anxiogenic-like response. Although the DNA-PCR data indicated that the CB1 gene appeared to be identical and intronless in all 3 mouse strains, the reverse PCR data showed two additional distinct CB1 mRNAs in the C57BL/6 mouse which also differed in pain sensitivity and rectal temperature changes following the administration of delta 9-THC. It is suggested that the diverse neurobehavioral alterations induced by delta 9-THC may not be mediated solely by the CB1 receptors in the brain and that the CB1 genes may not be uniform in the mouse strains.
Article
The liver enzymes alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH), which are responsible for the oxidative metabolism of ethanol, are polymorphic in humans. An allele encoding an inactive form of the mitochondrial ALDH2 is known to reduce the likelihood of alcoholism in Japanese. We hypothesized that the polymorphisms of both ALDH and ADH modify the predisposition to development of alcoholism. Therefore, we determined the genotypes of the ADH2, ADH3, and ALDH2 loci of alcoholic and nonalcoholic Chinese men living in Taiwan, using leukocyte DNA amplified by the PCR and allele-specific oligonucleotides. The alcoholics had significantly lower frequencies of the ADH2*2, ADH3*1, and ALDH2*2 alleles than did the nonalcoholics, suggesting that genetic variation in both ADH and ALDH, by modulating the rate of metabolism of ethanol and acetaldehyde, influences drinking behavior and the risk of developing alcoholism.
Article
delta 9-Tetrahydrocannabinol (delta 9-THC) induced in both rats and mice an increased aversion to the open arms of the elevated plus maze which was similar to that produced by anxiogenic agents. This effect of delta 9-THC was approximately three times greater in rats than in mice. When the behavioral effects of the cannabinoids were characterized further in the mouse, it was found that delta 9-11-THC, 12 beta-NH2-delta 8-THC, levonantradol and (-)-11-OH-delta 8-THC-DMH produced effects that were similar to those of delta 9-THC. The effect was found to be enantioselective in that (+)-11-OH-delta 8-THC-DMH was inactive even at a dose 200 times greater than an active dose of (-)-11-OH-delta 8-THC-DMH. In contrast to the effects of delta 9-THC, mice treated with cannabidiol and nabilone spent a greater amount of time in the open arm of the maze, an effect similar to that produced by diazepam, the reference anxiolytic agent. In this test situation, 11-nor-delta 8-THC-9-carboxylic acid and abnormal cannabidiol did not alter the behavior of the animals at doses up to 20 and 100 mg/kg, respectively. Pretreatment with either the bidirectional inverse agonist carboline-3-carboxylate or diazepam (at doses that did not modify normal behavior on the elevated plus maze) blocked the effect of delta 9-THC.(ABSTRACT TRUNCATED AT 250 WORDS)