No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Nitric oxide synthase sequences in the marine fish Stenotomus chrysops and the sea urchin Arbacia punctulata, and phylogenetic analysis of nitric oxide synthase calmodulin-binding domains
Abstract
The phylogenetic distribution and structural diversity of the nitric oxide synthases (NOS) remain important and issues that are little understood. We present sequence information, as well as phylogenetic analysis, for three NOS cDNAs identified in two non-mammalian species: the vertebrate marine teleost fish Stenotomus chrysops (scup) and the invertebrate echinoderm Arbacia punctulata (sea urchin). Partial gene sequences containing the well-conserved calmodulin (CaM)-binding domain were amplified by RT-PCR. Identical 375-bp cDNAs were amplified from scup brain, heart, liver and spleen; this sequence shares 82% nucleic acid and 91% predicted amino acid identity with the corresponding region of human neuronal NOS. A 387-bp cDNA was amplified from sea urchin ovary and testes; this sequence shares 72% nucleic acid identity and 65% deduced amino acid identity with human neuronal NOS. A second cDNA of 381 bp was amplified from sea urchin ovary and it shares 66% nucleic acid and 57% deduced amino acid identity with the first sea urchin sequence. Together with earlier reports of neuronal and inducible NOS sequences in fish, these data indicate that multiple NOS isoforms exist in non-mammalian species. Phylogenetic analysis of these sequences confirms the conserved nature of NOS, particularly of the calmodulin-binding domains.
Supplementary resources (3)
Nucleotide Sequence
October 1999
Nucleotide Sequence
October 1999
Nucleotide Sequence
October 1999
... The objective of the present study was to investigate iNOS and eNOS mRNA expression during the development of liver abscesses in hamsters inoculated with E. histolytica trophozoites. Inducible and endothelial NOS cDNA fragments from lipopolysaccaride-stimulated hamster MFs were isolated using the reverse transcriptase (RT) and nested touch-down polymerase chain reaction (PCR), and degenerate oligonucleotide primers were designed against a portion of the mammalian NOS genes that code for the Ca 2+ -CaM-binding region [6]. In hamster MFs in vitro, the iNOS mRNA was LPS-inducible, while the eNOS mRNA was constitutively expressed. ...
... In order to isolate NOS cDNA from hamster, thioglycollateinduced MFs were stimulated with LPS in vitro. We used reported degenerate oligonucleotide primers designed to amplify a portion of the mammalian NOS gene that codes for the Ca 2+ -CaM binding region [6]. A combination of nested and touch-down RT-PCR was performed to amplify the coding sequences for hamster NOS. ...
... To accomplish this, it was necessary to study iNOS and eNOS mRNA expression in immune cells, and peritoneal thioglycollate-induced hamster MFs were used for this purpose. Isolation of the hamster iNOS and eNOS Ca 2+ -CaM binding cDNA region was possible through the combination of nested and touch-down RT-PCR, and degenerate oligonucleotides described by Cox et al. [6]. Nested RT-PCR has been seen to enrich mRNA when it is at very low concentrations [30]. ...
... iNOS mRNA was amplified using a nested RT-PCR method [24] . The sequences of primers (Invitrogen Life Technologies, Carlsbad, CA) used in this study are shown in Table 1 [24][25][26] . ...
... The amount of NO measured by high performance liquid chromatography in each group is shown in Figure 2. The concentration of NO2 -+ NO3in the media was Table 1 [25] , 2001 NOS-893R AAGGCRCARAASTGDGGRTA Cox et al [25] , 2001 NOS40F GCAGGATGGGAAACTGAGGCCCAG Ramirez-Emiliano et al [24] , 2005 NOS40R TGAACAAGGCAGCCAGGTCCCGG Ramirez-Emiliano et al [24] , 2005 GAPDHF TCCCTCAAGATTGTCAGCAA Liu et al [26] , 1993 GAPDHR AGATCCACAACGGATACATT Liu et al [26] , 1993 NO generation was significantly higher in the CM group than in the control group (P < 0.001). Meanwhile, NO generation in the CM + L-NMMA group and control group was similar, and significantly lower than that in the CM group (P < 0.001). ...
... The amount of NO measured by high performance liquid chromatography in each group is shown in Figure 2. The concentration of NO2 -+ NO3in the media was Table 1 [25] , 2001 NOS-893R AAGGCRCARAASTGDGGRTA Cox et al [25] , 2001 NOS40F GCAGGATGGGAAACTGAGGCCCAG Ramirez-Emiliano et al [24] , 2005 NOS40R TGAACAAGGCAGCCAGGTCCCGG Ramirez-Emiliano et al [24] , 2005 GAPDHF TCCCTCAAGATTGTCAGCAA Liu et al [26] , 1993 GAPDHR AGATCCACAACGGATACATT Liu et al [26] , 1993 NO generation was significantly higher in the CM group than in the control group (P < 0.001). Meanwhile, NO generation in the CM + L-NMMA group and control group was similar, and significantly lower than that in the CM group (P < 0.001). ...
... In nonmammalian animals it appears that all these isoforms do not always exist, but in fish and sea urchin, there are indications for at least two NOS isoforms (Bicker 2001, Cox, et al. 2001. NOS usually shows more sequence similarity between species than between isoforms, and the parts binding the cofactors required for the function of the enzyme are highly conserved regions of the NOS molecule (Cox, Mariano, Heck, Laskin and Stegeman 2001). ...
... In nonmammalian animals it appears that all these isoforms do not always exist, but in fish and sea urchin, there are indications for at least two NOS isoforms (Bicker 2001, Cox, et al. 2001. NOS usually shows more sequence similarity between species than between isoforms, and the parts binding the cofactors required for the function of the enzyme are highly conserved regions of the NOS molecule (Cox, Mariano, Heck, Laskin and Stegeman 2001). ...
... NOS has been detected with immunohistochemistry in the nervous system of the echinoderm starfish Marthasterias glacialis, using antibodies against mammalian nNOS (Martinez, et al. 1994) and two different NOS isoforms have been sequenced in the sea urchin Arbacia punctulata (Cox, et al. 2001). This indicates a high probability for the existence of a brittlestar NOS, although this was not detected with the antibodies used in this study. ...
... The objective of the present study was to investigate iNOS and eNOS mRNA expression during the development of liver abscesses in hamsters inoculated with E. histolytica trophozoites. Inducible and endothelial NOS cDNA fragments from lipopolysaccaride-stimulated hamster MFs were isolated using the reverse transcriptase (RT) and nested touch-down polymerase chain reaction (PCR), and degenerate oligonucleotide primers were designed against a portion of the mammalian NOS genes that code for the Ca 2+ -CaM-binding region [6]. In hamster MFs in vitro, the iNOS mRNA was LPS-inducible, while the eNOS mRNA was constitutively expressed. ...
... In order to isolate NOS cDNA from hamster, thioglycollateinduced MFs were stimulated with LPS in vitro. We used reported degenerate oligonucleotide primers designed to amplify a portion of the mammalian NOS gene that codes for the Ca 2+ -CaM binding region [6]. A combination of nested and touch-down RT-PCR was performed to amplify the coding sequences for hamster NOS. ...
... To accomplish this, it was necessary to study iNOS and eNOS mRNA expression in immune cells, and peritoneal thioglycollate-induced hamster MFs were used for this purpose. Isolation of the hamster iNOS and eNOS Ca 2+ -CaM binding cDNA region was possible through the combination of nested and touch-down RT-PCR, and degenerate oligonucleotides described by Cox et al. [6]. Nested RT-PCR has been seen to enrich mRNA when it is at very low concentrations [30]. ...
The present study analyzed iNOS and eNOS mRNA expression and NO production during development of hepatic abscess caused by Entamoeba histolytica trophozoites. One 374-bp sequence, which displayed 88% identity to mammalian iNOS protein, was isolated from LPS-stimulated peritoneal hamster macrophages. A separate 365-bp cDNA sequence showed 99% identity with eNOS protein. iNOS mRNA was detected in hamsters during formation of amoebic liver abscesses, but not in control hamsters. eNOS mRNA expression was not modified. Serum nitrite concentration in hamsters infected with E. histolytica was 33 +/- 6 microM, in control hamsters was 20 +/- 3 microM. The study shows that iNOS mRNA expression and NO production are induced by E. histolytica trophozoites during amoebic liver abscess formation. However, in spite of iNOS mRNA expression and NO production, E. histolytica trophozoites induced liver abscess formation in hamster.
... In metazoans, the NO synthase structure is highly conserved. A sea urchin NO synthase gene has been described (Cox et al., 2001), and genes for a neuronal NOS and a soluble guanylyl cyclase described in mollusks (Fujie et al., 2005;Matsuo et al., 2008). Insect NO synthase has been well characterized (Imamura et al., 2002;Ohtsuki et al., 2008;Regulski and Tully, 1995;Yuda et al., 1996) and a similar crustacean NO synthase described (Kim et al., 2004). ...
... Why this particular creature should get along fine without this otherwise ubiquitous messenger is a puzzle; perhaps it is just to frustrate geneticists interested in this novel messenger. NO synthase has been described in all vertebrates examined, including fish (Cox et al., 2001), amphibians, reptiles, birds, and mammals including primates. Vertebrates express three distinct isoforms of NO synthase that are highly homologous, yet have distinct structures, regulation and distribution (Stuehr, 1999). ...
Nitric oxide was identified as a biological intercellular messenger just over 20 years ago, and its presence and potential importance in the nervous system was immediately noted. With the cloning of NO synthase and the physiological NO receptor soluble guanylyl cyclase, a variety of histochemical methods quickly led to a rather complete picture of where NO is produced and acts in the nervous system. However, the details regarding the subcellular localization of NO synthase and the identity of its molecular binding partners require further clarification. Although the hypothesis that calcium influx via activation of NMDA receptors is a key trigger for NO production has proven very popular and led to suggested roles for NO in synaptic plasticity, there is little direct evidence to support this notion. Instead, studies from the peripheral nervous system indicate a key role for voltage-sensitive calcium channels in regulating NO synthase activity. A similar mechanism may also be important in central neurons, and it remains an important task to identify the precise sources of calcium regulating NO production in specific NO neurons. Also, although cGMP production appears to mediate the physiological signaling by NO, the specific roles of cGMP-dependent ion channels, protein kinases and phosphodiesterases in mediating NO action remain to be determined.
... outgroups and low support of internal branches (e.g. Cox et al., 2001; Wang et al., 2001). Recent availability of numerous completely sequenced or draft assemblies of vertebrate and invertebrate genomes allowed us to overcome these limitations. ...
... Interestingly, our genome-wide search did not identify any eNOS homologs from zebrafish, tetraodon or takifugu genomes, suggesting that eNOS was either lost in the fish lineage or appeared due to a gene duplication in the tetrapod lineage after it had split from their common ancestors with fish. This agrees with earlier studies that found only nNOS and iNOS but not eNOS homologues in fish ( Cox et al., 2001;Wang et al., 2001;Hyndman et al., 2006;Reddick et al., 2006). By contrast, genomes of all invertebrates (including A. V. Ivanina and others Asterisks represent values significantly different from the control (0moll-1 Cd) (P<0.05); ...
Nitric oxide (NO) is an intracellular signaling molecule synthesized by a group of enzymes called nitric oxide synthases (NOS) and involved in regulation of many cellular functions including mitochondrial metabolism and bioenergetics. In invertebrates, the involvement of NO in bioenergetics and metabolic responses to environmental stress is poorly understood. We determined sensitivity of mitochondrial and cellular respiration to NO and the effects of cadmium (Cd) and intermittent anoxia on NO metabolism in eastern oysters, Crassostrea virginica. NOS activity was strongly suppressed by exposure to 50 microg l(-1) Cd for 30 days (4.76 vs 1.19 pmol NO min(-1) mg(-1) protein in control and Cd-exposed oysters, respectively) and further decreased during anoxic exposure in Cd-exposed oysters but not in their control counterparts. Nitrate/nitrite content (indicative of NO levels) decreased during anoxic exposure to less than 10% of the normoxic values and recovered within 1 h of re-oxygenation in control oysters. In Cd-exposed oysters, the recovery of the normoxic NO levels lagged behind, reflecting their lower NOS activity. Oyster mitochondrial respiration was inhibited by exogenous NO, with sensitivity on a par with that of mammalian mitochondria, and ADP-stimulated mitochondrial respiration was significantly more sensitive to NO than resting respiration. In isolated gill cells, manipulations of endogenous NOS activity either with a specific NOS inhibitor (aminoguanidine) or a NOS substrate (L-arginine) had no effect on respiration, likely due to the fact that mitochondria in the resting state are relatively NO insensitive. Likewise, Cd-induced stimulation of cellular respiration did not correlate with decreased NOS activity in isolated gill cells. High sensitivity of phosphorylating (ADP-stimulated) oyster mitochondria to NO suggests that regulation of bioenergetics is an evolutionarily conserved function of NO and that NO-dependent regulation of metabolism may be most prominent under the conditions of high metabolic flux when the ADP-to-ATP ratio is high.
... The studies available so far in mammals thus provide convincing evidence that NO is involved in many of the ovarian functions and plays a crucial role in reproductive processes. The information regarding the role of NO in the ovary of lower vertebrates is surprisingly lacking, although the presence of NOS has been demonstrated in the hypothalamo-hypophyseal complex of some fish species (Holmqvist et al. 2000, Oyan et al. 2000, Saiej et al. 2000, Cox et al. 2001). ...
... The studies available so far in mammals thus provide convincing evidence that NO is involved in many of the ovarian functions and plays a crucial role in reproductive processes. The information regarding the role of NO in the ovary of lower vertebrates is surprisingly lacking, although the presence of NOS has been demonstrated in the hypothalamo-hypophyseal complex of some fish species (Holmqvist et al. 2000, Saiej et al. 2000, Cox et al. 2001). The present study in the fish, Heteropneustes fossilis, aimed to: a) detect the presence and distribution of the NOS isoforms in the ovary by means of immunohistochemistry, b) determine the molecular weight of the NOS isoforms by western blot analysis, c) estimate changes in NOS activity and NO level in the ovary during reproductive cycle, and d) examine the role of NO in oocyte meiotic maturation. ...
The purpose of the study was to demonstrate the presence of nitric oxide (NO) synthase (NOS) isoforms (neuronal NOS (nNOS), inducible NOS (iNOS), and endothelial NOS (eNOS)) and the role of NO in the ovary of Heteropneustes fossilis. In one half of the ovary collected during different reproductive stages, NOS isoforms were localized immunohistochemically in paraffin sections whereas the other half was processed for NOS and NO quantification using western blot followed by densitometry and nitrate/nitrite assay respectively. The role of NO on oocyte maturation was studied by examining the effect of NO donor (sodium nitroprusside; SNP) and NOS inhibitor (Nomega-nitro-l-arginine methyl ester) on 17alpha,20beta-dihydroxy-4-pregnen-3-one (17alpha,20beta-P)-induced germinal vesicle breakdown (GVBD) in the cultured oocyte collected during prespawning phase. NOS immunostaining was predominantly localized in previtellogenic follicles, with nNOS detected in the nucleus and cytoplasm of oocytes whereas iNOS and eNOS localized in granulosa, theca cells, and cytoplasm of oocytes. The NOS expression was higher in previtellogenic phase when compared with vitellogenic phase. The nitrate/nitrite concentrations in ovary showed gradual increase from recrudescence (4.9+/-0.19 nM/mg protein) to late previtellogenic phase (7.02+/-0.53 nM/mg protein), but showed a sharp decline during the vitellogenic phase (0.41+/-0.053 nM/mg protein). Serum and ovarian nitrate/nitrite level showed a close association during the reproductive cycle. The results showed an increase in NOS activity and nitrate/nitrite concentrations as the follicle grow suggesting involvement of NO in follicular development. SNP significantly inhibited 17alpha,20beta-P-induced GVBD in fish oocytes. Thus, it is concluded that the fish ovary possesses NOS/NO system and a possibility that NO has a role in follicular development and regulation of oocyte maturation in fish, H. fossilis.
... Isoforms of NOS have been isolated from fish (Olsson and Holmgren, 1997;Nilsson and Söderström, 1997 for review) and invertebrates (mainly insects and molluscs) and partly sequenced (Moroz et al., 1996;Martinez, 1995;Jacklet, 1997;Arumugam et al., 2000). Calcium-calmodulin dependence and cofactor requirements are conserved in both phylogenetic groups (Cox et al., 2001). Data on NO signaling in diverse phyla suggest that a common ancestor had the ability to use NO signaling and that it conferred high adaptive value (Olsson and Holmgren, 1997;Jacklet, 1997). ...
... Data on NO signaling in diverse phyla suggest that a common ancestor had the ability to use NO signaling and that it conferred high adaptive value (Olsson and Holmgren, 1997;Jacklet, 1997). Among the physiological functions ascribed to NO in marine invertebrates and fish, its neurotransmitter function and its role in cellular immune defence are the most outstanding (Cox et al., 2001;Arumugam et al., 2000). In marine and freshwater molluscs, NO signaling is involved in muscle contraction and relaxation, mucus secretion and excretion, and in triggering feeding behavior (Moroz et al., 1996). ...
High oxygen solubility at cold-water temperature is frequently considered to be responsible for an apparently elevated level of antioxidant protection in marine ectotherms from polar environments. However, tissue oxidative stress is in most cases a function of elevated or variable pO2, rather than of an elevated tissue oxygen concentration. This review summarizes current knowledge on pro- and antioxidant processes in marine invertebrates and fish, and relates reactive oxygen species (ROS) formation in polar ectotherms to homeoviscous adaptations of membrane and storage lipids, as well as to tissue hypoxia and re-oxygenation during physiological stress.
... Nitric oxide (NO) is a freely diffusible unconventional neurotransmitter and neuromodulator molecule that is increasingly found to play an important role in several physiological systems, from invertebrates to mammals (Jacklet, 1997). Since the presence of an NO system has been described in several fish species (Schober et al., 1993;Olsson and Holmgren, 1997;Nilsson and Söderström, 1997;Cox et al., 2001), we investigated the possible role of NO as a neurotransmitter and/or modulator of the adrenergic control of bioluminescence, using isolated ventral photophores of Argyropelecus hemigymnus. ...
... Several studies have established the presence of ntype NOS and i-type NOS, but not eNOS, in teleost fish (e.g. Laing et al., 1999;Øjan et al., 2000;Cox et al., 2001;Jennings, 2004). The antibodies used in the present study were raised against the mammalian isoforms of NOS (nNOS, eNOS, . ...
Nitric oxide synthase-like immunoreactivity (NOS-LI IR) was detected by immunohistochemistry in ventral light organs of the mesopelagic fish, Argyropelecus hemigymnus. Strong NOS-LI IR was present in nerve fibres and in other cells central for production or modulation of light: immunoreactive fibres surrounded the photophores, and were also present in the filter area. Filter cells, particularly in the outer layers, showed strong IR throughout the cytoplasm. Pharmacological studies suggested that nitric oxide (NO) modulates adrenaline-stimulated light emission, and that the modulation is correlated to the ability of the light organ to respond to adrenaline. Adrenaline is known to produce two different types of light response in isolated photophores from Argyropelecus: a slow, long-lasting, high intensity response, or a fast and weak response of short duration. Incubation of photophores in the NO donors sodium nitroprusside or S-nitroso-N-acetylpenicillamine prior to adrenaline stimulation reduced the intensity of the strong and long-lasting type of response, but had little or even a potentiating effect on the weakly responding photophores. Hydroxylamine, which is converted to NO if catalase activity is present in the tissue, reduced the duration and the intensity of the adrenaline response in all tested organs. The NOS-inhibitor L-thiocitrulline potentiated the adrenaline response in the weakly responding organs; the weaker the adrenaline effect, the stronger the potentiation caused by L-thiocitrulline. The strongly responding organs were instead inhibited by L-thiocitrulline. The results suggest that NO has an important role in the control of light emission from Argyropelecus hemigymnus photophores. The cGMP analogue dibutyryl cGMP, the guanylate cyclase inhibitor ODQ and the phosphodiesterase inhibitor pentoxiphylline had no effect, indicating that the NO effect does not involve cGMP.
... Up to now, a full-length cDNA has been sequenced for iNOS from chicken macrophages [31], Cyprinus carpio phagocytes [42] and from bacterially stimulated Oncorhyncus mykiss gill [47], whereas partial cDNA for iNOS has been sequenced from Carassius auratus macrophages [30] and Salmo salar thymus [38]. As regards the constitutive NOS isoforms, different cDNAs for nNOS were cloned from the brain of some teleosts, a complete genomic sequence in Danio rerio [40] and a partial cloning in S. salar [38] and Stenotomus chrysops [17]. However, cDNA for nNOS from the teleosts Takifugu poecilonatus, Oryzias latipes and Fundulus heteroclitus, elasmobranch Squalus acanthias, the amphibian Xenopus laevis and bird Gallus gallus have been deposited in the GenBank, and their sequence data are available. ...
... In teleosts, partial nNOS gene sequences containing the well-conserved CaM-binding domain were amplified by RT-PCR in S. salar [38], S. chrysops [17] and D. rerio [25]. Sequence alignment analysis revealed elevated percentages of nucleotide and amino acid sequence identity among O. niloticus and other vertebrate nNOS. ...
A constitutive NOS complementary DNA (cDNA) was partially cloned by RT-PCR from the brain of a teleost, the Nile tilapia (Oreochromis niloticus), using degenerate primers against conserved regions of NOS. The predicted 206-long amino acid sequence showed a high degree of identity with other vertebrate neuronal NOS (nNOS) protein sequences. In addition, phylogenetic analysis revealed that Nile tilapia NOS clustered with other known nNOS. Using the coupled reaction of semi-quantitative RT-PCR and Southern blotting, the basal tissue expression pattern of the cloned nNOS gene was investigated in discrete areas of the central nervous system (CNS) and in the heart and skeletal muscle tissue. As revealed, expression of nNOS transcripts was detected in all the CNS regions examined, whereas nNOS gene was not expressed in the heart and skeletal muscle. The distribution pattern of nNOS gene expression showed the highest expression levels in the forebrain followed by the optic tectum, the brainstem and the spinal cord, whereas scarce expression was detected in the cerebellum. Cellular expression of nNOS mRNA was analyzed in the CNS by means of in situ hybridization. According to the RT-PCR results, most nNOS mRNA expressing neurons are localized in the telencephalon and diencephalon, whereas in the mesencephalic optic tectum, the brainstem and the spinal cord, nNOS mRNA expressing neurons are relatively more scattered. A very low hybridization signal was detected in the cerebellar cortex. These results suggest that NO is involved in numerous brain functions in teleosts.
... The relative contribution of each isoform to Ca 2ϩ release pathways at fertilization remains unclear. Two distinct NOS cDNAs that are expressed in testes and ovary have been identified in sea urchins (Cox et al., 2001;Sodergren, 2006). ...
... NOS can be activated not only by PKC-mediated phosphorylation, but also by Ca 2ϩ and calmodulin (Matsubara et al., 2003). In fact, binding to calmodulin via the highly conserved calmodulin-binding domains is essential for NOS function (Cox et al., 2001;Li and Poulos, 2005) and different NOS isoforms bind calmodulin with different affinities. While nNOS and eNOS, which are expressed in a constitutive manner, bind calmodulin in a Ca 2ϩ -dependent manner, iNOS, which is expressed upon induction of the immune response, binds calmodulin constitutively at physiological Ca 2ϩ levels of about 100 nM (Li and Poulos, 2005). ...
Sperm interaction with an egg in animals was first documented 160 years ago in sea urchins by Alphonse Derbès (1847) when he noted the formation of an "envelope" following the sperm's "approach" to the egg. The "envelope" in sea urchins is an obvious phenotype of fertilization in this animal and over the past 35 years has served to indicate a presence of calcium released from cytoplasmic stores essential to activate the egg. The mechanism of calcium release has been intensely studied because it is a universal regulator of cellular activity, and recently several intersecting pathways of calcium release have been defined. Here we examine these various mechanisms with special emphasis on recent work in eggs of both sea urchins and mice.
... There are 3 isoforms of NOS in fish, namely, neuronal NOS (nNOS, or NOS1), inducible NOS (iNOS, or NOS2), and endothelial NOS (eNOS, or NOS3) (Cox et al., 2001). Neuronal nitric oxide synthase (nNOS) catalyzes the nitric oxide biosynthesis in the brain and neuron, which plays an important role in embryological development. ...
Fish have limited ability in endogenous biosynthesis of arginine. Arginine is an indispensable amino acid for fish, and the arginine requirement varies with fish species and fish size. Recent studies on fish have demonstrated that arginine influences nutrient metabolism, stimulates insulin release, is involved in nonspecific immune responses and antioxidant responses, and elevates disease resistance. Specifically, arginine can regulate energy homeostasis via modulating the AMP-activated protein kinase (AMPK) pathway, and also regulate protein synthesis via activating the target of rapamycin (TOR) signaling pathway. The present article reviews pertinent knowledge of arginine in fish, including dietary quantitative requirements, endogenous anabolism and catabolism, regulation of the endocrine and metabolic systems, and immune-regulatory functions under pathogenic challenge. Our findings showed that further data about the distribution of arginine after intake into specific cells, its sub-cellular sensor to initiate downstream signaling pathways, and its effects on fish mucosal immunity, especially the adaptive immune response against pathogenic infection in different species, are urgently needed.
... High developmental temperature increased gene expression of calcium ion binding (involved in multiple biological effects and cell signaling processes) [25][26][27] and serine-type endopeptidase activity (involved in the early development) 28 . The increased gene expression could promote the development of sea urchins. ...
Ocean warming increasingly endangers the fitness of marine invertebrates. Transgenerational effects (TE) potentially mitigate the impacts of environmental stress on the embryos of marine invertebrates. The molecular mechanisms, however, remain largely unknown. Using high-throughput RNA sequencing technology, we investigated the gene expression patterns of embryos (the gastrula stage) of the sea urchin Strongylocentrotus intermedius at different developmental temperatures, whose parents were exposed to long-term (15 months) elevated temperature (A) or not (B). The temperatures at which adults were held for ~4 weeks prior to the start of the experiment (21 °C for A and 18 °C for B) were also used for the development of offspring (high: 21 °C and ambient (laboratory): 18 °C) resulting in four experimental groups (HA and HB at 21 °C, and LA and LB at 18 °C). The embryos were sampled ~24 h after fertilization. All samples were in the gastrula stage. Twelve mRNA libraries (groups HA, HB, LA, LB, 3 replicates for each group) were established for the following sequencing. Embryos whose parents were exposed to elevated temperatures or not showed 1891 significantly different DEGs (differentially expressed genes) at the ambient developmental temperature (LB vs LA, LB as control) and 2203 significantly different DEGs at the high developmental temperature (HB vs HA, HB as control), respectively. This result indicates complex molecular mechanisms of transgenerational effects of ocean warming, in which a large number of genes are involved. With the TE, we found 904 shared DEGs in both LB vs LA (LB as control) and HB vs HA (HB as control) changed in the same direction of expression (i.e., up- or down-regulated), indicating that parental exposed temperatures affect the expression of these genes in the same manner regardless of the development temperature. With developmental exposure, we found 198 shared DEGs in both HB vs LB (HB as control) and HA vs LA (HA as control) changed in the same direction of expression. Of the 198 DEGs, more genes were up-regulated at high developmental temperature. Interestingly, embryos whose parents were exposed to high temperature showed fewer differently expressed DEGs between high and low developmental temperatures than the individuals whose parents were exposed to ambient temperature. The results indicate that gene expressions are probably depressed by the transgenerational effect of ocean warming. The roles of hsp70 and hnf6 in thermal acclimation are highlighted for future studies. The present study provides new insights into the molecular mechanisms of the transgenerational and developmental effects of ocean warming on the embryos of sea urchins.
... Gene that encodes and subsequent protein expression of nNOS and iNOS has been demonstrated in a number of fish species including Carassius auratus (Laing et al., 1996), Cyprinus carpio (Saeij et al., 2000), Oncorhynchus mykiss (Laing et al., 1999;Wang et al., 2001), Salmo salar (Øyan et al., 2000;Cox et al., 2001), Danio rerio Lepiller et al., 2009;Poon et al., 2003), Oreochromis niloticus (Bordieri et al., 2005), Fundulus heteroclitus (Hyndman et al., 2006), Sciaenops ocellatus (Zhou et al., 2009), Psetta maxima (Losada et al., 2012) and Clarias batrachus Lal, 2015, 2017). However, the gene that encodes eNOS or eNOS nucleotide or protein sequences has not been reported. ...
The present study is concerned with the expression and localization of nitric oxide synthase (NOS) isoforms, nNOS, eNOS and iNOS in the epidermis and the gill epithelium of Chaca chaca by means of immunohistochemical techniques. nNOS immunoreactivity was observed in the outer layer epithelial cells of the epidermis, outer epithelium of gill filaments at their distal regions and in between the secondary lamellae. iNOS positive cells were observed at intervals in the epidermis from basal layer to superficial layer, in outer layers of epithelium of the gill filament and in epithelium of the secondary lamellae. The expression of eNOS is similar to that of iNOS in the gills. In addition, NOS activity was also observed in the taste buds in the epidermis. The expression of different NOS isoforms in C. chaca are associated to increase the adaptability and survivability of the fish in hypoxic condition, help in defence and ion regulation and sensory functions. The study could be useful to understand the expression of NOS isoforms in different fish tissues and their diverse role in relation to the physiology of the fish.
... Genomic analysis of marine invertebrate NOSs indicate that the cofactor binding sites for flavin adenine dinucleotide, NADPH, heme, tetrahydrobiopterin, and calmodulin found in mammalian NOSs are all well conserved in these lower organisms (9). Moreover, some marine species, such as the sea urchin Arbacia punctulata, encode multiple NOS genes that display striking homology to both constitutive (NOS1, NOS3) and inducible (NOS2) NOSs in mammals (47), reaffirming the long ancestry of this system. The Anopheles mosquito NOS displays the highest homology with mammalian inducible NOSs, complete with a lipopolysaccharide (LPS) and inflammatory cytokine response elements in its promoter (48). ...
Evolution of Cell-Autonomous Effector Mechanisms in Macrophages versus Non-Immune Cells, Page 1 of 2
Abstract
Specialized adaptations for killing microbes are synonymous with phagocytic cells including macrophages, monocytes, inflammatory neutrophils, and eosinophils. Recent genome sequencing of extant species, however, reveals that analogous antimicrobial machineries exist in certain non-immune cells and also within species that ostensibly lack a well-defined immune system. Here we probe the evolutionary record for clues about the ancient and diverse phylogenetic origins of macrophage killing mechanisms and how some of their properties are shared with cells outside the traditional bounds of immunity in higher vertebrates such as mammals.
... By cloning and sequencing studies, the presence of nNOS and iNOS was demonstrated in a number of fish species, including cyprinid, cichlid and salmonid fish, and also in the scup (Stenotomus chrysops) (Barroso et al., 2000;Cox et al., 2001;Oyan et al., 2000;Saeij et al., 2000;Wang et al., 2001). At the protein level, about 60% sequence identity (or more) has been reported. ...
The nitric oxide (NO), a highly versatile and ubiquitous signaling molecule, is produced in the body by the oxidation' of L-arginine by catalytic action of one of the three isoforms of 'nitric oxide synthase (NOS) in the presence of molecular oxygen and NADPH. In the paradigm of adaptation, one universal regulator controlling the physiological systems and gene expression is NO molecule. NO governs an impressive number of physiological and pathophysiological functions. In mammals, it has been reported to be involved in many different physiological processes including cell proliferation, differentiation, vasodilation, neurotransmission, angiogenesis, apoptosis, and has anti-microbial and anti-tumoral activities and is also involved in secretion of hormones, motility of vascular and non-vascular smooth muscle and immune defence. In recent years~ there has been a growing body of evidences of NOS expression and physiological implication of NO in non-mammalian vertebrates. However, reports on NOS activity and the physiological roles of NO in ectothermic vertebrates such as in fish are relatively less compared to mammalian system. By cloning and sequencing studies, the presence of different isoform of NOS has been demonstrated in a number of fish species, both in adult and early developmental strategies. Various physiological functions of NO have also been demonstrated in certain fish species. Recently, the expression of different isoforms of NOS has also been demonstrated in two Indian air-breathing catfishes (Heteropneustes fossilis and Clarias batrachus) by our group and by few more groups. Further, more expression of NOS along with more production of NO under various environment constraints such as high environmental ammonia, desiccation stress and also under pathological conditions have been demonstrated in these two air-breathing catfish. This chapter reviews about the NO chemistry, its synthesis and also the implication of NO as a signalling molecule in various physiological and pathological conditions with a more emphasis on fish including the Indian air-breathing catfish.
... The pretreatment with endotoxin derived from Escherichia coli can exhibit a stimulatory effect in the host innate immune response to subsequent Staphylococcus aureus bacterial challenge, which may possibly increase LPS tolerance in mice and thereby limit the growth of the invading bacteria by the increased numbers of phagocytic cells (Murphey et al. 2008). In some previous studies, CaM is reported to be involved in ROS generation by interacting with NADPH oxidase and nitric oxide synthase, two indispensable enzymes related to ROS generation (Beck-Speier et al. 1993;Cox et al. 2001;Tirone and Cox 2007). ROS functioning as a signaling molecule can promote the apoptotic signaling cascades for scavenging infectious cells (Wang et al. 2011) and increasing the complement-dependent phagocytosis (Collins and Bancroft 1992), as well as mediating the activation of cytokines in leukocyte, which is widely considered as the evaluation of the immune defense in teleost (Biswas et al. 2013). ...
The effects of Dissostichus mawsoni-Calmodulin (Dm-CaM) on growth performance, enzyme activities, respiratory burst, MDA level and immune-related gene expressions of the orange-spotted grouper (Epinephelus coioides) exposed to the acute low temperature stress were evaluated. The commercial diet supplemented with Dm-CaM protein was fed to the groupers for 6 weeks. No significant difference was observed in the specific growth rates, weight gains and survivals. After the feeding trial, the groupers were exposed to acute low temperature challenge. The groupers fed with Dm-CaM additive diet showed a significant decrease in the respiratory burst activity, while the blood cell number increased significantly at 25 °C by comparing with the control and additive control group. The enzymatic activity of SOD, ACP and ALP increased significantly in Dm-CaM additive group, while MDA level maintained stable with the lowest value. qRT-PCR analysis indicated that the up-regulated transcript expressions of CaM, C3, SOD2, LysC and HSPA4 were observed in Dm-CaM additive group. These results indicated that Dm-CaM additive diet may regulate the grouper immune response to the acute low temperature challenge.
... Otkriven je donekle jednoznačan obrazac distribucije aktivnosti NOS u istraživanim dijelovima mozga različitih vrsta riba: u šarana (Cyprinus carpio L.), zlatnog karasa (Carassius auratus) i kalifornijske pastrve (Oncorhynchus mykiis) su telencephalon, hipotalamus i mesencephalon pokazali najviše NOS aktivnosti; u antarktičkih teleosta NOS se može dokazati u Purkynĕovim stanicama malog mozga, dok se u malom mozgu zlatnog karasa NOS nije mogao uočiti(141,142,143,144,145,146). Ekspresija nNOS i iNOS opažena je u nekih ribljih vrsta, dok su za eNOS dobiveni nepodudarni podatci(147).U svjetlu povezanosti NO i središnjega živčanog sustava ribe najviše je pozornosti posvećeno istraživanju utjecaja hiperkapnije/anoksije na moždanu cirkulaciju. U sisavaca hiperkapnija uzrokuje cerebralnu vazodilataciju i povećanje protoka krvi kroz mehanizme koji uključuju povećanje stvaranja NO (148). ...
... To date, detailed analysis of NOS systems during early embryonic development have mainly been limited to the presence of the nNOS protein in the brain of rat and mouse. In teleosts, NOS proteins and their activity have been characterized, and the molecular identity demonstrated for nNOS and iNOS (Cox et al., 2001;Holmqvist et al., 2000a;Øyan et al., 2000;Saeij et al., 2000). In zebrafish and salmon, preliminary studies have shown an early expression of nNOS mRNA in the CNS (Holmqvist et al., , 2000b. ...
To examine a putative role for neuronal nitric oxide synthase (nNOS) in early vertebrate development we investigated nNOS mRNA expression and cGMP production during development of the zebrafish Danio rerio. The nNOS mRNA expression in the central nervous system (CNS) and periphery showed a distinct spatio–temporal pattern in developing zebrafish embryo and young larvae. nNOS mRNA expression was first detected at 19 h postfertilisation (h.p.f.), in a bilateral subpopulation of the embryonic ventrorostral cell cluster in the forebrain. The number of nNOS mRNA-expressing cells in the brain slowly increased, also appearing in the ventrocaudal cell cluster from about 26 h.p.f., and in the dorsorostral and hindbrain cell cluster and in the medulla at 30 h.p.f. A major increase in nNOS mRNA expression started at about 40 h.p.f., and by 55 h.p.f. the expression constituted cell populations in differentiated central nuclei and in association with the proliferation zones of the brain, and in the medulla and retina. In parts of the skin, nNOS mRNA expression started at 20 h.p.f. and ended at 55 h.p.f. Between 40 and 55 h.p.f., nNOS mRNA expression started in peripheral organs, forming distinct populations after hatching within or in the vicinity of the presumptive swim bladder, enteric ganglia, and along the alimentary tract and nephritic ducts. Expression of nNOS mRNA correlated with the neuronal differentiation pattern and with the timing and degree of cGMP production.
These studies indicate spatio–temporal actions by NO during embryogenesis in the formation of the central and peripheral nervous system, with possible involvement in processes such as neurogenesis, organogenesis and early physiology.
... As in higher vertebrates, NO plays a central role in the immune responses of fish. Full-length iNOS genes were sequenced from several fish species (Cox et al. 2001;Wang et al. 2001). Even though there are differences compared to the human NOS gene, the exons show remarkable conservation in sequence and organization. ...
... [28], Clostridium perfingens [30] and for survival of Pneumocystisinfected alveolar macrophages [31]. The presence of well conserved CaM is well documented in fish [32,33]. As we observed increased intracellular Ca 2+ -levels in infected HKM [19] and CaM being a well-known Ca 2+ -sensor, we hypothesised a role of CaM on the pathogenicity of A. hydrophila. ...
The role of calcium (Ca2+) and its dependent protease calpain in Aeromonas hydrophila-induced head kidney macrophage (HKM) apoptosis has been reported. Here, we report the pro-apoptotic involvement of calmodulin (CaM) and calmodulin kinase II gamma (CaMKIIg) in the process. We observed significant increase in CaM levels in A. hydrophila-infected HKM and the inhibitory role of BAPTA/AM, EGTA, nifedipine and verapamil suggested CaM elevation to be Ca2+-dependent. Our studies with CaM-specific siRNA and the CaM inhibitor calmidazolium chloride demonstrated CaM to be pro-apoptotic that initiated the downstream expression of CaMKIIg. Using the CaMKIIg-targeted siRNA, specific inhibitor KN-93 and its inactive structural analogue KN-92 we report CaM-CaMKIIg signalling to be critical for apoptosis of A. hydrophila-infected HKM. Inhibitor studies further suggested the role of calpain-2 in CaMKIIg expression. CaMK Kinase (CaMKK), the other CaM dependent kinase exhibited no role in A. hydrophila-induced HKM apoptosis. We report increased production of intracellular cAMP in infected HKM and our results with KN-93 or KN-92 implicate the role of CaMKIIg in cAMP production. Using siRNA to PKACA, the catalytic subunit of PKA, anti-PKACA antibody and H-89, the specific inhibitor for PKA we prove the pro-apoptotic involvement of cAMP/PKA pathway in the pathogenicity of A. hydrophila. Our inhibitor studies coupled with siRNA approach further implicated the role of cAMP/PKA in activation of extracellular signal-regulated kinase 1 and 2 (ERK 1/2). We conclude that the alteration in intracellular Ca2+ levels initiated by A. hydrophila activates CaM and calpain-2; both pathways converge on CaMKIIg which in turn induces cAMP/PKA mediated ERK 1/2 phosphorylation leading to caspase-3 mediated apoptosis of infected HKM.
... Neuronal NOS, eNOS and iNOS have been detected in many species of fish and in nearly all cell types, including oxidative muscle. The majority of fishes express nNOS and/or iNOS, which have been detected by immunocytochemistry as well as by gene cloning and sequencing (Laing et al. 1996(Laing et al. , 1999Holmqvist et al. 2000;Oyan et al. 2000;Saeij et al. 2000;Cox et al. 2001;Bordieri et al. 2005;Masini et al. 2005;Hyndman et al. 2006;Lepiller et al. 2009;Zhou et al. 2009). Although there is no genomic evidence for the presence of the eNOS isoform in fishes, eNOS has been detected using immunocytochemistry and mammalian-derived antibodies in zebrafish and Antarctic notothenioids (Fritsche et al. 2000;Garofalo et al. 2009a). ...
Antarctic icefishes of the family Channichthyidae are the only vertebrate animals that as adults do not express the circulating oxygen-binding protein hemoglobin (Hb). Six of the 16 family members also lack the intracellular oxygen-binding protein myoglobin (Mb) in the ventricle of their hearts and all lack Mb in oxidative skeletal muscle. The loss of Hb has led to substantial remodeling in the cardiovascular system of icefishes to facilitate adequate oxygenation of tissues. One of the more curious adaptations to the loss of Hb and Mb is an increase in mitochondrial density in cardiac myocytes and oxidative skeletal muscle fibers. The proliferation of mitochondria in the aerobic musculature of icefishes does not arise through a canonical pathway of mitochondrial biogenesis. Rather, the biosynthesis of mitochondrial phospholipids is up-regulated independently of the synthesis of proteins and mitochondrial DNA, and newly-synthesized phospholipids are targeted primarily to the outer-mitochondrial membrane. Consequently, icefish mitochondria have a higher lipid-to-protein ratio compared to those from red-blooded species. Elevated levels of nitric oxide in the blood plasma of icefishes, compared to red-blooded notothenioids, may mediate alterations in mitochondrial density and architecture. Modifications in mitochondrial structure minimally impact state III respiration rates but may significantly enhance intracellular diffusion of oxygen. The rate of oxygen diffusion is greater within the hydrocarbon core of membrane lipids compared to the aqueous cytosol and impeded only by proteins within the lipid bilayer. Thus, the proliferation of icefish's mitochondrial membranes provides an optimal conduit for the intracellular diffusion of oxygen and compensates for the loss of Hb and Mb. Currently little is known about how mitochondrial phospholipid synthesis is regulated and integrated into mitochondrial biogenesis. The unique architecture of the oxidative muscle cells of icefishes highlights the need for further studies in this area.
... NO is produced by three isoforms of the enzyme nitric oxide synthase (NOS): inducible NOS (iNOS), neuronal NOS (nNOS) and endothelial NOS (eNOS) (Moncada et al., 1991). There is immunohistochemical evidence for the presence of all three isoforms in fishes, and genomic evidence for iNOS and nNOS, but not eNOS (Amelio et al., 2006;Bordieri et al., 2005;Cox et al., 2001;Fritsche et al., 2000;Holmqvist et al., 2000;Laing et al., 1999;Masini et al., 2005;Saeij et al., 2000). It is unknown if NO increases in response to cold acclimation in fishes, but we do know that circulating levels of NO are higher in icefishes than in red-blooded fishes because of their lack of Hb (Beers et al., 2010). ...
Mitochondrial biogenesis is induced in response to cold temperature in many organisms. The effect is particularly pronounced in ectotherms such as fishes, where acclimation to cold temperature increases mitochondrial density. Some polar fishes also have exceptionally high densities of mitochondria. The net effect of increasing mitochondrial density is threefold. First, it increases the concentration of aerobic metabolic enzymes per gram of tissue, maintaining ATP production. Second, it elevates the density of mitochondrial membrane phospholipids, enhancing rates of intracellular oxygen diffusion. Third, it reduces the diffusion distance for oxygen and metabolites between capillaries and mitochondria. Although cold-induced mitochondrial biogenesis has been well documented in fishes, little is known about the molecular pathway governing it. In mammals, the co-transcriptional activator peroxisome proliferator-activated receptor gamma coactivator 1 alpha (PGC-1α) is thought to coordinate the three components of mitochondrial biogenesis: the synthesis of mitochondrial proteins, the synthesis of phospholipids and the replication of mitochondrial DNA. Some components of the mitochondrial biogenic pathway are conserved between fishes and mammals, yet the pathway appears more versatile in fishes. In some tissues of cold-acclimated fishes, the synthesis of mitochondrial proteins increases in the absence of an increase in phospholipids, whereas in some polar fishes, densities of mitochondrial phospholipids increase in the absence of an increase in proteins. The ability of cold-bodied fishes to fine-tune the mitochondrial biogenic pathway may allow them to modify mitochondrial characteristics to meet the specific needs of the cell, whether it is to increase ATP production or enhance oxygen diffusion.
... The nitric oxide synthase gene of the mosquito Anopheles shows the highest homology to the vertebrate neuronal NOS (Luckhart & Rosenberg, 1999). Phylogenetic analysis shows that in the sea urchin Arbacia, each of two cloned sequences of NOSs cluster with the mammalian constitutive and inducible isoforms, respectively (Cox et al., 2001). They may represent early homologues of these two isoenzymes. ...
The last two decades of study enriched greatly our knowledge of how the immune system originated and the sophisticated immune mechanisms of today's vertebrates and invertebrates developed. Even unicellular organisms possess mechanisms for pathogen destruction and self recognition. The ability to distinguish self from non-self is a prerequisite for recognition of sexual compatibility and ensuring survival. Molecules involved in these processes resemble those found in the phagocytic cells of higher organisms. Recognition of bacteria by scavenger receptors induces phagocytosis or endocytosis. The phagocytic mechanisms characterizing the amoeboid protozoans developed further during the evolution towards innate immunity. The scavenger receptor cysteine-rich domain SRCR is encoded in the genomes from the most primitive sponges to mammals. The immune system of sponges comprises signal transduction molecules which occur in higher metazoans as well. Sponges already possess recognition systems for pathogenic bacteria and fungi, based on membrane receptors (a lipopolysaccharide-interacting protein, a cell surface receptor recognizing β(1 → 3)-d-glucans of fungi). Perforin-like molecules and lysozymes are involved, among others, in defense in sponges. Reactive oxygen and nitrogen species function in the immunity of early metazoan. Genes encoding the family of reactive oxygen-generating NADPH oxidases (Noxes) are found in a variety of protists and plants. The NO synthases of cnidarians, mollusks, and chordates are conserved with respect to the mammalian NOS. The antimicrobial peptides of protozoans, amoebapores, are structural and functional analogs of the natural killer cell peptide, NK-lysin, of vertebrates. An ancestral S-type lectin has been found in sponges. Opsonizing properties of lectins and the ability to agglutinate cells justify their classification as primitive recognition molecules. Invertebrate cytokines are not homologous to those of vertebrate, and their functional convergence was presumably enabled by the general similarity of the lectin-like recognition domain three-dimensional structure. Sponges contain molecules with SCR/CCP domains that show high homology to the mammalian regulators of complement activation (RCA family). A multi-component complement system comprising at least the central molecule of the complement system, C3, Factor B, and MASP developed in the cnidarians and evolved into the multilevel cascade engaged in innate and acquired immunity of vertebrates. The adaptive immune system of mammals is also deeply rooted in the metazoan evolution. Some its precursors have been traced as deep as in sponges, namely, two classes of receptors that comprise Ig-like domains, the receptor tyrosine kinases (RTK), and the non-enzymic sponge adhesion molecules (SAM). The antibody-based immune system defined by the presence of the major histocompatibility complex (MHC), T-cell receptor (TCR), B-cell receptor (BCR) or recombination activating genes (RAGs) is known beginning from jawed fishes. However, genes closely resembling RAG1 and RAG2 have been uncovered in the genome of a see urchin. The ancestry of MHC gene remains unknown. Similarly, no homologue of the protein binding domain (PBD) in MHC molecules has been found in invertebrates. The pathway by which endogenous peptides are degraded for presentation with class I MHC molecules utilizes mechanisms similar to those involved in the normal turnover of intracellular proteins, apparently recruited to work also for the immune system. Several cDNAs coding for lysosomal enzymes, e.g., cathepsin, have been isolated from sponges. All chromosomal duplication events in the MHC region occurred after the origin of the agnathans but before the gnathostomes split from them. The V-domains of the subtype found in the receptors of T and B-cells are known from both agnathans and cephalochordates, although they do not rearrange. The rearrangement mechanism of the lymphocyte V-domains suggests its origin from a common ancestral domain existing before the divergence of the extant gnathostome classes. Activation-induced deaminase (AID) - homologous proteins have been found only in the gnathostomes. It appears thus that the adaptive immunity of vertebrates is a result of stepwise accumulation of small changes in molecules, cells and organs over almost half a billion years.
... Antibodies used against nNOS and iNOS isoforms were of mammalian origin, because no antibody against piscine nNOS or iNOS is available to the best of author's knowledge, and till date piscine workers are frequently using poly-or monoclonal antibody against different isoforms of mammalian NOS (Giraldez-Perez et al., 2008;Tripathi and Krishna, 2008;Singru et al., 2007;Zaccone et al., 2006;Gaikwad et al., 2009). Moreover, Cox et al. (2001) and Pelster (2007) have shown very high degree of conservation in sequences and structure of characteristic motifs in NOS isoforms across the vertebrates. The nNOS antibody used in the present study was raised against twenty amino acid sequences of nNOS of rat origin and does not recognize iNOS or eNOS (Singru et al., 2003). ...
Nitric oxide (NO) is a well-recognized versatile signaling molecule. It is produced by catalytic action of nitric oxide synthase (NOS) on L-arginine in a variety of animal tissues. Existence of different isoforms of NOS has been shown in mammalian testis, but report on their presence in the testis of ectothermic vertebrates is non-existent. This study demonstrates the differential expressions of two isoforms of nitric oxide synthase (neuronal-nNOS and inducible-iNOS) like molecules in different cell types in the testis of seasonally breeding catfish, Clarias batrachus through immunohistochemistry. Positive immunoprecipitation of nNOS and iNOS like molecules were detected in germ cells as well as interstitial cells only in the recrudescing and fully mature fish. The immunoreactions differed in intensity and varied with changing reproductive status. Treatment of adult male fish with NO donor, sodium nitroprusside, and a NOS inhibitor, N-nitro-L-arginine methyl ester (L-NAME) increased and decreased the total nitrate and nitrite concentration in the testis, respectively. Sodium nitroprusside and L-NAME also induced simultaneous decline and rise in the testicular testosterone level, respectively. These findings, thus, suggest that NOS isoforms are expressed variedly in different cell types in the testis of reproductively active fish. This investigation also suggests that NO inhibits testosterone production in the testis.
... This ancestral gene could be sufficient to regulate many of the vital nitric oxide function in urochordate and in fishes whose one duplicated gene was secondarily lost. Two partial sequences of nos cDNA were cloned in the echinoderm sea urchin (Arbacia punctulata) and could represent early homologs of the NOS1 and NOS2 isoforms (Cox et al., 2001), indicating that NOS isoform diversity may exist early in deuterostomes. Thus, the number of nos loci can vary between species, especially in the heterogeneous phylogenetic group of fishes, since NOS isoforms could exert redundant functions as observed by studying nos knock-out consequences in mice (Mashimo and Goyal, 1999;Tsutsui et al., 2006). ...
Nitric oxide synthase (NOS) produces nitric oxide (NO) from arginine. Three NOS isoforms have been identified in mammals, namely a neuronal (NOS1), an inducible (NOS2) and an endothelial (NOS3) enzyme. In zebrafish genome, one nos1 gene and two nos2 genes (nos2a and nos2b) were observed. We cloned zebrafish nos2a cDNA and compared nos2a and nos2b sequences, expression and inducibility. When analyzed by reverse transcription-PCR, the expression of nos2a remained very low during initial development, then increased at 96 hpf, while nos2b was expressed from 6 hpf and subsequently remained stable. Expression of nos2a is detected in the head, eye and gut regions by WISH experiments performed at 48, 72 and 96 hpf larvae. In adults, nos2a expression varies from one tissue to another whereas nos2b is expressed in all studied tissues. Both nos2 isoforms can be induced by pro-inflammatory or mechanical stresses (tissue injury). In vitro as in vivo stimulations with Poly I:C and lipopolysaccharides (LPS) enhanced more dramatically nos2a than nos2b expression. After tail transection in 4 dpf larvae a strong increase of nos2a and nos2b expression was evidenced in the regeneration site, skin cells and for the nos2b gene in neuromasts. Phylogenetic and syntenic analyses show that nos2b gene was associated with syntenic genes identified for nos2 genes in vertebrate. This is not the case for the nos2a gene, despite zebrafish nos2a presenting the inducible property of a classical vertebrate nos2 isoform. A myristoylation consensus site was detected at the N-terminal extremity of zebrafish Nos2b, a property shared with mammal NOS3 isoforms. Thus, the evolution of nos2 genes in zebrafish provides a typical example of gene divergence after duplication.
... Both DmagNOS1 and Dmag-NOS2 possess conserved domains and active sites typical of NOS proteins. In particular the four hydrophobic residues corresponding to the Ca 2+-dependent calmodulinbinding motif were found in both sequences ( Fig. 1A and B; [43]). The sequences of DmagNOS1 and Dmag-NOS2 have been deposited in NCBI GenBank under the accession number FJ593039 and FJ593040, respectively. ...
NO (nitric oxide) is a highly reactive free radical gas thought to play a major role in the invertebrate immune response by harming pathogens and limiting their growth. Here we report on studies of nitric oxide synthase (NOS) genes in the crustacean Daphnia, one of the few non-insect arthropod models used to study host-pathogen interactions. While the NOS gene is found as a single copy in other invertebrates, we found two copies (NOS1 and NOS2), which a phylogenetic reconstruction showed to be the result of an ancient duplication event. Both genes bear features commonly found in invertebrate NOS, however, the two genes differ in their rate of evolution, intraspecific polymorphism and expression level. We tested whether the more rapid evolution of NOS2 could be due to positive selection, but found the rate of amino-acid substitutions between Daphnia species to be compatible with a neutral model. To associate NOS or NO activity with infection, we performed infection experiments with Daphnia magna and one of its natural pathogens (the bacterium Pasteuria ramosa). In one set of experimental infections, we supplemented D. magna with L-arginine, the NOS substrate, or with L-NAME, a NOS antagonist, and found this to result in lower and higher infection levels, respectively, which is at least compatible with the notion that NO may aid defence against Pasteuria. A second experiment indicated that NOS transcription does not increase following exposure to Pasteuria. Thus, the function of NOS in Daphnia immunity remains uncertain, but the pattern of gene duplication and subsequent divergence suggests evolution via neo- or subfunctionalization.
... This partial cDNA showed a very high degree of conservation in nucleotide and derived amino acid sequences with the Nile tilapia nos1, which we recently cloned (Bordieri et al., 2005). In teleosts, partial or complete nos1 sequences have also been reported in Salmo salar (Øyan et al., 2000), Danio rerio , Stenotomus chrysops (Cox et al., 2001), Fundulus heteroclitus (Hyndman et al., 2006), Oncorhyncus mykiss (McNeill and Perry, 2006), and Platichthys flesus (Marley et al., 2007). A phylogenetic analysis showed that the nos sequence of O. mossambicus clustered with other known vertebrate nNOS rather than with teleostean iNOS or mammalian eNOS, thus indicating that it belongs to a neuronal NOS isoform. ...
We examined the effects of hyperosmotic stress on the gene expression and activity of neuronal nitric oxide synthase (nNOS) in the preoptic/hypothalamic neurosecretory system of the euryhaline tilapia Oreochromis mossambicus (Mozambique tilapia) by means of semiquantitative RT-PCR and NADPHd histochemistry. Expression of nos1 was rapidly and transiently up-regulated in the preoptic region and hypothalamus in response to a salinity change (70% seawater, SW). Expression levels increased 4 h after the salinity change and then returned to basal levels within 8 h of the hyperosmotic challenge. NADPHd histochemistry revealed that positive magnocellular and gigantocellular preoptic neurons increased in number 4 h after the salinity change, while the number of parvocellular preoptic neurons reactive for NADPHd showed no significant change. These results indicate that the nNOS gene expression and NOS activity are stimulated in the preoptic/ hypothalamic neurosecretory system in response to hyperosmotic stress and suggest that NO influences neuronal responses to short-term osmotic stimulation in euryhaline fish.
... Nitric oxide synthase (NOS) has been identified in basal eukaryotes such as slime molds, in fungi, and in plants (Werner-Felmayer et al., 1994;Ninnemann and Maier, 1996;Tao et al., 1997;Golderer et al., 2001;Chandok et al., 2003), suggesting that gaseous NO may have played a crucial signaling role from the early stages of the evolution of life (Moncada and Martin, 1993;Feelisch and Martin, 1995;Franchini et al., 1995;Moroz, 2000bMoroz, , 2001. It is well established that, in the mammalian nervous system, NO has important functions as a neurotransmitter and neuromodulator , and there is a growing body of evidence indicating a signaling function for NO in central nervous and peripheral tissues of the major bilaterian invertebrate groups such as molluscs (Ottaviani et al., 1993;Jacklet, 1995;Moroz and Gillette, 1996a;Korneev et al., 1998;Moroz et al., 1999;Moroz, 2000a), annelids derms (Bishop and Brandhorst, 2001;Cox et al., 2001;Leckie et al., 2003). However, evidence is lacking for a similar role of NO in nervous tissues of the Cnidaria, the phylum with the simplest and possibly the earliest nervous systems. ...
The cnidarian nervous system is considered by many to represent neuronal organization in its earliest and simplest form. Here we demonstrate, for the first time in the Cnidaria, the neuronal localization of nitric oxide synthase (NOS) in the hydromedusa Aglantha digitale (Trachylina). Expression of specific, fixative-resistant NADPH-diaphorase (NADPH-d) activity, characteristic of NOS, was observed in neurites running in the outer nerve ring at the base of the animal and in putative sensory cells in the ectoderm covering its tentacles. At both sites, diphenyleneiodonium (10(-4) M) abolished staining. Capillary electrophoresis confirmed that the NO breakdown products NO2- and NO3- were present at high levels in the tentacles, but were not detectable in NADPH-d-negative areas. The NADPH-d-reactive neurons in the tentacles send processes to regions adjacent to the inner nerve ring where swimming pacemaker cells are located. Free-moving animals and semi-intact preparations were used to test whether NO is involved in regulating the swimming program. NO (30-50 nM) and its precursor L-arginine (1 mM) stimulated swimming, and the effect was mimicked by 8-Br-cGMP (50-100 microM). The NO scavenger PTIO (10-100 microM) and a competitive inhibitor of NOS, L-nitroarginine methyl ester (L-NAME, 200 microM), significantly decreased the swimming frequency in free-moving animals, while its less-active stereoisomer D-nitroarginine methyl ester (D-NAME, 200 microM) had no such effect. 1H-[1,2,4]oxadiazolo[4,3-a]quinoxaline-1-one (ODQ, 5-20 microM), a selective inhibitor of soluble guanylyl cyclase, suppressed spontaneous swimming and prevented NO-induced activation of the swimming program. We suggest that an NO/cGMP signaling pathway modulates the rhythmic swimming associated with feeding in Aglantha, possibly by means of putative nitrergic sensory neurons in its tentacles.
... During the past decade the number of cloned NOS genes from invertebrates has steadily increased. This includes NOS genes from the cnidaria Discosoma striata (Accession No.: AY036119), the arthropoda Drosophila melanogaster [6], Rhodnius prolixus [34], Manduca sexta [35], Bombyx mori [36], the tropical land crab Gecarcinus lateralis [37], the mosquito Anopheles stephensi [38,39], the sea urchin Arbacia punctulata [40], and the chordate Ciona intestinalis (http:// genome.jgi-psf.org). In mollusks, NOS gene was cloned from Helix pomatia [41], Aplysia californica (Accession No.: AAK83069), and the pond snail L. stagnalis where, in addition to the full-length NOS mRNA, two pseudo-NOS transcripts have been identified [31,42,43]. ...
Nitric oxide (NO) signaling is involved in numerous physiological processes in mollusks, e.g., learning and memory, feeding behavior, neural development, and defence response. We report the first molecular cloning of NOS mRNA from a cephalopod, the cuttlefish Sepia officinalis (SoNOS). SoNOS was cloned using a strategy that involves hybridization of degenerate PCR primers to highly conserved NOS regions, combined with RACE procedure. Two splicing variants of SoNOS, differing by 18 nucleotides, were found in the nervous system and the ink gland of Sepia. In situ hybridization shows that SoNOS is expressed in the immature and mature cells of the ink gland and in the regions of the nervous system that are related to the ink defence system.
... The usage of oxygen as a substrate for specialized immune functions through NADPH oxidase (NOX-2) and nitric oxide synthase (NOS-2 or i nducible NOS) occurred relatively late in evolution. The pattern of molecular and phylogenetic changes in both enzymes suggests that they were the products of gene duplication, perhaps developing in chordates with the separation of mammals and fishes4243444546. Features of TAM biology under low oxygen tensions may be rooted in our innate immune responses to facultative anaerobes. ...
Monocytes are recruited from the circulation into solid tumors where they differentiate into macrophages with unique phenotypes. While macrophages utilize oxygen in a broad range of immune effector functions, the generation of reactive oxygen and nitrogen oxide species is less clear in the setting of hypoxia, which can be a prominent feature of solid tumors. The relationships among innate immunity, redox systems, and the plasticity of phenotypic changes tumor-associated macrophages undergo in conjunction with tumor hypoxia will be examined.
... However, little is known about the diversity of NOS isoforms in nonmammalian taxa. A recent report has provided evidence for the existence of multiple NOS genes in fish and echinoderms, showing the appearance of multiple forms early in chordate evolution (Cox et al. 2001). Whereas there are reports of NO production by certain insect species (Weiske and Wiesner 1999), mollusks (Huang et al. 1997;Moroz et al. 1996;Sanchez-Alvarez et al. 1994), and nematodes such as Ascaris suum, Dirofilaria immitis, and Brugia species (Bascal et al. 1996;Kaiser et al. 1998;Mupanomunda et al. 1997;Pfarr and Fuhrman 2000), the information about the production of this molecule by protozoa is limited. ...
Free-living ameba Naegleria fowleri produces an acute and fatal infectious disease called primary amebic meningoencephalitis (PAM), whose pathophysiological mechanism is largely unknown. The aim of this study was to investigate the role of nitric oxide (NO) in PAM. Although NO has a cytotoxic effect on various parasites, it is produced by others as part of the pathology, as is the case with Entamoeba histolytica. To test for the production of NO, we analyzed whether antibodies against mammalian NO synthase isoforms (neuronal, inducible, and endothelial) presented immunoreactivity to N. fowleri proteins. We found that the trophozoites produced NO in vitro. The Western blot results, which showed N. fowleri trophozoites, contained proteins that share epitopes with the three described mammalian NOS, but have relative molecular weights different than those described in the literature, suggesting that N. fowleri may contain undescribed NOS isoforms. Moreover, we found that trophozoites reacted to the NOS2 antibody, in amebic cultures as well as in the mouse brain infected with N. fowleri, suggesting that nitric oxide may participate in the pathogenesis of PAM. Further research aimed at determining whether N. fowleri contains active novel NOS isoforms could lead to the design of new therapies against this parasite.
We describe a method for the simultaneous culturing of biliary epithelial cells (BECs) from the gallbladder (GB), extrahepatic bile duct (EBD), and intrahepatic bile duct (IBD) of hamsters. The GB, EBD and IBD were excised from the biliary tree after collagenase perfusion of the liver. These biliary segments were minced into fragments, which were embedded in collagen gel and cultured in Dulbeccos Modified Eagle Medium/HamF12 Medium containing 10% fetal bovine serum. The various cells subsequently spread from the fragments and formed cellular sheets. After the fragments and flattened cells were removed under phase-contrast microscopy, the sheets remaining were found to be composed of cuboidal cells. These cuboidal cells expressed gamma glutamyl transpeptidase and cytokeratin 7, which are known to be specific markers of BECs. Ultrastructurally, there were many microvilli on the luminal surface and junctional complex and interdigitation was identifiable on the lateral surfaces. BEC cultures were subcultured by digestion with collagenase and dispase and then dissociated by subsequent digestion in trypsin and ethylenediaminetetraacetic acid. They were maintained in collagen gel for up to 8 weeks. After several passages, the BECs in the culture eventually grew and showed vacuoles in the cytoplasm. They demonstrated irreversible growth arrest at 9 weeks. The BECs tended to form cystic structures when they were transplanted with collagen gel into the interscapular fat pads of the syngeneic hamsters.
Vibrio alginolyticus containing the highly toxic extracellular product is one of the most serious threats to grouper survival and its minimum lethal dose is approximately 500 CFU/g fish body weight in grouper. To study the toxic effects of V. alginolyticus on the immune system in teleost, Calmodulin (CaM), an important molecular indicator gene, was cloned from the orange-spotted grouper (Epinephelus coioides). The full-length Ec-CaM consisted of a 5'-UTR of 103 bp, an ORF of 450 bp and a 3'-UTR of 104 bp. The Ec-CaM gene encoded a protein of 149 amino acids with an estimated molecular mass of 16.4 kDa and a predicted isoelectric point of 3.93. The deduced amino acid sequence showed that Ec-CaM contained four highly conserved EF-hand domains known to be critical for the function of CaM. Ec-CaM was widely expressed and the highest expression level was observed in liver. Following V. alginolyticus challenge, a sharp increase level of respiratory burst activity and apoptosis ratio were observed. Further analyses of CaM expression and p53 expression in liver, kidney and spleen by qRT-PCR demonstrated that the up-regulated expression of CaM and p53 were observed in the vibrio challenge group. Western blotting analysis confirmed that the Ec-CaM protein was strongly induced in liver at 12 h post-injection, while a sharp increase of p53 protein expression was observed at 24 h post-injection. These results showed CaM expression serving as a potential molecular indicator may help to assess the toxicological effects of V. alginolyticus on the ROS generation and apoptotic process in grouper.
Using the head kidney macrophages (HKM) from catfish (Clarias batrachus) we earlier demonstrated the role of calcium (Ca2+) and its dependent neutral protease calpain in arsenic-induced apoptosis. Here, we report the role of the CaM-CaMKII axis as an initiator of the process. With the help of specific assay kits and inhibitors we document the pro-apoptotic role of CaM and CaMKII in arsenic-induced HKM apoptosis. CaM-induced CaMKII activity influenced superoxide ion production in exposed cells with a consequent increase in intracellular cAMP levels. Using H-89, the specific inhibitor for PKA, we show for the first time the pro-apoptotic role of the cAMP/PKA pathway in arsenic-induced HKM apoptosis. We report the cAMP/PKA pathway to be critical for initiating downstream activation of MAPKs, namely ERK 1/2. The superoxide ions generated due to arsenic-stress also induce NF-κB activation in HKM. Inducible NOS activity and consequent NO production were evident in the exposed HKM and our study implicates the involvement of ERK 1/2 and NF-κB in the process. Arsenic exposure alters mitochondrial membrane potential, releases cytochrome C and activates caspase-9 leading to caspase-3 mediated apoptosis of HKM. Our findings, thus, provide insight into the underlying mechanism of arsenic toxicity and indicate that HKM could serve as an important in vitro model for immunotoxicity assays.
Autonomic innervation, at least of the cardiovascular system, appears late during the development of vertebrate embryos. In the early stages of innervation, control may be achieved by the activity of hormones, including for example the messenger molecule nitric oxide (NO). While NO in adult vertebrates is known to play a key function in many physiological processes, such as control of vascular tone, neurotransmission, macrophage activity and angiogenesis, very little is known about the onset of NO responsiveness during development. In fish, the presence of neuronal NO synthase (nNOS) and inducible NOS (iNOS) have been established by cloning and sequencing. The presence of endothelial NOS (eNOS) is indicated by immunological data, but attempts to identify eNOS at the molecular level have failed so far. nNOS expression, in particular, has been shown to occur at very early developmental stages. Analysis of the effect of NO on the cardiovascular system in zebrafish embryos and larvae revealed almost no effects on cardiac activity during chronic exposure to NO-producing chemicals, whereas vascular reactivity was observed in veins and arteries of the zebrafish in early developmental stages (5–6 days post-fertilization). Chronic exposure to a NO donor also modified the development of the vascular system by inducing an earlier appearance of some blood vessels in the trunk region of the zebrafish larvae. The nervous system and the gut also appear to be organs in which the early expression of NOS is of functional importance.
Nitric oxide (NO) is one of the smallest and most diffusible signal molecules known. It can be synthesized in virtually any cell of our body and found in nearly every major group of organisms on our planet. Here, we will discuss several enzymatic and nonenzymatic pathways of NO synthesis in both prokaryotes and eukaryotes including protists, plants and animals. Many of these synthetic mechanisms can coexist within the same cell or cell population. We will also briefly review comparative aspects of NO signaling with a focus on the diversity of NO synthases in invertebrate animals and nonanimal groups. NO-related regulatory mechanisms may be as old as cellular organization itself, so that “ancestral” functions of NO in prokaryotes and basal eukaryotes are likely well preserved across billions of years of biological evolution and can be essential for biomedical studies and clinical applications. On the other hand, NO synthetic pathways might represent examples of parallel evolution in different lineages of organisms.
The signaling networks controlling calcium release and cortical granule exocytosis at fertilization are complex and multilayered, providing various points for regulatory input and quality control. Though it is clear that many of the mechanisms leading to both calcium release and cortical granule exocytosis are conserved, a great deal of variability exists between homologous signaling pathways in different species. The signaling pathways responsible for the release of calcium seen at fertilization vary from species to species, yet they center around the importance of IP3-mediated signaling. Similarly, while there are differences in the mechanisms of regulated secretion between species and between intracellular membrane trafficking events, particularly with respect to time and space, all seem to be dependent on the SNARE proteins and their regulator and effector proteins. What has been most helpful in these studies is the convergence of studies from many different species of eggs. With the amazing divergence of reproductive processes and mechanisms that exists throughout phylogeny, it is comforting to see such strong overlapping roles of key players in widely disparate eggs.
Nitric oxide (NO) is one of the oldest signaling molecules in animals, which acts as an intercellular and intracellular messenger in a multitude of cell types. Its role in the vascular biology of terrestrial vertebrates, particularly in mammals, is well established and extensively documented. This review article deals with the occurrence and effects of NO in the fish vascular system. In fish, the information regarding the roles of NO in the control of vascular resistance is surprisingly scanty; on the other hand, there is increasing evidence for a role for the NO synthase (NOS)/NO system in this highly diverse group of animals. Many authors have reported the occurrence and localization of both constitutive and inducible NOS (iNOS) isoforms in fish tissues, including gills and heart. Endothelial NOS (eNOS) has been detected in the vascular and endocardial endothelium of eel and some Antarctic fish, as well as in the endothelial cells of developing zebrafish. Evidence has been also reported for NOS-independent NO production, and particularly on the conversion of nitrite to NO by erythrocytes under conditions of hypoxia. The functional roles (vascular effects) of NO in developing and adult fish have been investigated. Studies on various fish species show results specific to the species or to the particular vascular preparation used. Fish appear to be an ideal model for studying the conservation and diversity of the functional roles of NO in the control of vascular resistance.
There are three isoforms of the enzyme nitric oxide synthase (NOS) in mammals: endothelial NOS (eNOS), inducible NOS (iNOS) and neuronal NOS (nNOS). All three isoforms oxidize arginine to citrulline in a reaction producing nitric oxide (NO), which regulates multiple signaling pathways and physiological functions in mammals. Less is known about NOS in fishes, in which the existence of eNOS is controversial. Nevertheless, multiple adjustments occur during cold acclimation of fishes, several of which are known to be mediated by eNOS and NO in mammals, including mitochondrial biogenesis, vasodilation and angiogenesis. We hypothesized that if NOS was present, and NO stimulated these pathways in fishes, then the activity of NOS would increase during cold acclimation. To test this hypothesis, we measured the activity and mRNA levels of NOS in three tissues (liver, oxidative muscle, glycolytic muscle) known to undergo mitochondrial biogenesis and/or angiogenesis. Measurements were made in the threespine stickleback, Gasterosteus aculeatus acclimated to either warm (20°C) or cold (8°C) temperature for 9weeks. Cold-acclimated fish were harvested on days 1-3, and at weeks 1, 4 and 9 at 8°C, while warm-acclimated fish were harvested on day 0 and after 9 weeks at 20°C. Transcript levels of NOS were quantified using quantitative real-time PCR, and NOS activity was measured using a radiochemical assay, which detected the rate of catabolism of (14)C-labeled arginine. Neither NOS activity nor transcripts were detected in oxidative muscle or glycolytic muscle of warm- or cold-acclimated stickleback, although transcript levels of nNOS and NOS activity were detected in brain. Arginine catabolism was detected in liver of animals held at 10°C and 20°C for 9weeks, but was due to arginase activity, rather than NOS. Consistent with this, NOS transcripts were undetectable in liver. The absence of NOS in liver and muscles of stickleback indicates that signaling molecules other than NO likely mediate physiological changes during cold acclimation in stickleback.
Early activation and coordination of innate defenses are critical for effective responses against infiltrating pathogens. Rapid engagement of immune cells provides a critical first line of defense soon after pathogen infiltration. Activation leads to a well-orchestrated set of events that sees the induction and regulation of intracellular and extracellular antimicrobial defenses. An array of regulatory mediators, highly toxic soluble molecules, degradative enzymes and antimicrobial peptides provides maximal protection against a wide range of pathogens while limiting endogenous damage to host tissues. In this review we highlight recent advances in our understanding of innate cellular antimicrobial responses of teleost fish and discuss their implications to cell survival, immunomodulation and death. The evolutionary conservation of these responses is a testament to their effectiveness against pathogen infiltration and their commitment to effective maintenance of host homeostasis. Importantly, recent developments in teleost fish systems have identified novel host defense strategies that may be unique to this lower vertebrate group or may point to previously unknown innate mechanisms that also play a significant role in higher vertebrate host immunity.
Species of the fish genus Carassius survive prolonged anoxia. Nitric oxide (NO) regulates cerebral blood flow in these fish during normoxic conditions whereas adenosine is the main vasoregulating molecule during anoxia. We investigated the calcium ion dependence of Carassius auratus brain NO synthase (NOS) as a function of pH. The physiological pH decrease from 7.2 to 6.8, which takes place during anoxia, greatly decreases NOS activity. This strong pH dependence is mainly due to variation of the calcium sensitivity of the enzyme. The EC(50) is 0.15 microM at pH 7.2 and 2.1 microM at pH 6.8 for the soluble enzyme. The particulate enzyme is also dependent on pH variations. The reduced sensitivity to calcium ions at acidic pH decreases both NO and H(2)O(2) production, saving the cells by suppression of the formation of potentially toxic nitrogen and oxygen species. Modulation of NOS activity by variation of its calcium affinity within the range of physiological pH constitutes an important and rapid mechanism to control the formation of NO and H(2)O(2) during normoxia-anoxia and anoxia-normoxia transitions.
Gene and genome duplications in the vertebrate lineage explain the complexity of extant gene families. Among these, the medium-chain alcohol dehydrogenase (ADH), which expanded by tandem duplications after the cephalochordate-vertebrate split, is a good model with which to analyze the evolution of gene function. Although the ancestral member of this family, ADH3, has been strictly conserved throughout animal evolution, its physiological role is still controversial. Previous evidence indicates that it contributes to formaldehyde cytoprotection, retinoic acid metabolism, and nitric oxide homeostasis. We performed in situ hybridization during Drosophila, ascidian (Ciona intestinalis), and zebrafish (Danio rerio) development. We showed that Adh3 expression was restricted to the fat body in Drosophila embryos at stage 17 and to the anterior endoderm in C. intestinalis tail bud, whereas in the zebrafish 2.5-day larvae the signal appeared widespread. A more comprehensive expression analysis including amphioxus and mice revealed that ancestral Adh3 was tissue specific, whereas a widespread expression was later attained in vertebrates. These variations occurred concomitantly with the expansion of the ADH family and the acquisition of new functions but were unlinked to the genomic changes that led to the transition from fractional to global methylation in vertebrates. Our data challenge the housekeeping role of ADH3 and question its involvement in the prevertebrate retinoic acid pathway.
Many studies have revealed the free radical nitric oxide (NO) to be an important modulator of vascular and neuronal physiology. It also plays a developmental role in regulating synapse formation and patterning. Recent studies suggest that NO may also mediate the switch from proliferation to differentiation during neurogenesis. Many mechanisms of this response are conserved between neuronal precursor cells and the cells of the vascular system, where NO can inhibit the proliferative response of endothelial and smooth-muscle cells to injury. In cultured neuroblastoma cells, NO synthase (NOS) expression is increased in the presence of various growth factors and mitogens. Subsequent production of NO leads to cessation of cell division and the acquisition of a differentiated phenotype. The inhibitory action of NO on neuroblast proliferation has also been demonstrated in vivo for vertebrate and invertebrate nervous systems, as well as in the adult brain. Potential downstream effectors of NO include the second messenger cyclic GMP, activation of the tumor-suppressor genes p53 and Rb, and the cyclin-dependent kinase inhibitor p21. These studies highlight a new role for NO in the nervous system, as a coordinator of proliferation and patterning during neural development and adult neurogenesis.
Mitochondria play a central role in the life and death of cells. These organelles serve as the major energy-producing power-house, whereby the generation of ATP is associated with the utilization of molecular oxygen. A significant fraction (2-3%) of molecular oxygen consumed by mitochondria may be reduced in a one-electron fashion to yield a series of reactive oxygen species (ROS) such as superoxide anion radical, hydrogen peroxide, and hydroxyl radical. ROS are capable of damaging components of the electron transport apparatus and can, in turn, disrupt mitochondrial functioning, limiting cellular ATP levels and ultimately resulting in cell death. ROS-induced disruption of electron transport can perpetuate production of deleterious ROS and propagate mitochondrial damage. Consequently, mitochondria are highly enriched with water-soluble and lipid-soluble antioxidants (glutathione, ascorbate, Vitamin E, and coenzyme Q) and antioxidant enzymes, such as superoxide dismutase, glutathione peroxidase, catalase, thioredoxins, and peroxiredoxin. Another important antioxidant acting as a very effective scavenger of reactive lipid (peroxyl, alkoxyl) radicals is nitric oxide (NO) generated by mitochondrial nitric oxide synthase. However, NO can also be very disruptive to mitochondria function, a process facilitated by its high reactivity with superoxide. This interaction results in the formation of peroxynitrite, an oxidant capable of causing oxidative/nitrosative stress, further aggravating mitochondrial dysfunction, causing ATP depletion and damage to cells. Thus, in the most general sense, the effects of NO in mitochondria may be either protective or deleterious depending on specific conditions of local redox environment (redox potential, ratio of oxidized to reduced glutathione, transition metals, and the presence of other oxygen- and nitrogen-centered radicals).
Since the discovery of the biological effects of nitric oxide (NO) more than two decades ago, NO has been identified as an important physiological modulator and a messenger molecule in mammals. Parallel to these studies, evidence that has accumulated in recent years has revealed that the NO signalling pathway is spread throughout the entire phylogenetic scale, being increasingly found in lower organisms, ranging from Chordata to Mollusca. The present review attempts to provide a survey of current knowledge of the genesis and possible roles of NO and the related signalling pathway in marine invertebrates, with special emphasis on Sepia, a choice dictated by the increasing appreciation of cephalopods as most valuable model systems for studies of NO biology and the present expectation for new exciting insights into as yet little explored segments of NO biology.
Ten years ago, we surmised that there was a common evolutionary origin for the immune and neuroendocrine systems. This was based on morphological and functional results indicating that a common pool of molecules is shared by the two systems, both in invertebrates and vertebrates. In the past decade, numerous molecular biology experiments have confirmed sequence similarity between invertebrate and vertebrate neuroimmune mediators, such as corticotrophin-releasing hormone. However, sequence similarity-based approaches were inadequate for analyzing other immune-related molecules, such as helical cytokines. This review covers older, and more recent findings on invertebrate immune- and neuroendocrine-related molecules with an evolutionary perspective, and suggests that protein-folding recognition algorithms are a fundamental tool in understanding the evolution of immune- and neuroendocrine-related molecules.
To investigate the link between chronic biliary inflammation and carcinogenesis using hamster gallbladder epithelial cells.
Gallbladder epithelial cells were isolated from hamsters and cultured with a mixture of inflammatory cytokines including interleukin-1beta, interferon-gamma, and tumor necrosis factor-alpha. Inducible nitric oxide synthase (iNOS) expression, nitric oxide (NO) generation, and DNA damage were evaluated.
NO generation was increased significantly following cytokine stimulation, and suppressed by an iNOS inhibitor. iNOS mRNA expression was demonstrated in the gallbladder epithelial cells during exposure to inflammatory cytokines. Furthermore, NO-dependent DNA damage, estimated by the comet assay, was significantly increased by cytokines, and decreased to control levels by an iNOS inhibitor.
Cytokine stimulation induced iNOS expression and NO generation in normal hamster gallbladder epithelial cells, which was sufficient to cause DNA damage. These results indicate that NO-mediated genotoxicity induced by inflammatory cytokines through activation of iNOS may be involved in the process of biliary carcinogenesis in response to chronic inflammation of the biliary tree.
Each copy of any part of a JSTOR transmission must contain the same copyright notice that appears on the screen or printed page of such transmission. The JSTOR Archive is a trusted digital repository providing for long-term preservation and access to leading academic journals and scholarly literature from around the world. The Archive is supported by libraries, scholarly societies, publishers, and foundations. It is an initiative of JSTOR, a not-for-profit organization with a mission to help the scholarly community take advantage of advances in technology. For more information regarding JSTOR, please contact support@jstor.org.
Nitric oxide (NO) is a ubiquitous intercellular messenger molecule synthesized from the amino acid L-arginine by NO synthases in diverse cells and tissues. NO is synthesized in vascular endothelial cells and appears to play an important role in the control of blood pressure and platelet aggregation. A detailed understanding of the regulation of NO synthesis by endothelial cells has been hampered by the lack of molecular clones for endothelial NO synthase; the isolation and characterization of such clones is reported herein. The constitutive NO synthases present in endothelial cells and in brain share common biochemical and pharmacologic features. We purified NO synthase from bovine brain and determined the amino acid sequence of several tryptic peptides. The sequence of the bovine brain peptides is nearly identical to the deduced amino acid sequence previously determined for the rat brain NO synthase. These sequence data were utilized to design PCR-generated NO synthase cDNA probes, which were used to isolate clones encoding NO synthase from a bovine aortic endothelial cell (BAEC) cDNA library. A full-length NO synthase cDNA clone was isolated, representing a protein of 1205 amino acids with a molecular mass of 133 kDa; transfection of this clone in a heterologous expression system demonstrated the expected enzymatic activity. The deduced amino acid sequence of the BAEC NO synthase cDNA differs at numerous residues from the sequence determined for the purified bovine brain protein and shows 50-60% sequence identity with recently isolated molecular clones for murine macrophage and rat brain NO synthase isoforms. Bovine genomic Southern blots probed with bovine brain and BAEC NO synthase cDNA probes identify distinct bands, indicating that these cDNAs are the products of different genes. Prolonged treatment of BAECs with the cytokine tumor necrosis factor alpha, which we have previously shown to result in a marked increase in NO synthase activity, is associated with a decrease in the abundance of the 4.8-kilobase BAEC NO synthase transcript. The increase in BAEC NO synthase activity induced by tumor necrosis factor alpha is thus likely to involve posttranscriptional mechanisms or the induction of a distinct endothelial NO synthase isoform.
The three-dimensional solution structure of the complex between calcium-bound calmodulin (Ca(2+)-CaM) and a 26-residue synthetic peptide comprising the CaM binding domain (residues 577 to 602) of skeletal muscle myosin light chain kinase, has been determined using multidimensional heteronuclear filtered and separated nuclear magnetic resonance spectroscopy. The two domains of CaM (residues 6 to 73 and 83 to 146) remain essentially unchanged upon complexation. The long central helix (residues 65 to 93), however, which connects the two domains in the crystal structure of Ca(2+)-CaM, is disrupted into two helices connected by a long flexible loop (residues 74 to 82), thereby enabling the two domains to clamp residues 3 to 21 of the bound peptide, which adopt a helical conformation. The overall structure of the complex is globular, approximating an ellipsoid of dimensions 47 by 32 by 30 angstroms. The helical peptide is located in a hydrophobic channel that passes through the center of the ellipsoid at an angle of approximately 45 degrees with its long axis. The complex is mainly stabilized by hydrophobic interactions which, from the CaM side, involve an unusually large number of methionines. Key residues of the peptide are Trp4 and Phe17, which serve to anchor the amino- and carboxyl-terminal halves of the peptide to the carboxyl- and amino-terminal domains of CaM, respectively. Sequence comparisons indicate that a number of peptides that bind CaM with high affinity share this common feature containing either aromatic residues or long-chain hydrophobic ones separated by a stretch of 12 residues, suggesting that they interact with CaM in a similar manner.
Nitric oxide (NO) synthase in rat brain was found to be constitutive and Ca2(+)-dependent. The enzyme in rat lung or liver (predominantly in parenchymal cells) was not constitutive, but was induced by endotoxin treatment and was Ca2(+)-independent. The NO synthases in rat brain and liver or lung are therefore distinct both in their properties and in their regulation.
Livers of a natural population of winter flounder from a contaminated site in Boston Harbor were examined for the presence of oncogenes by transfection of DNA into NIH 3T3 mouse fibroblasts. Tissues analyzed contained histopathologic lesions including abnormal vacuolation, biliary proliferation, and, in many cases, hepatocellular and cholangiocellular carcinomas. Fibroblasts transfected with liver DNA samples from 7 of 13 diseased animals were effective in the induction of subcutaneous sarcomas in nude mice. Further analysis revealed the presence of flounder c-Ki-ras oncogenes in all 10 nude mouse subcutaneous tumors analyzed. Direct DNA sequencing and allele-specific oligonucleotide hybridization following amplification of the tumor DNA by the polymerase chain reaction showed mutations in the 12th codon in this gene. Analysis of DNA from all nude mouse tumors as well as the livers from which they were derived showed mutations at this codon. The mutations comprised G.C----A.T or G.C----T.A base changes resulting in substitution of serine, valine, or cysteine for glycine. Liver DNA samples from five histologically normal livers of animals from a less polluted site were ineffective in the transfection assay and showed only wild-type DNA sequences (GGT) at the 12th codon of c-Ki-ras. The prevalence of mutations in this gene region was associated with the presence of liver lesions and could signify DNA damage resulting from environmental chemical exposure.
Incubation of human articular chondrocytes with interleukin 1 beta results in the time-dependent expression of nitric oxide (NO) synthase. We report here the isolation of a cDNA clone which encodes a protein of 1153 amino acids with a molecular mass of 131,213 Da and a calculated isoelectric point of 7.9. CHO cells transfected with a plasmid harboring this cDNA clone expressed NO synthase activity that was inhibited by some L-arginine analogues. The deduced amino acid sequence of the human chondrocyte inducible NO synthase shows 51% identity and 68% similarity with the endothelial NO synthase and 54% identity and 70% similarity with the neuronal NO synthase. The similarity (88%) between the human chondrocyte NO synthase cDNA sequence and that reported for the murine macrophage suggests that the inducible class of enzyme is conserved between different cell types and across species.
Physarum polycephalum, an acellular slime mould, serves as a model system to study cell-cycle-dependent events since nuclear division is naturally synchronous. This organism was shown to release isoxanthopterin which is structurally related to tetrahydrobiopterin, a cofactor of aromatic amino acid hydroxylases and of nitric oxide synthases (NOSs) (EC 1.14.13.39). Here, we studied Physarum pteridine biosynthesis in more detail and found that high amounts of tetrahydrobiopterin are produced and NOS activity is expressed. Physarum pteridine biosynthesis is peculiar in as much as 7,8-dihydroneopterin aldolase (EC 4.1.2.25), an enzyme of folic acid biosynthesis usually not found in organisms producing tetrahydrobiopterin, is detected in parallel. NOS purified from Physarum depends on NADPH, tetrahydrobiopterin and flavins. Enzyme activity is independent of exogenous Ca2+ and is inhibited by arginine analogues. The purified enzyme (with a molecular mass of 130 kDa) contains tightly bound tetrahydrobiopterin and flavins. During the synchronous cell cycle of Physarum, pteridine biosynthesis increases during S-phase whereas NOS activity peaks during mitosis, drops at telophase and peaks again during early S-phase. Our results characterize Physarum pteridine biosynthesis and NOS and suggest a possible link between NOS activity and mitosis.
Hepatic macrophages and endothelial cells play an important role in the clearance of endotoxin from the portal circulation. These cells are activated by endotoxin to release reactive mediators including superoxide anion, hydrogen peroxide, and nitric oxide, which have been implicated in hepatic inflammation and tissue injury. In the present studies we analyzed mechanisms regulating the production of nitric oxide by hepatic macrophages and endothelial cells following in vivo exposure to endotoxin. Rats were injected intravenously with Escherichia coli lipopolysaccharide (LPS, 5 mg/kg). Cells were isolated from the animals 48 h later by in situ perfusion of the liver with collagenase and pronase followed by differential centrifugation and centrifugal elutriation. We found that macrophages and endothelial cells from both untreated and endotoxin-treated rats readily synthesized nitric oxide following in vitro stimulation with interferon-gamma (IFN-gamma) and LPS alone and in combination. This response was dependent on l-arginine and was blocked by two nitric oxide synthase inhibitors, NG-monomethyl-l-arginine and l-canavanine. Macrophages produced more nitric oxide in response to LPS or LPS plus IFN-gamma than endothelial cells. In addition, nitric oxide production by both cell types in response to LPS plus IFN-gamma was increased after treatment of rats with endotoxin. Macrophages appeared to be more sensitive than endothelial cells to the in vivo effects of this inflammatory stimulus. Northern and Western blot analysis demonstrated that nitric oxide production by macrophages and endothelial cells in response to LPS plus IFN-gamma was due to increased expression of an inducible form of nitric oxide synthase (iNOS) mRNA and protein. Using fluorescence image analysis, iNOS protein was found to be localized in the cytoplasm of the cells. Treatment of rats with endotoxin was associated with increased expression of iNOS protein in the macrophages. The phorbol ester 12-O-tetradecanoyl-phorbol-13-acetate (TPA) also stimulated nitric oxide production by macrophages and endothelial cells from endotoxin-treated rats, although not as effectively as LPS and IFN-gamma. Macrophages were more responsive than endothelial cells to TPA. Furthermore, depletion of the cells of glutathione using buthionine sulfoximine had no major effect on nitric oxide production by macrophages but resulted in small but significant inhibition in endothelial cells. This suggests that this sulfhydryl-containing tripeptide does not regulate intracellular levels of reactive nitrogen intermediates in activated macrophages.(ABSTRACT TRUNCATED AT 400 WORDS)
We report the first nonmammalian inducible nitric-oxide synthase (NOS) cDNA obtained from chicken macrophages. It exhibits an open reading frame encoding 1,136 amino acid residues, predicting a protein of 129,648-Da molecular mass. The deduced NOS protein sequence showed 66.6%, 70.4%, 54.2%, and 48.7% sequence identity to mouse and human inducible NOS and to two constitutive NOSs from rat brain and bovine endothelium. Overall, NOS appears to be a moderately conserved protein. Northern analysis showed that chicken iNOS mRNA is approximately 4.5 kilobases (kb), a size similar to mammalian inducible NOS. Analysis of 3.2 kb of 5'-flanking sequence of the chicken iNOS gene showed a putative TATA box at 30 base pairs (bp) upstream of the transcription initiation site. The functional importance of the upstream region was determined by transient expression of deletion constructs. An endotoxin regulatory region was located exclusively within 300 bp upstream of the transcription initiation site. This is in contrast to the two distinct sites identified in the mouse macrophage NOS promoter. Transcription factor binding sites such as NF-kappaB, PEA1, PEA3, and C/EBP were identified. Using a NF-kappaB inhibitor, we showed that NF-kappaB is indeed involved in the induction of chicken iNOS gene by lipopolysaccharide. Our results suggest that NF-kappaB is a common regulatory component in the expression of both mammalian and nonmammalian iNOS genes.
Calmodulin (CaM) is recognized as a major calcium sensor and orchestrator of regulatory events through its interaction with a diverse group of cellular proteins. Many investigations have focused on defining the region of interaction between CaM and its cellular targets and the action of CaM on target protein function. Because CaM can bind with high affinity to a relatively small alpha-helical region of many proteins, success in clearly defining the essential elements of CaM binding motifs seems feasible and should provide a means of identifying CaM binding proteins. Three recognition motifs for CaM interaction are discussed in the context of experimental investigations of a variety of CaM target proteins. A modified version of the IQ motif as a consensus for Ca2+-independent binding and two related motifs for Ca2+-dependent binding, termed 18-14 and 1-5-10 based on the position of conserved hydrophobic residues, are proposed. Although considerable sequence diversity is observed among the different binding regions, these three classes of recognition motifs exist for many of the known CaM binding proteins.
Nitric oxide (NO) conveys a variety of messages between cells, including signals for vasorelaxation, neurotransmission, and cytotoxicity. In some endothelial cells and neurons, a constitutive NO synthase is activated transiently by agonists that elevate intracellular calcium concentrations and promote the binding of calmodulin. In contrast, in macrophages, NO synthase activity appears slowly after exposure of the cells to cytokines and bacterial products, is sustained, and functions independently of calcium and calmodulin. A monospecific antibody was used to clone complementary DNA that encoded two isoforms of NO synthase from immunologically activated mouse macrophages. Liquid chromatography-mass spectrometry was used to confirm most of the amino acid sequence. Macrophage NO synthase differs extensively from cerebellar NO synthase. The macrophage enzyme is immunologically induced at the transcriptional level and closely resembles the enzyme in cytokine-treated tumor cells and inflammatory neutrophils.
This report demonstrates the presence of the immunoreactive enzyme nitric oxide (NO) synthase in the molluscan hemocytes of Viviparus ater. Bacterial elimination by the hemocytes occurs through phagocytosis and the nitric oxide (NO) system. These processes are correlated, and the hemocytes activate phagocytosis before the NO defence response. This behaviour could be explained by the fact that, as in vertebrate macrophages, NO synthase can also be induced in invertebrate hemocytes. Indeed, in the bacteria-activated hemocytes there is an increase of NO synthase in comparison to controls. Moreover, the same behaviour is also seen in the NADPH diaphorase activity. These findings suggest a pivotal role of the NO system in defence mechanisms, and indicate that, as with phagocytosis, this system developed very early in the course of evolution.
The recently-developed statistical method known as the "bootstrap" can be used to place confidence intervals on phylogenies. It involves resampling points from one's own data, with replacement, to create a series of bootstrap samples of the same size as the original data. Each of these is analyzed, and the variation among the resulting estimates taken to indicate the size of the error involved in making estimates from the original data, In the case of phylogenies, it is argued that the proper method of resampling is to keep all of the original species while sampling characters with replacement, under the assumption that the characters have been independently drawn by the systematist and have evolved independently. Majority-rule consensus trees can be used to construct a phylogeny showing all of the inferred monophyletic groups that occurred in a majority of the bootstrap samples. If a group shows up 95% of the time or more, the evidence for it is taken to be statistically significant. Existing computer programs can be used to analyze different bootstrap samples by using weights on the characters, the weight of a character being how many times it was drawn in bootstrap sampling. When all characters are perfectly compatible, as envisioned by Hennig, bootstrap sampling becomes unnecessary; the bootstrap method would show significant evidence for a group if it is defined by three or more characters.
Nitric oxide is a messenger molecule, mediating the effect of endothelium-derived relaxing factor in blood vessels and the cytotoxic actions of macrophages, and playing a part in neuronal communication in the brain. Cloning of a complementary DNA for brain nitric oxide synthase reveals recognition sites for NADPH, FAD, flavin mononucleotide and calmodulin as well as phosphorylation sites, indicating that the synthase is regulated by many different factors. The only known mammalian enzyme with close homology is cytochrome P-450 reductase.
The effects of l-arginine, and its analogues N
ω-nitro-l-arginine methyl ester and N
ω-nitro-l-arginine on vascular resistance were investigated in the intact coronary system of an isolated non-working trout heart preparation. l-Arginine, at 10–8 mol · l–1induced a slight vasodilatory effect (max 10%). N
ω-nitro-l-arginine methyl ester and N
ω-Nitro-l-arginine in the range 10–8–10–4 mol · l–1 caused dose-dependent increases in coronary resistance. The vasodilatory action of l-arginine was abolished when the preparation was pretreated with 10–4 mol · l–1N
ω-nitro-l-arginine or N
ω-nitro-l-arginine methyl ester. Nitroprusside alone at 1 mmol · l–1 induced a maximum vasodilation (30%) of the coronary system. Methylene blue a known inhibitor of guanylate cyclase, induced a strong vasoconstriction (already significant at 10–5 mol · l–1) and was able to overcome the vasodilative effect of nitroprusside. The endothelial nitric oxide agonists acetylcholine and serotonin, established in mammalian vessels, also mediate vasodilation in trout coronary system. In 50% of preparations, acetylcholine induced a biphasic response with vasodilation at low concentration (max 15% at 10–8 mol · l–1). Serotonin displayed a dose-response vasodilation in the range 10–8–10–4 mol · l–1 (max 20%). These vasodilative effects were reduced or abolished by 10–4 mol · l–1l-NA. These data support the existence of NO-mediated vasodilation mechanisms in the trout coronary system.
The subcellular localization of neuronal nitric oxide (NO) synthase (NOS)-immunoreactive (NOSir) elements in the brain of the Atlantic salmon was investigated by means of electron microscopy and confocal laser scanning microscopy. NOSir structures are present only in neuronal elements. In neuronal processes, strong NOS immunoreactivity was mainly localized within synaptic vesicles or seen as a dense accumulation associated with the plasma membrane of dendrites and at terminal formations. NOSir precipitate was also associated with microtubuli and mitochondrial outer membranes. The highest accumulation of NOS immunoreactivity was found in dendrites located in close apposition to immunonegative myelinated or unmyelinated neural processes. Several NOSir and unmyelinated immunonegative profiles formed synaptic specializations. Immunonegative neurons in contact with NOSir processes always contained round clear synaptic vesicles. In neuronal somata, strong NOS immunoreactivity was localized in the cristae of some large mitochondria, whereas vacuoles and the endoplasmic reticulum showed a relatively weak staining. Confocal microscopic analysis of NOS immunofluorescence showed a corresponding subcellular localization of NOS in different brain regions, but also indicated the presence of NOS axosomatic terminals. Our data show that specific neurons contain a neuronal NOS-like molecule which to a high degree is stored in vesicles and is accumulated at various sites along the neuronal processes or at specific synaptic terminal formations. Thus, NO may be formed and exert its actions at various sites along the processes of NOS-synthesizing neurons. The present study provides evidence at the ultrastructural level that NO may play a messenger role in neural circuits involved in visual and hypophysiotrophic brain functions.
The constitutive nitric oxide synthase activity of the catfish taste organ (barbel) was characterized, using the conversion of l-[3H]arginine to l-[3H]citrulline as the index of enzyme activity. The enzyme was dependent on Ca2+ (but not calmodulin) and NADPH (but not FAD). Activity was moderately enhanced by tetrahydrobiopterin. Kinetic parameters were Km = 22 μM and Vmax = 25 pmol/min/mg. The enzyme was inhibited by (half-maximally at 3 μM) and (half-maximally at 50 μM), and also by sodium nitroprusside and superoxide dismutase. In the presence of millimolar levels of the taste stimulus l-alanine, nitric oxide synthase activity was increased by up to 3-fold, with activation of the enzyme being reversed by . There was no activation of guanylyl cyclase by l-alanine. These data indicate that a constitutive nitric oxide synthase activity is present in the catfish taste organ and that, therefore, nitric oxide may have a role in the biochemical mechanisms underlying taste perception.
Here we report on the molecular characterization of the first molluscan NOS in the CNS of the pond snail Lymnaea stagnalis. This Lymnaea NOS (Lym-nNOS) which is expressed preferentially in the CNS is most similar to mammalian neuronal NOS but contains tandem repeats of a seven amino acid motif not found in any other known NOS. We have localized Lym-nNOS to the serotonergic cerebral giant cells (CGCs) which modulate synaptic transmission within a neural network that generates feeding behavior. Our results suggest that the CGCs employ both NO and serotonin in the modulation of the central neural network underlying feeding.
Nitric oxide synthase (NOS) activity is found both in soluble and in particulate fractions of the carp brain. The Km values for arginine are 2.8+/-0.5 and 3.3+/-0.4 microM for the soluble and particulate fractions, respectively. K for NG-monomethyl-L-arginine inhibitor are 2.6+/-0.5 and 2.9+/-0.6 microM, and activation energy for the breakdown of the substrate-enzyme complex 8120+/-710 and 4620+/-450 cal per mole. Carp enzyme shows higher affinity than rat NOS for Ca2+ and for the competitive inhibitor 7-nitroindazole.
Histological studies have detected nitric oxide (NO) synthase in the central nervous system of all vertebrates examined, from lampreys to mammals. However, there are still very few comparative physiological studies on the function of NO synthase in the brain of non-mammalian vertebrates. So far, we know that acetylcholine can cause an NO-dependent increase in brain blood flow in turtles and some fish species (crucian carp and rainbow trout), whereas some other fishes appear to lack such a mechanism. Hypercapnia can induce NO-dependent cerebral vasodilation in mammals, but such a mechanism appears to be lacking in the ectothermic vertebrates examined. The number of species studied needs to be expanded before we can draw any firm conclusions about the origin of NO-dependent brain blood flow regulation: if it has evolved more than once or if it has been occasionally lost during evolution. We conclude that NO synthase may be present in all vertebrate brains but that its functions can vary, as judged from its role in cerebral blood flow regulation. The diversity of functions that NO has proven to have within the mammalian brain is likely to be paralleled by the same degree of diversity of function between vertebrate groups.
Nitric oxide (NO) conveys a variety of messages between cells, including signals for vasorelaxation, neurotransmission, and
cytotoxicity. In some endothelial cells and neurons, a constitutive NO synthase is activated transiently by agonists that
elevate intracellular calcium concentrations and promote the binding of calmodulin. In contrast, in macrophages, NO synthase
activity appears slowly after exposure of the cells to cytokines and bacterial products, is sustained, and functions independently
of calcium and calmodulin. A monospecific antibody was used to clone complementary DNA that encoded two isoforms of NO synthase
from immunologically activated mouse macrophages. Liquid chromatography-mass spectrometry was used to confirm most of the
amino acid sequence. Macrophage NO synthase differs extensively from cerebellar NO synthase. The macrophage enzyme is immunologically
induced at the transcriptional level and closely resembles the enzyme in cytokine-treated tumor cells and inflammatory neutrophils.
The constitutive calcium/calmodulin-dependent nitric oxide (NO) synthase expressed in vascular endothelium shares common biochemical and pharmacologic properties with neuronal NO synthase. However, recent cloning and molecular characterization of NO synthase from bovine endothelial cells indicated the existence of a family of constitutive NO synthases. Accordingly, we undertook molecular cloning and sequence analysis of human endothelial NO synthase. Complementary DNA clones predict a protein of 1,203 amino acids sharing 94% identity with the bovine endothelial protein, but only 60% identity with the rat brain NO synthase isoform. Northern blot analysis with an endothelial-derived cDNA identified a 4.6-4.8 kb mRNA transcript in HUVEC and in situ hybridization localized transcripts to vascular endothelium but not neuronal tissue.
We have isolated and sequenced a mouse brain cDNA encoding Ca2+/calmodulin-dependent protein kinase IV. The sequence predicts an acidic protein (pI = 4.56) of 469 amino acids (Mr = 52,627) that contains kinase catalytic and calmodulin-binding domains. The carboxy region has several primary structural features that suggest it may be a readily cleaved attachment domain. This region is highly charged and hydrophilic and contains several PEST sequences, motifs associated with high turnover proteins. Of the tissues examined, expression of the CaM kinase IV gene is restricted to brain and testis, where transcripts are differentially expressed to produce a kinase in both tissues and a calmodulin-binding protein, calspermin, in testis that lacks a kinase catalytic domain.
Bradykinin (BK)- or acetylcholine (ACh)-mediated vasodilation has only rarely been observed in fish. This suggests that many fish vessels lack the endothelium-dependent relaxing mechanisms recently identified in mammals. To examine this hypothesis, isolated vascular rings were prepared from trout ventral aortas (VA), efferent branchial and celiacomesenteric (CM) arteries, and anterior cardinal veins (CV) and examined for endothelium-mediated responses. A doubly perfused trunk preparation was also used to evaluate the response of the microcirculation. ACh produced dose-dependent contractions in all vascular rings and increased vascular resistance when perfused into the CM but had no affect when perfused into the dorsal aorta. Neither ACh nor BK relaxed precontracted vessels or lowered resting tone. Removal of the endothelium did not affect ACh or BK responses. The calcium ionophore A23187 produced an endothelium-dependent relaxation of precontracted VA, CM, and CV. The A23187 response was abolished by indomethacin, indicating that a prostanoid was involved in the relaxation. ATP contracted and/or relaxed precontracted CM and CV. ATP effects were independent of an intact endothelium. Sodium nitroprusside and atrial natriuretic factor partially or completely relaxed all vessels, indicating the presence of soluble and particulate guanylate cyclases, respectively. These results suggest that nonprostanoid endothelium-derived relaxing factors (EDRFs) or EDRF-like vasodilator mechanisms are not present in trout vessels or, if they are, they are not released by classical agonists.
Previous studies have shown that high levels of cytochrome P450 can occur in cardiac microsomes of vertebrates [Mol. Pharmacol. 21:517-526, (1982)]. Here we identify the dominant cardiac P450 in the marine fish scup as P450E, a teleost representative of P450IA1, and we describe its restricted cellular localization in the heart. Treatment of scup with beta-naphthoflavone produced an unusually strong (10-fold) induction of spectrally measured P450 in cardiac microsomes, with specific content reaching levels (0.5 nmol/mg) similar to those induced in scup liver. Microsomal ethoxyresorufin O-deethylase and aryl hydrocarbon hydroxylase activities, catalytic functions of scup P450E, were induced in parallel with P450 content. Similar induction was seen in both atrium and ventricle. Immunoblot analysis with monoclonal antibody 1-12-3, specific to scup P450E and other vertebrate P450IA1 proteins, showed that this hydrocarbon-inducible P450 is the dominant and possibly sole P450 form in heart microsomes of experimentally induced animals. Immunohistochemical analysis of scup heart sections (2-4-microns) with monoclonal antibody 1-12-3 revealed that P450E was detectable only in endothelial cells of the endocardium and of the coronary vasculature. A similar endothelial cell localization of the monoclonal antibody 1-12-3 epitope was observed in heart of rainbow trout, induced with beta-naphthoflavone, indicating a general nature for the endothelial localization of induced cardiac P450. Morphometric analysis showed that endothelium could constitute 8-9% of the volume of teleost heart, from which we calculate that P450IA1 could account for as much as 25% of the endothelial cell microsomal protein. Heart microsomes of untreated animals from contaminated environments also contained high levels of P450E, indicating that induction like that caused by beta-naphthoflavone could occur with chemicals in the environment. Strongly induced P450E (P450IA1) in endothelium could play a critical role in chemical-biological interactions involving xenobiotics affecting the vasculature of the heart or other organs.
BALB/c mice injected intraperitoneally with bacterial lipopolysaccharide (LPS) developed lethal septic shock. This was accompanied by significantly elevated concentrations of nitrite and nitrate in the plasma and expression of high levels of nitric oxide (NO) synthase activity in the lungs, heart, spleen and peritoneal macrophages. Mice pretreated with anti-tumour necrosis factor-alpha (TNF-alpha) monoclonal antibody or anti-interleukin-1 beta (IL-1 beta) polyclonal antibody were protected, in a dose-dependent manner, from endotoxin-induced mortality. This effect was accompanied by a significant reduction in plasma levels of nitrite and nitrate. Antibody treatment also reduced the level of NO synthase activity in peritoneal macrophages, spleen and heart but had no effect on enzyme expression in the lung. These results demonstrate that TNF-alpha and IL-1 beta play an important role in the induction of NO following administration of LPS and in the development of endotoxin-induced shock. In addition, NO synthase activity is differentially expressed in various organs and this may not always require TNF-alpha and IL-1 beta.
Nitric oxide synthase (EC 1.14.23) was discovered in a Nocardia species. The bacterial nitric oxide synthase was purified as much as 380 fold by affinity chromatography over 2',5'-ADP-agarose. The partially purified enzyme required NADPH, O2, CA++, FAD, FMN, and tetrahydrobiopterin as cofactors in the conversion of L-arginine to L-citrulline and nitric oxide. The apparent Km for L-arginine was determined to be 8.2 microM, and the Vmax was 840 nmole NADPH consumed/min/mg protein. The enzyme was competetively inhibited by NG-nitro-arginine with an apparent Ki of 14.6 microM. The experimental evidence provides confirmation of the first microbial nitric oxide synthase in microorganisms.
The presence and distribution of the nitric oxide (NO) converting enzyme, NO synthase (NOS), was investigated in the brain of a teleost, the Atlantic salmon. Both NOS immunoreactive and NADPH diaphorase positive, non-neuronal and neuronal cell bodies, fibers and putative nerve terminals were identified throughout the brain. Even so, the staining was not identical in all regions. NO, synthesized by NOS-like enzymes, may play an important role in a diversity of cellular mechanisms in the brain of the salmon, including in neural systems related to olfactory, visual, hypophysiotrophic, viscero-sensoric and motor functions.
Administration of endotoxin to rodents produces widespread tissue induction of nitric oxide synthase (NOS). To understand the mechanisms of the resulting endotoxin shock, it is important to know the cellular distribution of the inducible NOS (iNOS).
We have investigated the localization and time course of expression of iNOS in rats at time 0 (control) and 3, 6, 9, and 24 hours after administration of endotoxin and also in endotoxin- and cytokine-stimulated RAW 264 murine macrophage and A7r5 aortic smooth muscle cells. We have used a rabbit antiserum to a synthetic peptide selected from the deduced sequence of the cloned macrophage enzyme (residues 47-71) and immunochemical techniques.
The antiserum reacted with an approximately 130-kilodalton protein (the molecular weight of iNOS) in Western blots of total cytoplasmic proteins from livers of endotoxin-treated rats, RAW 264 murine macrophages stimulated with endotoxin and combinations of cytokines, and purified liver iNOS, but not in control, untreated tissues. Strong cytoplasmic immunostaining was seen in RAW 264 murine macrophages and A7r5 rat aortic smooth muscle cells after stimulation, but not in nonstimulated cells. Three hours after endotoxin treatment in rats, iNOS immunoreactivity was detectable in many tissues and was at its strongest at 6 and 9 hours after stimulation. Staining was detected predominantly in macrophages distributed abundantly in heart, lung, liver, and kidney. It was also present in Kupffer cells and hepatocytes, biliary epithelium, mesangial cells, airway epithelium, and nerves supplying mesenteric blood vessels but was not detected in any vasculature. By 24 hours there was a reduction in the number of cells stained compared with that seen at 6 and 9 hours. In addition, at 24 hours after endotoxin treatment, granulomatous lesions showing iNOS staining were evident, particularly in the liver.
Antiserum raised to macrophage NOS recognizes an inducible enzyme in a wide variety of cells. Macrophages are the major site of iNOS expression in endotoxin-treated rats and show greatest staining between 6 and 9 hours after treatment. Although staining was not seen in vascular cells in vivo, levels of the enzyme that are below the immunocytochemistry detection limit cannot be excluded.
Nitric oxide (NO), exogenously administered or endogenously produced by NO synthase (NOS), is an important regulator of lung ventilation and perfusion in mammals. This study attempts to investigate the evolutionary history of this system in fish and its possible relationship to air breathing. The gas bladder of Hoplerythrinus unitaeniatus (air-breathing teleost) and Oncorhynchus mykiss (non-air-breathing teleost) and the lung of Lepidosiren paradoxa (air-breathing dipnoan) all exhibited elevated guanosine 3',5'-cyclic monophosphate (cGMP) levels in response to 1 microM sodium nitroprusside. Only the H. unitaeniatus gas bladder responded to 10 microM acetylcholine chloride (ACh) with increased cGMP levels. The ACh response was inhibited by N omega-nitro-L-arginine methyl ester, which inhibits NOS. These data suggest that although tissues from each species may respond to exogenous NO, only the gas bladder of H. unitaeniatus appears to synthesize NO through NOS. This is the first report of constitutive NOS outside of the central nervous system in a teleost. These results also imply that NOS did not necessarily coevolve with air breathing in fish.
Nitric oxide (NO)-dependent regulation of brain blood flow has not been proved to exist in fish or other ectothermic vertebrates. Using epi-illumination microscopy on the brain surface (optic lobes) of crucian carp (Carassius carassius), we show that superfusing the brain with acetylcholine (ACh) induces an increase in cerebral blood flow velocity that can be completely blocked by the NO synthase inhibitors NG-nitro-L-arginine methylester (L-NAME) and NG-nitro-L-arginine. Also, sodium nitroprusside, which decomposes to liberate NO, causes an increase in cerebral blood flow velocity. By contrast, L-NAME does not block the increase in blood flow velocity caused by anoxia. The results suggest that NO is an endogenous vasodilator in crucian carp brain that mediates the effects of ACh. Because teleost fish deviated from other vertebrates 400 million years ago, these results suggest that NO-dependent brain blood flow regulation was an early event in vertebrate evolution.
Nitric oxide (NO) is an intercellular messenger involved with various aspects of mammalian physiology ranging from vasodilation and macrophage cytotoxicity to neuronal transmission. NO is synthesized from L-arginine by NO synthase (NOS). Here, we report the cloning of a Drosophila NOS gene, dNOS, located at cytological position 32B. The dNOS cDNA encodes a protein of 152 kDa, with 43% amino acid sequence identity to rat neuronal NOS. Like mammalian NOSs, DNOS protein contains putative binding sites for calmodulin, FMN, FAD, and NADPH. DNOS activity is Ca2+/calmodulin dependent when expressed in cell culture. An alternative RNA splicing pattern also exists for dNOS, which is identical to that for vertebrate neuronal NOS. These structural and functional observations demonstrate remarkable conservation of NOS between vertebrates and invertebrates.
The neuroanatomical organization of neurons projecting to the pituitary and the origin of pituitary dopamine and nonapeptides were investigated in the brain of the Atlantic salmon (Salmo salar). Carbocyanine tract tracing in combination with tyrosine hydroxylase, arginine vasotocin and isotocin immunocytochemistry for double labelling revealed a previously unknown organization of hypophysiotrophic cell groups and their extrahypothalamic projections, and provide the first direct identification in a teleost fish of the origin of the dopaminergic and nonapeptidergic innervation of the pituitary. The present data include identification of (1) hypophysiotrophic neurons in the ventral telencephalon and in the periventricular preoptic nucleus, (2) large (magnocellular) vasotocinergic hypophysiotrophic neurons in the most rostral extension of the preoptic area, (3) a distinct neuronal group located in a supraoptic/suprachiasmatic position in the anterior periventricular nucleus, that seems to be the major source of dopaminergic innervation of the pituitary, (4) the nonapeptidergic hypophysiotrophic neurons in the preoptic nucleus, (5) hypophysiotrophic neurons in the ventral and posterior hypothalamus of which some are of liquor-contacting type, (6) projections from hypophysiotrophic and non-hypophysiotrophic neurons in the preoptic nucleus to extrahypothalamic areas such as thalamic and periventricular pretectal nuclei, and (7) subdivisions within the preoptic nucleus that exhibit different combinations of hypophysiotrophic and extrahypothalamic efferent connections. Together with previous studies of retinohypothalamic projections and neurochemical organization of hypothalamic/preoptic areas, the present data suggest that the preoptic nucleus and the anterior periventricular nucleus in teleosts possess functional subdivisions with features that resemble those of the paraventricular, supraoptic and suprachiasmatic nuclei of other vertebrates. In the Atlantic salmon, specific dopaminergic and nonapeptidergic neuronal subdivisions are proposed to play a role for photoperiod control of endocrine activity.
Complementary DNA clones corresponding to human brain nitric oxide (NO) synthase have been isolated. The deduced amino acid sequence revealed an overall identity with rat brain NO synthase of about 93% and contained all suggested consensus sites for binding of the co-factors. The cDNA transfected COS-1 cells showed significant NO synthase activity with the typical co-factor requirements. Unexpectedly, messenger RNA levels of this isoform of NO synthase was more abundant in human skeletal muscle than human brain. Moreover, we detected high NO synthase activity and the expressed protein in human skeletal muscle by Western blot analysis, indicating a possible novel function of NO in skeletal muscle.
Nitric oxide, a free radical, has recently been shown to exert major influences on CNS functions in mammals. It is synthesized by NO-synthase. For the first time, this study reveals this enzyme's existence in the CNS of a teleost fish and describes its distribution in the diencephalon, where the paraventricular organ displays an extraordinarily high activity. The study contributes to an evolutionary perspective of the biological role played by nitric oxide in the vertebrate CNS, and raises questions regarding the significance of this gas in cerebrospinal fluid-contacting neurons.
Polymerase chain reaction amplification of reverse transcribed RNA (RNA-PCR) was used to isolate overlapping cDNA clones encoding an inducible form of nitric oxide synthase (NOS) from purified rat hepatocytes. NOS gene expression in hepatocytes is dependent upon bacterial lipopolysaccharide (LPS) and cytokine treatment. The predicted amino acid sequence of rat hepatocyte inducible NOS is 94% identical with that from the mouse macrophage cell line, RAW264.7. Differences between the two sequences occur as sporadic amino acid substitutions with no major gaps or insertions. These differences are most likely the result of species variability which suggests that hepatocytes and macrophages express the same NOS gene upon induction.
Nitric oxide (NO), generated from L-arginine by an enzymatic reaction of a NO synthase (NOS; EC 1.14.23), is a recently identified biological mediator suggested to be involved in a wide variety of biological processes. In the present work, we isolated and sequenced the entire region of cDNAs encoding mouse neuronal NOS (n-NOS) and demonstrated structural diversity of n-NOS mRNA in the nervous system. Sequence determination revealed a novel mRNA with an inframe deletion in the middle of the n-NOS cDNA. Structural analysis of the corresponding part of the n-NOS gene indicated that the deletion corresponded exactly to two exons. These findings suggest that the variant n-NOS is formed by alternative splicing. Both n-NOSs were found in almost all parts of the nervous system, the expression level of the novel variant being about one twentieth of that of the known n-NOS. Generation of diversity of n-NOS is probably related to diversity of its biological functions.
Comparatively little is known about host-defense activities in the fish heart. Investigations showed that intraperitoneally injected carbon particles are actively taken up by the cardiac endothelial cells of the medaka Oryzias latipes, but less so by those of the goldfish Carassius auratus and lemon tetra Hyphessobrycon pulchripinnis. (In vitro experiments confirmed these species differences in endocytic activities by these cells.) Electron microscopy revealed that endothelial cells of the medaka atrium have large cytoplasm with many organelles, and ingested carbon particles were observed within phagosomes of cardiac endothelial cells even at 4 degrees C. Phagocytic cells, which apparently reside in the heart, were found in all the species examined. These cells were located on the endothelial cells and developed cytoplasmic processes extending toward the heart lumen and/or the intercellular spaces of the endothelial cells. The heart with its resident phagocytes is proposed to function as a host defense organ--at least in certain fish species.
Nitric oxide synthase is a useful maker for nitric oxide's scope. Localized by either NADPH-diaphorase histochemistry or immunohistochemical methods, most nitric oxide synthase activity in the normal heart is present in endothelium along the extensive network of arteries, veins and capillaries within myocardium. This endothelial isoform of nitric oxide synthase also exists in the endocardium lining the cavities. Neuronal nitric oxide synthase appears much less prominent, although the exact amount of this isoform in the heart is uncertain. Scattered nerves and ganglion cells are localized by the histochemical methods. While there is no inducible nitric oxide synthase in the normal heart, macrophages associated with repair following various forms of cardiac damage contain this isoform. For all nitric oxide synthases, however, species variation and variability among models underscore the importance of correlative studies of structure and function.
Nitric oxide (NO) dependent regulation of blood flow has hitherto not been demonstrated in rainbow trout or other salmonid fish. Through in vivo observations of the brain surface (optic lobes) of rainbow trout (Oncorhynchus mykiss) with epi-illumination microscopy, we show that application of acetylcholine (ACh) to the brain surface induces an increase in cerebral blood flow velocity that can be completely blocked by the NO synthase inhibitor NG-nitro-L-arginine. Also sodium nitroprusside, which decomposes to form NO, stimulated cerebral blood flow velocity. The results indicate that NO is a vasodilator in rainbow trout brain, mediating the effect of ACh.
The gas nitric oxide is now recognized as an important signalling molecule that is synthesized from L-arginine by the enzyme nitric oxide synthase. This enzyme can be localized by different methods, including immunocytochemistry and the histochemical reaction for NADPH diaphorase. It has been demonstrated in various vertebrate cells and tissues, and recently several studies dealing with the production of nitric oxide in invertebrates have been published. Diploblastic animals, flatworms and nematodes seem to lack NADPH diaphorase activity but it has been found in the rest of the phyla studied. The most frequently reported sites for the production of nitric oxide are the central and peripheral nervous systems and, in primitive molluscs, the muscle cells. In insects, it has also been described in the Malpighian tubules. The roles of nitric oxide in invertebrates are closely related to the physiological actions described in vertebrates, namely, neurotransmission, defence, and salt and water balance. The recent cloning of the first nitric oxide synthase from an invertebrate source could open interesting avenues for further studies.
The role of nitric oxide or related molecules as neuromodulators was investigated in the buccal and the abdominal ganglia of the mollusc Aplysia californica. In a first step we showed that reduced nicotinamide adenine dinucleotide phosphate-diaphorase histochemistry and specific nitric oxide synthase immunohistochemistry labelled the same neurons and fibres in both ganglia, pointing to the presence of a neuronal nitric oxide synthase. In a second step, we performed voltammetric detection of nitric oxide-related molecules using a microcarbon electrode in a reduction mode. A peak identified as N-nitroso-L-arginine was detected at -1.66 V in both ganglia. The identification of this compound as a product of endogenous nitric oxide synthase activity was reinforced by the fact that its peak amplitude was decreased in the presence of NG-monomethyl-L-arginine, an inhibitor of nitric oxide synthase, and increased with its substrate, L-arginine. An additional proof of a nitric oxide synthase activity was the detection of nitrites and nitrates in high concentrations (millimolar range) by capillary electrophoresis. We also showed that these nitric oxide-related molecules modulated acetylcholine release at two identified synapses in these ganglia. L-Arginine decreased acetylcholine release at the inhibitory synapse (buccal ganglion), whereas it increased acetylcholine release at the excitatory synapse (abdominal ganglion). The nitric oxide synthase inhibitors, N omega-nitro-L-arginine and NG-monomethyl-L-arginine, had opposite effects. Moreover, the exogenous nitric oxide donor, 3-morpholinosydnonimine hydrochloride mimicked the effects of L-arginine on both inhibitory and excitatory cholinergic synapses. The identification of two cholinergic synapses where nitric oxide affects acetylcholine release in opposite ways provides a useful tool to study the cellular mechanisms through which nitric oxide-related molecules modulate transmitter release.
There is increasing evidence that alterations in nitric oxide synthesis are of pathophysiological importance in heart failure. A number of studies have shown altered nitric oxide production by the endothelial constitutive isoform of nitric oxide synthase (NOS), but there is very little information on the role of the inducible isoform.
We analyzed inducible NOS (iNOS) expression in ventricular myocardium taken from 11 control subjects (who had died suddenly from noncardiac causes), from 10 donor hearts before implantation, and from 51 patients with heart failure (24 with dilated cardiomyopathy [DCM], 17 with ischemic heart disease [IHD], and 10 with valvular heart disease [VHD]). Reverse transcription-polymerase chain reaction was used to confirm the presence of intact mRNA and to detect expression of iNOS and atrial natriuretic peptide (ANP). ANP was used as a molecular phenotypic marker of ventricular failure. iNOS was expressed in 36 of 51 biopsies (71%) from patients with heart failure and in none of the control patients (P<.0001). iNOS expression could also be detected in 50% of the donor hearts. All samples that expressed iNOS also expressed ANP. iNOS gene expression occurred in 67% of patients with DCM, 59% of patients with IHD, and 100% of patients with VHD. To determine whether iNOS protein was expressed in failing ventricles, immunohistochemistry was performed on three donor hearts and nine failing hearts with iNOS mRNA expression. Staining for iNOS was almost undetectable in the donor myocardium and in control sections, but all failing hearts showed diffuse cytoplasmic staining in cardiac myocytes. Expression of iNOS could be observed in all four chambers. Western blot analysis with the same primary antibody showed a specific positive band for iNOS protein in the heart failure specimens; minimal iNOS protein expression was seen in donor heart samples.
iNOS expression occurs in failing human cardiac myocytes and may be involved in the pathophysiology of DCM, IHD, and VHD.
To determine a possible relationship between organismal and molecular evolution, the divergence patterns of gene families were examined by taking special notice of functional difference, tissue distribution, and intracellular localization of the members. A phylogenetic analysis of 25 different gene families revealed interesting patterns of divergence of these families: Most gene duplications giving rise to different functions antedate the vertebrates-arthropods separation. On the other hand, in a group of members carrying virtually identical function to one another but differing in tissue distribution (tissue-specific isoform), most gene duplications have occurred independently in each of vertebrates and arthropods after the separation of the two animal groups. In family members encoding molecules localizing in cell compartments (compartmentalized isoforms), the gene duplications antedate the animals-fungi separation. In the cases of the Ca2+ pump and rab subfamilies, the compartmentalized isoforms were shown to have diverged during the early evolution of eukaryotes. A phylogenetic analysis of the tissue-specific isoforms from 26 different subfamilies revealed extensive gene duplications and rapid rates of amino acid substitutions in the early evolution of chordates before the separation of fishes and tetrapods. On the contrary, the genetic variations are relatively low in the later period. This pattern of evolution observed at the molecular level is correlated well with that of tissue evolution based on fossil evidence and morphological data, and thus evolution at the two levels may be related.
Complementary DNA clones encoding mouse endothelial constitutive nitric oxide synthase (ecNOS) were isolated by plaque hybridization from a murine fetal cardiac lambda ZAP II cDNA expression library using a full-length human ecNOS cDNA as the hybridization probe. DNA sequence analysis indicates a 1202 amino acid protein showing significant sequence identity with human as well as bovine ecNOS.
Recent studies in our laboratory demonstrated that fish macrophages produce nitric oxide. To elucidate the mechanisms which regulate nitric oxide production in teleosts, we examined whether macrophage activating factors (MAFs) secreted by mitogen stimulated leukocytes, induced nitric oxide production in a long-term cultured macrophage cell line and in primary cultures of kidney macrophages from the goldfish. The results indicate that both primary and long term cultured goldfish macrophages produce nitric oxide in response to MAF or bacterial lipopolysaccharide (LPS), and co-stimulation with both factors results in a synergistic induction of nitric oxide production. MAF that induced nitric oxide production were present in leukocyte supernatants as early as 24 h after addition of mitogens to cell cultures. The production of MAF was dependent upon the incubation temperature, presence of serum in the culture medium and duration of incubation: maximal MAF activity was detected in 72-96 h supernatants raised in media with serum at 30 degrees C. MAF-induced nitric oxide production by long term cultured macrophages was inhibited by 1000 microM NG-monomethyl-L-arginine or amino-guanidine, indicating an L-arginine-dependent metabolic pathway for the production of the reactive nitrogen intermediates in teleosts. The biochemical events of cytokine induced nitric oxide production by teleost macrophages appear to be similar to those of mammalian macrophages.