Cyclin D1 gene polymorphism is associated with increased risk of urinary bladder cancer

ArticleinCarcinogenesis 23(2):257-64 · March 2002with9 Reads
DOI: 10.1093/carcin/23.2.257 · Source: PubMed
Abstract
Cyclin D1 is believed to play an important role in the genesis and/or progression of transitional cell cancer (TCC) of the urinary bladder. Cyclin D1 gene (CCND1) mRNA is alternatively spliced to produce two transcripts, and the splicing pattern may be modulated by a G to A single nucleotide polymorphism within the splice donor site of exon 4. This study was conducted to explore the association between the polymorphism and the susceptibility to and disease status of TCC of the bladder in 222 cases and 317 native Japanese controls. The relationship between the CCND1 polymorphism and the mRNA splicing pattern in TCC cells was evaluated by semi-quantitative reverse-transcription PCR. The CCND1 A allele was more frequently observed in the TCC group than the control group (P = 0.032) with a significant difference in the genotype frequency between the two groups (P = 0.029). The AA genotype was associated with a significantly higher risk of TCC compared with the AG+GG genotypes (adjusted odds ratio (aOR) = 1.76, 95% confidence interval (CI) = 1.09-2.84, P = 0.022). This association was observed more significantly in nonsmoking cases (aOR = 2.53; 95% CI = 1.28-4.51, P = 0.008). Looking at tumor grade, the presence of the A allele was associated with higher grade (= grade 3) tumors with a gene dosage effect (aOR = 1.77, CI = 1.16-2.69, P = 0.008). In tumor stage, although not significant, the AA + AG genotypes tended to be more frequently observed in cases with T1-4 tumors than those with Ta tumors (aOR = 1.94, 95% CI = 0.98-3.82, P = 0.057). The genotype seemed to influence the two alternatively spliced forms of the CCND1 mRNA because the ratio of the CCND1 transcript-b/transcript-a was significantly higher in cases with the AA genotype compared with those with the AG + GG genotypes. These data suggest that the CCND1 variant A allele may be associated with an increased risk of TCC of the bladder, especially in men without a history of smoking, and it may also have an effect on its disease status.
    • "The primers for analysis were [24]: Forward primer: 5´- GTGAAGTTCATTTCCAATCCGC-3´; Reverse primer: 5´GGGACATCACCCTCACTTAC 5´GGGACATCACCCTCACTTAC-3´(3´(QIAGEN, Germany) to amplify a 167-bp fragment. The PCR reaction was performed according to the method of Wang et al. [24]. For RFLP analysis, each PCR product (10 µl) was subjected to 2 units of ScrF1 restriction enzyme (New England, BioLabs Inc, UK) at 37ºC for 1 hour and separated by electrophoresis on 2% agarose gel containing 0.5 mg/ml ethidium bromide and the bands on the gel were visualized using UV Transilluminator. "
    [Show abstract] [Hide abstract] ABSTRACT: Aim: To investigate the influence of the polymorphic variants of CCND1 (G870A) and p73 (G4C14- to- A4T14) on the susceptibility to breast cancer development, also, to figure out their diagnostic and prognostic roles.Subjects and Methods: Blood samples were obtained from breast cancer patients and controls. Genotyping of CCND1 and p73 genes were carried out by PCR-RFLP and PCR-CTPP; respectively.Results: In comparison with the control group, CCND1 (G870A) GA and AA genotypes frequencies were significantly higher in breast cancer patients (p=0.035 and p=0.002; respectively), whereas CCND1 (G870A) GG genotype frequency was significantly lower (p< 0.001). The CCND1 GA and AA genotypes significantly increased the risk for developing breast cancer compared with the GG genotype. The CCND1 (GA+AA) genotypes were significantly correlated with disease-free survival (DFS) of breast cancer patients. In comparison with the control group, p73 (G4C14/A4T14) GC/AT and AT/AT genotypes frequencies were significantly higher in breast cancer patients (p=0.013 and p=0.04; respectively), whereas p73 (G4C14/A4T14) GC/GC genotype frequency was significantly lower (p= 0.004). Compared with the GC/GC genotype, the p73 GC/AT and AT/AT genotypes significantly increased the risk for developing breast cancer. Beside being significantly correlated with DFS, p73 [(GC/AT)+ (AT/AT)] genotypes were indirectly correlated with tumor size, tumor pathological grade, patient's clinical stage, number of axillary lymph node involvement and Her2/neu expression.Conclusion: The GA and AA genotypes of CCND1 (G870A) polymorphism and the GC/AT and AT/AT genotypes of p73 (G4C14- to- A4T14) polymorphism can be used as diagnostic markers in breast cancer patients. The presence of the CCND1 (G870A) GA and AA genotypes and the GC/AT and AT/AT genotypes of p73 (G4C14- to- A4T14) polymorphism can increase the susceptibility to breast cancer incidence. Both of CCND1 (G870A) and p73 (G4C14- to- A4T14) polymorphisms can be used for prognosis of breast cancer patients.
    Article · May 2016
    • "Most genes preventing genome instability and the genes regulating cell proliferation are polymorphic in the human population, with common variants with low penetrance which may affect cancer susceptibility. In particular, polymorphisms of TP53, p21 and cyclin D1 have been associated with increased susceptibility/poor prognosis of breast cancer (Powell et al., 2002), cancer of the urinary bladder (Wang et al., 2002) and lung cancer (Qiuling et al., 2003), all with odds ratios of 2 to 3. After in vitro treatment of blood cells from healthy subjects with genotoxic agents a variation in response in a range of around an order of magnitude has been reported (Gu et al., 1999), but the contributions of individual variant alleles of DNA repair genes is modest, less than two-fold although the impact of low penetrance polymorphisms may theoretically be barely detectable (Mohrenweiser et al., 2003). "
    [Show abstract] [Hide abstract] ABSTRACT: The pollution levels of typical semivolatile organic compounds (SVOCs) consisting of 15 polycyclic aromatic hydrocarbons (PAHs), 20 organic chlorinated pesticides (OCPs), and 15 phthalate esters (PAEs) were investigated in small rivers running through the flourishing cities in Pearl River Delta region, China. The concentrations of ∑15PAHs were 2.0-48 ng/L and 29-1.2 × 10(3) ng/g in the water and sediment samples, respectively. The ∑20OCPs were 6.6-57 ng/L and 9.3-6.0 × 10(2) ng/g in the water and sediment samples, respectively. The concentrations of ∑15PAEs were much higher both in the water and sediments. The partition process of the detected SVOCs between the water and sediment did not reach the equilibrium state at most of the sites when sampling. The combustion of petroleum products and coal was the major source of the detected PAHs. The OCPs were mainly historical residue, whereas the new inputs of dichlorodiphenyltrichloroethane (DDT), chlordane, and endosulfan were possible at several sites. The industrial and domestic sewage were the major source for the PAEs; storm water runoff accelerated the input of PAEs. No chronic risk of the SVOCs was identified by a health risk assessment through daily water consumption, except for the ∑20OCPs that might cause cancer at several sites. Nevertheless, the integrated health risk of the SVOCs should not be neglected and need intensive investigations.
    Full-text · Article · May 2014
    • "Cyclin D1 is required for the regulation and control of cell proliferation and transcription (Chen et al., 2012). Several studies and researches have recognized a correlation between the CCND1 870A allele and an increased cancer risk, including bladder , prostate ,liver and breast cancer (Wang et al., 2002; Wang et al., 2003; Akkiz et al., 2010; Canbay et al., 2010). Till now a number of studies have reported for the role of the CCND1 G870A polymorphism in cancer risk.Table 1. Statistics for Missense and Nonsense Mutation (Source-http://www.hgmd.cf.ac.uk/ac/hoho1.php).Table 2. Table for nonsense mutations (Source-http://www.hgmd.cf.ac.uk/ac/hoho1.php). "
    [Show abstract] [Hide abstract] ABSTRACT: Single nucleotide polymorphism (SNP) is single base variation either in A, T, C or G in sequences and may leads to change of particular phenotype or can cause disease or work as a precursor for disease. Recently, it has been suggested that SNP may be used to identify and map complex disease such as cancer. Matrix metalloproteinase-1 (MMP1) gene encodes a proteolytic enzyme that regulates numbers of cell behaviors related to physiochemical pathway of cancer via their basic role of degradation of proteins. SEPS1 encodes a selenoprotein which contains a selenocysteine (Sec) residue at its active binding sites. Cyclin-D transcript is a component of the cyclin protein family which is involved in regulating cell cycle progression. The synthesis of cyclin-D is initiated during G1 of cell cycle. In many human cancers result due to errors in cell cycle regulation and in growth factor dependent intracellular pathways. We find out that in all cases the single base change as compared with normal sequences occurs at position of 16 th , 2 nd and 169 th in the sequence with PDB ID-1CGE, 3RW9 and 2W9Z respectively may leads to the cause of disease and could modify the level of MMP-, SEPS-1 and CCND-1 expression and might be a factor for tumor development and cancer. Although these results have provided insight into the temperament of human sequence variation and its relation to disease, yet these variants may offer a starting point for further inquiry. The aim of this study is to assess the effects of the single nucleotide polymorphisms (SNPs) in cancer causing gene.
    Full-text · Article · Jun 2013
Show more