Novel Approach to the Improvement of Biphenyl and Polychlorinated Biphenyl Degradation Activity: Promoter Implantation by Homologous Recombination

Article (PDF Available)inApplied and Environmental Microbiology 69(1):146-53 · February 2003with13 Reads
DOI: 10.1128/AEM.69.1.146-153.2003 · Source: PubMed
Abstract
To improve the capabilities of microorganisms relevant for biodegradation, we developed a new genetic approach and applied it to the bph operon (bphEGF[orf4]A1A2A3CD[orf1]A4R) of Pseudomonas sp. strain KKS102 to enhance its biphenyl- and polychlorinated biphenyl (PCB)-degrading activity. A native promoter of the bph operon, which was under control, was replaced through homologous recombination by a series of promoters that had constitutive activity. By testing a series of promoters with various strengths, we were able to obtain strains that have enhanced degradation activity for biphenyl and PCBs. This strategy removes the rate-limiting factor associated with transcription and has the potential to improve the degradation activity of a wide variety of microorganisms involved in biodegradation.

Figures

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Jan. 2003, p. 146–153 Vol. 69, No. 1
0099-2240/03/$08.000 DOI: 10.1128/AEM.69.1.146–153.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Novel Approach to the Improvement of Biphenyl and Polychlorinated
Biphenyl Degradation Activity: Promoter Implantation by
Homologous Recombination
Yoshiyuki Ohtsubo,
1,2
* Minoru Shimura,
3
Mina Delawary,
1
Kazuhide Kimbara,
3
Masamichi Takagi,
1
Toshiaki Kudo,
2
Akinori Ohta,
1
and Yuji Nagata
4
Department of Biotechnology, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657,
1
Molecular Microbial Ecology
Division, RIKEN, Hirosawa 2-1, Wako, Saitama 351-0198,
2
Railway Technical Research Institute, Kokubunji-shi, Tokyo
185-8540,
3
and Graduate School of Life Sciences, Tohoku University, Katahira, Sendai 980-8577,
4
Japan
Received 5 August 2002/Accepted 28 October 2002
To improve the capabilities of microorganisms relevant for biodegradation, we developed a new genetic
approach and applied it to the bph operon (bphEGF[orf4]A1A2A3CD[orf1]A4R)ofPseudomonas sp. strain
KKS102 to enhance its biphenyl- and polychlorinated biphenyl (PCB)-degrading activity. A native promoter of
the bph operon, which was under control, was replaced through homologous recombination by a series of
promoters that had constitutive activity. By testing a series of promoters with various strengths, we were able
to obtain strains that have enhanced degradation activity for biphenyl and PCBs. This strategy removes the
rate-limiting factor associated with transcription and has the potential to improve the degradation activity of
a wide variety of microorganisms involved in biodegradation.
The use of microbial metabolic potential for elimination of
environmental pollutants is a promising technology. Although
various factors such as pathway enzyme specificity, substrate
availability, incomplete degradation pathways, and the tran-
scription and translation of genes for bioconversion can limit
efficient biodegradation, genetic engineering can be used to
overcome such factors and improve degradation (3, 9, 20, 22,
30).
Among pollutants, polychlorinated biphenyls (PCBs) are the
most serious pollutants, and their degradation by microorgan-
isms has been studied extensively (9, 10). Pseudomonas sp.
strain KKS102 is one of the well-characterized PCB and bi-
phenyl degraders, and its bph gene organization, catabolic
route, and regulatory mechanisms have been characterized.
The bph genes are organized into an operon in the following
order: bphEGF(orf4)A1A2A3CD(orf1)A4R (8, 13–15). The
transcription of the bph operon is dependent on the pE pro-
moter, which is located upstream of the bphE gene and is
controlled by a negative regulator, BphS. The bphS gene is
divergently orientated upstream of bphE and is separated from
bphE by an insertion sequence (17). The repression mediated
by BphS protein is counteracted by a meta-cleaved intermedi-
ate of biphenyl degradation (17, 18).
It is generally recognized that microorganisms can be genet-
ically engineered to increase the rate of pollutant removal. The
design of improved microorganisms includes various optimiza-
tion strategies among which altering the level of transcription
is a good target. In general, genes encoding catalytic activities
are organized into an operon and transcription of the operon
is under the control of activator(s) (6). Various efforts have
been made to increase the level of transcription, e.g., creation
of mutant regulators that mediate a higher level of transcrip-
tion or recognize new substrates (2, 19, 21) and construction of
plasmids or transposons that carry degradative genes under the
control of constitutive promoters (11, 16). The transcription
level should be optimized through trials with a series of pro-
moters of different strengths if we are to exclude the rate-
limiting steps associated with transcription. It can be expected
that application of too strong a promoter results in a decline of
overall degradation performance due to the energetic burden.
In addition, once transcription reaches a threshold level, a
further increase in transcription seems to be of no use, because
other limitations such as translation efficiency or availability of
the substrates become increasingly more important.
In this study, we developed a novel strategy to increase and
optimize the level of transcription. This strategy is applicable
without a detailed knowledge of the regulatory mechanisms
controlling the transcription and does not involve the laborious
task of handling large DNA fragments harboring entire deg-
radation operons. This strategy is based on the integration of a
series of constitutive promoters in front of the degradative
operon through homologous recombination. We demonstrated
the effectiveness of the strategy by enhancing the activity of the
PCB and biphenyl degrader KKS102.
MATERIALS AND METHODS
Bacterial strains and growth conditions. Pseudomonas sp. strain KKS102 and
its derivative strains were cultivated in 1/3 Luria-Bertani (LB) medium (0.3%
tryptone, 0.16% yeast extract, 0.5% NaCl) at 30°C. In the experiment addressing
catabolite control, sodium succinate was added to 1/3 LB medium at a final
concentration of 25 mM. Antibiotics chloramphenicol and kanamycin were used
at a final concentration of 25 g/ml each. Details regarding the bphS gene
disruptant (KKSS) are available from reference 7.
Construction of promoters. Promoter DNAs were prepared either syntheti-
cally (ptac,prrnB, and pEcoli promoters) or by PCR amplification (pEcore
* Corresponding author. Mailing address: Molecular Microbial
Ecology Division, RIKEN (The Institute of Physical and Chemical
Research), Hirosawa 2-1, Wako, Saitama 351-0198, Japan. Phone:
81-48-467-9544. Fax: 81-48-462-4672. E-mail: yohtsubo@postman-
.riken.go.jp.
146
promoter). The DNA sequences of ptac and prrnB promoters were obtained
from references 1 and 4, respectively. The DNA sequence of pEcoli promoter is
GAATTCGGCTCGAAAATTTTTTTTCAAAACTAGTTGACAAAAAATTA
TGATGCATATATAATCTAGA, which has a conserved Escherichia coli 10
box and a 35 box (underlined), as well as a UP element consensus described in
references 7 and 23. The pEcore promoter sequence is GAATTCGGATCCGA
GTGAAGTGAGTGAAACATAGGGTTTTCACGAGTGTTTAAAAATTAT
GGCATGCATATAATCTAGTCGACAGATCTGGTCTAGA (17), which con-
sists of promoter elements of pE promoter but lacks binding sites of the negative
regulator, BphS. EcoRI and XbaI restriction sites for further use were arranged
to ank each promoter sequence (shown in italics).
Assessment of promoter activity. The promoters were cloned into a vector
pKLZ-Z creating promoter-lacZ reporter transcriptional fusions. pKLZ-Z is a
derivative of pKLZ-A (17) and differs in multicloning sites. The promoter-lacZ
fusion constructs were integrated into the genome of KKS102 as described
previously (17).
Plasmid for promoter integration. pKH966 (see Fig. 2) contains two DNA
segments for double-crossover allelic DNA exchange (upstream and downstream
of the pE promoter, positions 1284 to 400 and 242 to 3; 1 represents the
translation initiation site of bphE). These regions were PCR amplied with a set
of primers tagged with appropriate restriction sites. A DNA cassette harboring
the kanamycin resistance gene and a multicloning site derived from pKLZ-Z is
encompassed by these two regions.
Integration of the promoter sequence at upstream region of bphE. The pro-
moter DNA sequence was ligated in the multicloning site of pKH966, and the
resulting plasmid was linearized by digesting within the vector DNA sequence.
The DNA was introduced into KKS102 by electrotransformation. The conditions
for electrotransformation were as described previously (18). The kanamycin-
resistant clones were obtained, and PCR amplication with an appropriate set of
primers was performed to conrm the double-crossover homologous recombi-
nation.
Assay of BphD activity. The assay of BphD (2-hydroxy-6-oxo-6-phenylhexa-
2,4-dienoic acid hydrolase) activity was performed as described previously (17).
In brief, cell extract was prepared and a HOPDA (2-hydroxy-6-oxo-6-phenyl-
hexa-2,4-dienoic acid) solution was added. The decrease in absorbance at 434 nm
was recorded. We dened1UofBphD activity as the activity converting 1 nmol
of HOPDA per min. A molar extinction coefcient of 19,800 (26) for HOPDA
was used to calculate the BphD activity. The activity was normalized by protein
amount in the cell extract. The protein amount in the cell extract was measured
by a protein assay kit (Bio-Rad) with bovine serum albumin as a standard.
Assay of LacZ activity. Cells were collected by centrifugation and resuspended
in Z buffer (60 mM Na
2
HPO
4
,40mMNaH
2
PO
4
, 10 mM KCl, 1 mM MgSO
4
,50
mM -mercaptoethanol). After disrupting cells by sonication, samples were
centrifuged and the LacZ activity in the supernatant (cell extract) was measured.
To cell extract, the same volume of o-nitrophenyl--
D-galactopyranoside solution
(4 mg/ml in Z buffer) was added. After incubation at 37°C, 1/4 volume of Na
2
CO
3
(1 M) was added to terminate the reaction. The amount of o-nitrophenol pro-
duced was measured spectrophotometrically at an optical density at 420 nm
(OD
420
). We dened 1 unit of LacZ activity as that which generates 1 nmol of
o-nitrophenol per min. The activity was normalized by the amount of protein in
the cell extract. The amount of protein in the cell extract was measured by a
protein assay kit (Bio-Rad) with bovine serum albumin as a standard.
Northern blot analysis. The total RNA was isolated by using RNA purication
kit ISOGEN (NIPPON GENE, Tokyo, Japan). The total RNA was electropho-
resed through agarose gel containing formaldehyde and blotted onto nylon
membrane. The blot was hybridized with digoxigenin (DIG)-labeled DNA, and
a detection system for DIG-labeled probe was used according to the protocol
provided (Roche Diagnostics). The 0.9-kb EcoT22I-KpnI fragment was used to
generate the bphE probe.
Biphenyl degradation activity analysis. To examine the biphenyl degrading
activity, strains were grown in 5 ml of 1/3 LB medium. The cells were grown to
the stationary phase (OD
600
of 1.2). To 390 l of the culture, 10 l of a biphenyl
solution (10 mg/ml in ethanol) was added. The samples were incubated at room
temperature with vigorous shaking. At each time point, samples were extracted
by 1 ml of ethyl acetate containing naphthalene (5 ppm) as an internal standard
for gas chromatography-mass spectrometer (GC-MS) analysis. After centrifuga-
tion, the ethyl acetate layer was analyzed by GC-MS.
PCB degradation activity analysis. Bacteria were grown in 100 ml of 1/3 LB
medium supplemented with biphenyl to an OD
660
of 0.75. Kanechlor 300 was
added at a nal concentration of 10 mg/liter. As a negative control, heat-inacti-
vated KKS102 cells were used. After 24 h of incubation, the 5-ml aliquot was
extracted by ethyl acetate. PCBs recovered in the ethyl acetate layer were ana-
lyzed by GC-MS, as described previously (27). The percent degradation was
calculated in comparison to heat-inactivated cells. In the calculations, 2,3,6,3,4-
pentachlorobiphenyl, which is one of the most stable isomers, was selected as an
internal standard.
RESULTS
Assessment of promoter strength. Various approaches have
been developed to genetically modify microorganisms to con-
fer the desired biodegradation performance. In this study, our
strategy to improve the biodegradation activity of microorgan-
isms was to implant a promoter at the upstream region of a
target operon. The bph operon involved in biphenyl and PCB
degradation in Pseudomonas sp. strain KKS102 was selected as
a target operon. The transcription of the operon is dependent
on the pE promoter, which is located upstream of the bphE
gene and regulated by a negative regulator, BphS (17).
Since we did not know what degree of transcription strength
would give the maximum degradation efciency, four different
promoter DNA sequences were prepared either synthetically
or by PCR amplication (Table 1). The pEcoli promoter was
designed according to the consensus DNA sequence of pro-
moter elements (10 box, 35 box, and UP element). The
ptac promoter is a promoter often used to overexpress genes in
E. coli (1). prrnB is a strong promoter in E. coli for ribosomal
gene transcription (4). pEcore is a core region of pE promoter
and lacks BphS binding sites.
To evaluate promoter activity in KKS102, each promoter
was fused with lacZ gene, and the fusion construct was inte-
grated, as a single copy, into the genome of KKS102. To com-
pare the activity of the constitutive promoters with that of the
native promoter of bph genes, the activity of pE promoter was
measured as a control. The promoter-lacZ reporter strains
were grown in liquid culture, and LacZ activity was measured
at mid-log phase (OD
660
0.5), late log phase (OD
660
1.0),
and stationary phase (24 h after OD
660
reached 0.5) (Fig. 1).
In
the pE-lacZ fusion strain, LacZ activity was 3.3-fold higher in
the presence of biphenyl than in its absence. A negative reg-
TABLE 1. Strains used in this study
Strain Promoter Relevant characteristics of the promoter or strain
Promoter-lacZ
fusion strain
Source or
reference
KH952 pEcoli Consensus E. coli promoter KLZ952 This study
KH967 prrnB Promoter for rRNA transcription KLZ401 4
KH968 ptac Promoter often used for overexpression in E. coli KLZ301 1
KH981 pEcore Core part of pE promoter KLZ201 This study
KKS102 pE pE promoter with operator sites for the negative regulator KLZ12 17
KKSSpE bphS gene-inactivated derivative of KKS102 17
V
OL. 69, 2003 IMPROVING BIPHENYL AND PCB BIPHENYL DEGRADATION 147
ulator, BphS, mediates this inducible expression of the pE
promoter (17). As shown in Fig. 1, LacZ activity of all four
promoters was higher than that of the pE promoter in every
growth phase tested. The ptac and prrnB promoters showed
activities 4.4- to 15.1-fold higher than that of the pE promoter.
The pEcore promoter showed activity 2.0- to 4.7-fold higher,
and pEcoli promoter showed activity 1.0- to 2.6-fold higher
than that of the pE promoter. The promoters tested differed from
the native pE promoter in that they showed the same level of
LacZ activity even in the absence of biphenyl (data not shown).
Construction of a bph constitutive strain by homologous
recombination. The strategy used to implant the promoter is
shown in Fig. 2. The fundamental scheme of the strategy lies in
the implantation of the promoter through double allelic ho-
mologous recombination by using the kanamycin resistance
gene as a selection marker. To implant several promoters eas-
ily, we constructed a key plasmid, pKH966. The plasmid con-
tains two DNA regions derived from the bphE upstream region
(upstream and downstream of the pE promoter, 1284 to
400 and 242 to 3; 1 represents the translation initiation
site of bphE) and the kanamycin resistance gene and a set of
restriction sites to clone promoter DNA. pKH966 was digested
by endonucleases, and each promoter DNA was cloned into
the cleaved sites. The resulting plasmid was linearized by en-
donuclease digestion within vector DNA. KKS102 cells were
transformed with the digested DNA by electroporation. Colo-
nies grown on kanamycin-containing media were selected, and
a homologous recombination event at the bphE upstream re-
gion was conrmed by PCR (data not shown).
Assessment of the strains by BphD activity. The bphD gene
encoding BphD is located relatively downstream of the bph
operon; thus, BphD activity could represent the expression
level of the entire bph operon (17). We measured the BphD
activity of the recombinant strains to assess the effect of the
implanted promoters. As a control, we included strain KKSS,
which is a KKS derivative that constitutively expresses bph
genes due to inactivation of the bphS gene (17). The strains
were grown in liquid culture (1/3 LB medium) until the tur-
bidity of the culture at 600 nm reached a value of 1.2 (station-
ary phase). We selected the stationary phase because it is
believed that the stationary phase is the prevailing status of
microorganisms under natural environmental conditions (24,
29). Cells were harvested, and BphD activity in cell extract was
measured as described in Materials and Methods. The result is
shown in Fig. 3A. Compared to the control strain KKSS,
KH967 and KH981 showed 1.9-fold-higher activity, KH968
showed 1.6-fold-activity, and KH952 showed comparable but
higher activity.
We also measured BphD activity of the strains grown in
minimum medium (W medium) supplemented with 25 mM
glucose and a trace amount of Casamino Acids (0.02%). We
observed a higher activity than that of strains grown in 1/3 LB
medium, but the overall activity pattern was conserved (data
not shown).
FIG. 1. Assessment of the promoters used in this study by LacZ activity. Each strain harboring the promoter-lacZ fusion reporter construct in
its chromosome was grown in liquid culture in the presence or absence of biphenyl. Cells were harvested at mid-log phase, late log phase, and
stationary phase. LacZ activity in cell extract was assayed. The activity was normalized by the amount of protein in the reaction mixture. The results
shown represent two independent experiments.
148 OHTSUBO ET AL. A
PPL.ENVIRON.MICROBIOL.
Catabolite-repressive effect of succinate on promoter activ-
ity. Recently, we found that expression of bph operon is down
regulated by certain carbon sources. We tested the effect of
one of the repressive carbon sources, succinate, on BphD ac-
tivity. The strains were grown in 1/3 LB medium containing
succinate (25 mM) for 24 h (stationary phase), and BphD
activity was measured (Fig. 3B). The BphD activity of KKSS
was more severely down regulated by the presence of succinate
than were the activities of the other strains implanted with
articial promoters.
Assessment of the strains by Northern blot analysis. To
assess the functionality of each promoter to drive transcription
of bph operon, and to correlate the level of BphD activity with
the level of bph transcription, the level of bphE transcription
was analyzed by Northern blot analysis. Total RNA was pre-
pared from each strain at the stationary phase, electropho-
resed through agarose gel, blotted onto a membrane, and hy-
bridized with bphE probe (Fig. 4A). The experiment was
repeated three times, and the signal intensity relative to that of
KKSDS was calculated (Fig. 4B). The overall hybridization
signal was correlated to BphD activity.
Assessment of the strains by biphenyl degradation activity.
We measured the biphenyl degradation activity of the engi-
neered strains. Each strain was grown in 5 ml of 1/3 LB me-
dium until the turbidity at 600 nm reached a value of 1.2
(stationary phase). The culture was divided into several test
FIG. 2. Strategy for systematic integration of promoters. A master plasmid, pKH966, has two DNA regions for homologous recombination
(shaded regions), a kanamycin resistance gene (white arrow), a transcriptional terminator (black arrow), and a cloning site. Each promoter
sequence was inserted into EcoRI and XbaI sites of pKH966. A HindIII-BamHI DNA fragment of the resulting plasmid was prepared and
introduced into KKS102 by electroporation. The cells are plated onto medium containing kanamycin. Double-crossover allelic exchange is expected
to replace the native pE promoter with a constitutive promoter.
V
OL. 69, 2003 IMPROVING BIPHENYL AND PCB BIPHENYL DEGRADATION 149
tubes, and to each tube biphenyl was added at a nal concen-
tration of 250 mg/liter. After 30, 60, and 120 min of vigorous
shaking at room temperature, residual biphenyl was quantied
by GC-MS analysis (Fig. 5A). All the engineered strains de-
graded most of the biphenyl within 60 min. In contrast, the
KKS102 cells degraded biphenyl only slightly in the experimen-
tal period. The higher biphenyl degradation activity of the
engineered strains grown even in the absence of biphenyl em-
phasizes the advantage of the strategy.
To better characterize the biphenyl degradation activity of
each strain, biphenyl degradation within the initial 15 min was
investigated in more detail (Fig. 5B). To note, biphenyl deg-
radation activity was not correlated with BphD activity. The
strains KH967, KH968, and KH981 showed the same level of
biphenyl degradation activity. This observation shows that, as
long as biphenyl is the substrate to be degraded, the level of
transcription in KH968 is high enough and further increase in
transcription is of no use because it is no longer a rate-limiting
factor.
Assessment of the strains by PCB-degrading activity. We
measured the PCB-degrading activities of KH952 and
KKS102. Strains were grown in liquid culture in the presence
of biphenyl, and at mid-log phase Kanechlor 300 was added at
a nal concentration of 10 mg/liter. As a control, heat-inacti-
vated KKS102 cells were used. After 24 h of incubation, PCBs
were extracted by ethyl acetate and residual amount of PCBs
were analyzed by GC-MS. The degradation activity of KH952
to all isomers was superior to that of KKS102 (Table 2). We
noted that degradation activity was greatly enhanced toward
FIG. 3. Assessment of created strains by BphD activity. (A) Strains
were grown in liquid culture in 1/3 LB medium. Cells were harvested
at the stationary phase, and BphD activity in the cell extract was
assayed. The activity was normalized by the amount of protein in the
reaction mixture. Each bar represents the average of three parallel
experiments, and vertical lines represent standard deviations.
(B) Strains were grown in 1/3 LB medium supplemented with 25 mM
sodium succinate for 24 h. BphD activity in the cell extract was assayed.
The results shown represent two independent experiments, and the
values are averages of duplicate measurements.
FIG. 4. Assessment of created strains by Northern blot analysis.
(A) Each strain was grown in 1/3 LB medium to the stationary phase,
and total RNA was prepared. Three micrograms of total RNA was
electrophoresed through agarose gel containing formaldehyde and
blotted onto a nylon membrane. The blot was hybridized with DIG-
labeled bphE probe. For signal detection, CDP star was used as a
substrate for chemical luminescence. The results shown represent
three independent experiments. (B) The signal intensity of the blot was
quantied by using Image Gauge ver. 3.1 software (Fuji Photo Film,
Tokyo, Japan). The signal intensity relative to that of KKSS was
calculated. Each bar represents the average of three independent ex-
periments, and vertical lines represent standard deviations
150 OHTSUBO ET AL. APPL.ENVIRON.MICROBIOL.
several isomers, e.g., 2,5,4-, 2,4,5,4-, and 2,3,4,3,4-chlorobi-
phenyl. Of signicance was the fact that KH952 degraded some
isomers that were hardly degraded by KKS102, for example,
2,4,3,4-, 3,4,3,4-, and 3,4,5,2,5-chlorobiphenyls. However,
the reasons for this unexpected expansion of substrate speci-
city remain to be elucidated.
DISCUSSION
In this work we demonstrated the effectiveness of implanting
a promoter to enhance degradation activity. The constructed
strains expressed the bph operon at high levels not only in the
absence of the pathway substrate but also in the presence of a
repressive carbon source. We also demonstrated that a certain
level of expression yields the highest degradation performance.
Transcription of the genes that encode a metabolic pathway
is thought to be one of the bottlenecks which limit pollutant
removal. In many cases, transcription of the metabolic genes is
under the control of regulatory mechanisms and active tran-
scription requires a sufcient concentration of cognate effector
molecule(s). Moreover, transcription of the degradative genes
is often under the control of catabolite repression that re-
presses transcription in the presence of a favorable carbon
source where the microorganism can grow rapidly (6). The
transcription of degradative genes is an important step in ca-
tabolism and hence a signicant event if we are to use the
catabolic potential. Thus, transcription is a good target in ef-
forts to improve the efciency of degradation.
Strains KH967, KH968, and KH981 showed different BphD
activities (Fig. 3A), while they showed the same level of biphe-
nyl-degrading activity (Fig. 5). This indicates that transcription
was no longer a rate-limiting step for biphenyl degradation in
these strains. Presumably, other steps such as supplying the
FIG. 5. Assessment of created strains by biphenyl degradation ac-
tivity. Strains were cultivated in 1/3 LB medium to the stationary
phase. The portions of each culture were transferred to test tubes. To
the tubes, biphenyl was added at a nal concentration of 250 mg/liter.
The tubes were incubated at room temperature with vigorous shaking.
At several time points, ethyl acetate was added to the tube and residual
biphenyl was extracted. The amount of biphenyl in the ethyl acetate
was analyzed by GC-MS. The cell-free 1/3 LB medium was used as a
control. (A) Cells and biphenyl were reacted for 30, 60, and 120 min.
The values are the averages of two parallel samples. (B) Cells and
biphenyl were incubated for 15 min. Each bar represents the average
of four parallel experiments, and vertical lines represent standard
deviations.
TABLE 2. PCB-degrading activity of KKS102 and KH952
Congener
% Degradation by strain:
KKS102 KH952
2,2,2,6 71.7 97.9
2,3 2,4 99.6 99.6
3,4 16.7 70.0
4,4 85.5 97.5
2,6,2 26.6 55.0
2,5,2 16.4 69.2
2,4,2 19.3 83.7
2,6,3 2,3,6 59.3 100.0
2,3,2 2,6,4 27.3 75.2
2,5,3 36.7 93.7
2,4,3 100.0 100.0
2,5,4 3.2 69.3
2,4,4 100.0 100.0
3,4,2 2,3,3 2,3,4 64.9 97.7
2,3,4 96.5 97.9
3,4,4 45.4 94.3
2,5,2,6 0.0 17.4
2,4,2,6 0.0 13.2
2,3,6,2 0.0 13.2
2,6,3,5 2,5,2,5 0.0 8.9
2,4,2,5 0.0 15.0
2,4,2,4 2,4,5,2 2,4,6,4 0.0 10.4
2,3,2,5 0.0 0.0
2,3,2,4 2,3,6,3 0.0 49.5
2,6,3,4 2,3,4,2 2,3,6,4 2,5,3,5 0.0 10.7
2,3,2,3 19.2 87.1
2,3,5,3 2,4,5,3 39.8 100.0
2,3,5,4 2,3,3,5 4.7 71.9
2,4,5,4 1.8 61.3
2,5,3,4 3,4,5,2 0.0 17.3
2,4,3,4 0.0 55.3
2,3,4,3 67.2 100.0
2,3,3,4 2,3,4,4 55.0 92.5
3,4,3,4 0.0 26.6
2,4,5,2,6 2,3,6,2,5 0.0 0.0
2,3,6,2,4 0.0 1.7
2,4,5,2,5 2,3,5,2,4 0.0 2.4
2,4,5,2,4 0.0 5.6
2,4,5,2,3 2,3,4,5,2 0.0 8.9
2,3,4,2,5 2,3,4,6,4 2,3,5,3,5 0.0 1.6
2,3,4,2,4 0.0 0.5
2,3,6,3,4
a
0.0 0.0
3,4,5,2,5 0.0 11.5
2,4,5,3,4 2,3,4,5,3 0.0 14.1
2,3,4,34 6.7 43.8
a
2,3,6,3,4-pentachlorobiphenyl was used as an internal standard.
VOL. 69, 2003 IMPROVING BIPHENYL AND PCB BIPHENYL DEGRADATION 151
oxygen and/or NADH necessary for degradation, bioavailabil-
ity of the substrates (28), and translation efciency could now
be rate-limiting factors. It could be postulated that the ptac
promoter (KH968) was strong enough and that promoters with
higher activity might not be suitable, because their use could
lead to, for example, energy expenditure and instability of the
genetic information. Although the reason was not clear, the
presence of biphenyl at the onset of cultivation impaired the
growth of strain KH967, which showed the highest BphD ac-
tivity (data not shown). These observations suggest that the use
of a strong promoter does not always give the desirable strain
and that trials of different promoters are necessary to optimize
degradation.
Implanting of a constitutive promoter was demonstrated to
be effective for the creation of microorganisms with high deg-
radation activity. This strategy is practical for a number of
reasons. First, the strategy could be applicable to a wide variety
of microorganisms relevant for biodegradation without need-
ing to know how the transcription of the degradative operon is
regulated. Second, the DNA element on a chromosome would
be maintained more stably than on a plasmid and seems to be
less likely to transfer horizontally (5), reducing the risk of
dispersal of human-derived genetic information into nature.
Third, implanting leads to constitutive expression. Thus, we do
not have to add inducing chemicals or take catabolite control
into consideration to maintain the expression level (Fig. 3B)
(6). This advantage is pronounced in the degradation of PCBs
that are made up of various isomers and not likely to induce
bph genes effectively. Fourth, overexpression leads to the deg-
radation of some PCB isomers that are hardly degraded by the
wild-type strain; i.e., overexpression has the potential to ex-
pand the range of substrates. Although the reasons for the
apparent expansion of substrate specicity are unclear, it could
be speculated that rapid conversion of PCBs or PCB degrada-
tion intermediates reduces their toxic effect on cell viability.
Finally, constitutive expression of the entire operon would
accelerate each step of mineralization; therefore, the target
compound would be mineralized more completely, preventing
the accumulation of intermediates. The accumulation of PCB
degradation intermediates could cause undesirable effects. The
3-chlorinated, 4-chlorinated, and 4-hydroxy HOPDAs, which
were formed from PCB degradation, inhibited BphD enzyme
from Burkholderia cepacia strain LB400 (25). Recently, inter-
mediate metabolites resulting from the degradation of PCBs
were shown to inhibit cell separation of Comamonas testos-
teroni strain TK102 (12).
This approach is applicable, provided that the host strain is
subject to homologous recombination, to any genes or operons
to improve biological functions in the original strain. We ex-
pect that a combination of promoter implanting and the many
genetic techniques developed thus far will contribute to the
effective and rapid remediation of polluted environments.
ACKNOWLEDGMENTS
Y.O. was nancially supported by research fellowships of the Japan
Society for the Promotion of Science for Young Scientists.
Y.O. is a special postdoctoral researcher at RIKEN.
REFERENCES
1. Amann, E., J. Brosius, and M. Ptashne. 1983. Vectors bearing a hybrid
trp-lac promoter useful for regulated expression of cloned genes in Esche-
richia coli. Gene 25:167178.
2. Cebolla, A., C. Sousa, and V. de Lorenzo. 1997. Effector specicity mutants
of the transcriptional activator NahR of naphthalene degrading Pseudomo-
nas dene protein sites involved in binding of aromatic inducers. J. Biol.
Chem. 272:39863992.
3. Chen, W., F. Bruhlmann, R. D. Richins, and A. Mulchandani. 1999. Engi-
neering of improved microbes and enzymes for bioremediation. Curr. Opin.
Biotechnol. 10:137141.
4. Csordas-Toth, E., I. Boros, and P. Venetianer. 1979. Structure of the pro-
moter region for the rrnB gene in Escherichia coli. Nucleic Acids Res.
7:21892197.
5. Davison, J. 1999. Genetic exchange between bacteria in the environment.
Plasmid 42:7391.
6. Diaz, E., and M. A. Prieto. 2000. Bacterial promoters triggering biodegra-
dation of aromatic pollutants. Curr. Opin. Biotechnol. 11:467475.
7. Estrem, S. T., T. Gaal, W. Ross, and R. L. Gourse. 1998. Identication of an
UP element consensus sequence for bacterial promoters. Proc. Natl. Acad.
Sci. USA 95:97619766.
8. Fukuda, M., Y. Yasukochi, Y. Kikuchi, Y. Nagata, K. Kimbara, H. Horiuchi,
M. Takagi, and K. Yano. 1994. Identication of the bphA and bphB genes of
Pseudomonas sp. strains KKS102 involved in degradation of biphenyl and
polychlorinated biphenyls. Biochem. Biophys. Res. Commun. 202:850856.
9. Furukawa, K. 2000. Engineering dioxygenases for efcient degradation of
environmental pollutants. Curr. Opin. Biotechnol. 11:244249.
10. Furukawa, K. 1994. Molecular genetics and evolutionary relationship of
PCB-degrading bacteria. Biodegradation 5:289300.
11. Gallardo, M. E., A. Ferrandez, V. De Lorenzo, J. L. Garcia, and E. Diaz.
1997. Designing recombinant Pseudomonas strains to enhance biodesulfu-
rization. J. Bacteriol. 179:71567160.
12. Hiraoka, Y., T. Yamada, K. Tone, Y. Futaesaku, and K. Kimbara. 2002. Flow
cytometry analysis of changes in the DNA content of the polychlorinated
biphenyl degrader Comamonas testosteroni TK102: effect of metabolites on
cell-cell separation. Appl. Environ. Microbiol. 68:51045112.
13. Kikuchi, Y., Y. Nagata, M. Hinata, K. Kimbara, M. Fukuda, K. Yano, and
M. Takagi. 1994. Identication of the bphA4 gene encoding ferredoxin re-
ductase involved in the biphenyl and polychlorinated biphenyl degradation in
Pseudomonas sp. strain KKS102. J. Bacteriol. 176:16891694.
14. Kikuchi, Y., Y. Yasukochi, Y. Nagata, M. Fukuda, and M. Takagi. 1994.
Nucleotide sequence and functional analysis of the meta-cleavage pathway
involved in biphenyl and polychlorinated biphenyl degradation in Pseudo-
monas sp. strain KKS102. J. Bacteriol. 176:42694276.
15. Kimbara, K., T. Hashimoto, M. Fukuda, T. Koana, M. Takagi, M. Oishi, and
K. Yano. 1989. Cloning of two tandem genes involved in degradation of
2,3-dihydroxybiphenyl to benzoic acid in the polychlorinated biphenyl-de-
grading soil bacterium Pseudomonas sp. strain KKS102. J. Bacteriol. 171:
27402747.
16. Lajoie, C. A., A. C. Layton, and G. S. Sayler. 1994. Cometabolic oxidation of
polychlorinated biphenyls in soil with a surfactant-based eld application
vector. Appl. Environ. Microbiol. 60:28262833.
17. Ohtsubo, Y., M. Delawary, K. Kimbara, M. Takagi, A. Ohta, and Y. Nagata.
2001. BphS, a key transcriptional regulator of bph genes involved in poly-
chlorinated biphenyl/biphenyl degradation in Pseudomonas sp. KKS102.
J. Biol. Chem. 276:3614636154.
18. Ohtsubo, Y., Y. Nagata, K. Kimbara, M. Takagi, and A. Ohta. 2000. Expres-
sion of the bph genes involved in biphenyl/PCB degradation in pseudomonas
sp. KKS102 induced by the biphenyl degradation intermediate, 2-hydroxy-
6-oxo-6-phenylhexa-2,4-dienoic acid. Gene 256:223228.
19. Pavel, H., M. Forsman, and V. Shingler. 1994. An aromatic effector speci-
city mutant of the transcriptional regulator DmpR overcomes the growth
constraints of Pseudomonas sp. strain CF600 on para-substituted methylphe-
nols. J. Bacteriol. 176:75507557.
20. Pieper, D. H., and W. Reineke. 2000. Engineering bacteria for bioremedia-
tion. Curr. Opin. Biotechnol. 11:262270.
21. Ramos, J. L., A. Wasserfallen, K. Rose, and K. N. Timmis. 1987. Redesign-
ing metabolic routes: manipulation of TOL plasmid pathway for catabolism
of alkylbenzoates. Science 235:593596.
22. Reineke, W. 1998. Development of hybrid strains for the mineralization of
chloroaromatics by patchwork assembly. Annu. Rev. Microbiol. 52:287331.
23. Ross, W., S. E. Aiyar, J. Salomon, and R. L. Gourse. 1998. Escherichia coli
promoters with UP elements of different strengths: modular structure of
bacterial promoters. J. Bacteriol. 180:53755383.
24. Roszak, D. B., and R. R. Colwell. 1987. Survival strategies of bacteria in the
natural environment. Microbiol. Rev. 51:365379.
25. Seah, S. Y., G. Labbe, S. Nerdinger, M. R. Johnson, V. Snieckus, and L. D.
Eltis. 2000. Identication of a serine hydrolase as a key determinant in the
microbial degradation of polychlorinated biphenyls. J. Biol. Chem. 275:
1570115708.
152 OHTSUBO ET AL. APPL.ENVIRON.MICROBIOL.
26. Seah, S. Y., G. Terracina, J. T. Bolin, P. Riebel, V. Snieckus, and L. D. Eltis.
1998. Purication and preliminary characterization of a serine hydrolase
involved in the microbial degradation of polychlorinated biphenyls. J. Biol.
Chem. 273:2294322949.
27. Shimura, M., G. Mukerjee-Dhar, K. Kimbara, H. Nagato, H. Kiyohara, and
T. Hatta. 1999. Isolation and characterization of a thermophilic Bacillus sp.
JF8 capable of degrading polychlorinated biphenyls and naphthalene. FEMS
Microbiol. Lett. 178:8793.
28. Sikkema, J., J. A. de Bont, and B. Poolman. 1995. Mechanisms of membrane
toxicity of hydrocarbons. Microbiol. Rev. 59:201222.
29. Thorne, S. H., and H. D. Williams. 1997. Adaptation to nutrient starvation
in Rhizobium leguminosarum bv. phaseoli: analysis of survival, stress resis-
tance, and changes in macromolecular synthesis during entry to and exit
from stationary phase. J. Bacteriol. 179:68946901.
30. Timmis, K. N., and D. H. Pieper. 1999. Bacteria designed for bioremedia-
tion. Trends Biotechnol. 17:200204.
VOL. 69, 2003 IMPROVING BIPHENYL AND PCB BIPHENYL DEGRADATION 153
    • "ction or screening to obtain the enzymes or pathways with the desired catabolic properties. Various successful modifications of some catabolic enzymes involved in biodegradation of aromatic compounds are summarized inTable 8. Several studies dealing with promoters instead of catabolic enzymes to enhance biodegradative properties have been reported. Ohtsubo et al. (2003) replaced the native bph promoter with various constitutive promoters through PCR, recombinant DNA construction, and homologous recombination and greatly improved the PCBdegrading activity and extended the substrate range of Pseudomonas sp. strain KKS102. Genetically engineered E. coli with the chlorobenzene dioxygenase (CDO) gene from P"
    [Show abstract] [Hide abstract] ABSTRACT: Biodegradation can achieve complete and cost-effective elimination of aromatic pollutants through harnessing diverse microbial metabolic processes. Aromatics biodegradation plays an important role in environmental cleanup and has been extensively studied since the inception of biodegradation. These studies, however, are diverse and scattered; there is an imperative need to consolidate, summarize, and review the current status of aromatics biodegradation. The first part of this review briefly discusses the catabolic mechanisms and describes the current status of aromatics biodegradation. Emphasis is placed on monocyclic, polycyclic, and chlorinated aromatic hydrocarbons because they are the most prevalent aromatic contaminants in the environment. Among monocyclic aromatic hydrocarbons, benzene, toluene, ethylbenzene, and xylene; phenylacetic acid; and structurally related aromatic compounds are highlighted. In addition, biofilms and their applications in biodegradation of aromatic compounds are briefly discussed. In recent years, various biomolecular approaches have been applied to design and understand microorganisms for enhanced biodegradation. In the second part of this review, biomolecular approaches, their applications in aromatics biodegradation, and associated biosafety issues are discussed. Particular attention is given to the applications of metabolic engineering, protein engineering, and "omics" technologies in aromatics biodegradation.
    Full-text · Article · Oct 2009
    • "Approaches That Upregulate Unmodified Coding Regions Ohtsubo et al. (2003) "
    [Show abstract] [Hide abstract] ABSTRACT: This paper presents a critical review of the literature on the application of genetically engineered microorganisms (GEMs) in bioremediation. The important aspects of using GEMs in bioremediation, such as development of novel strains with desirable properties through pathway construction and the modification of enzyme specificity and affinity, are discussed in detail. Particular attention is given to the genetic engineering of bacteria using bacterial hemoglobin (VHb) for the treatment of aromatic organic compounds under hypoxic conditions. The application of VHb technology may advance treatment of contaminated sites, where oxygen availability limits the growth of aerobic bioremediating bacteria, as well as the functioning of oxygenases required for mineralization of many organic pollutants. Despite the many advantages of GEMs, there are still concerns that their introduction into polluted sites to enhance bioremediation may have adverse environmental effects, such as gene transfer. The extent of horizontal gene transfer from GEMs in the environment, compared to that of native organisms including benefits regarding bacterial bioremediation that may occur as a result of such transfer, is discussed. Recent advances in tracking methods and containment strategies for GEMs, including several biological systems that have been developed to detect the fate of GEMs in the environment, are also summarized in this review. Critical research questions pertaining to the development and implementation of GEMs for enhanced bioremediation have been identified and posed for possible future research.
    Article · Sep 2006
    • "The repression observed by the three organic compounds was distinct compared with moderate repression by several other organic compounds such as mannitol, arabinose, lactate, glycerol and fructose. To see whether this catabolite control is specific to pE promoter, three promoters ( tac promoter, rrnB promoter (a promoter of ribosomal RNA transcription) derived from E. coli , and a promoter designed according to E. coli consensus promoter (designated as pEcoli) (Ohtsubo et al ., 2003 ) were tested in KKS102 with regard to their sensitivity to succinate. In the presence of succinate, each promoter showed a moderate (5–30%) decrease in activity, which was far below that observed for the pE promoter (data not shown). "
    [Show abstract] [Hide abstract] ABSTRACT: Acidovorax sp. (formally Pseudomonas sp.) strain KKS102 carries a bph operon for the degradation of PCB/biphenyl. Transcription from the pE promoter for the bph operon was found to be under catabolite control, i.e. the promoter activity was at a lower level when succinate, fumarate or acetate was added to the culture. Some mutations in the immediate upstream region of the pE promoter resulted in catabolite-insensitive and constitutively low promoter activity, suggesting that a transcriptional activator was involved in catabolite control. A genetic screen for a pE promoter activator identified two tandemly arranged genes, bphP and bphQ, that encoded proteins homologous to the sensor kinases and response regulators, respectively, of two-component regulatory system. In the bphPQ double mutant, pE promoter activity was weak and catabolite-insensitive, and a supply of the bphQ gene alone led to the restoration of the catabolite response. The mechanism of catabolite repression in KKS102 is explained in terms of inhibition of activation by BphQ. The genes highly similar to bphQ were found from several beta-proteobacteria, such as Burkholderia cenocepacia J2315, B. multivorans ATCC17616, B. xenovorans LB400 and Ralstonia solanacearum RS1085.
    Full-text · Article · Jul 2006
Show more