Content uploaded by Katsuiku Hirokawa
Author content
All content in this area was uploaded by Katsuiku Hirokawa on Jun 15, 2015
Content may be subject to copyright.
Arch Virol (2003) 148: 1175–1184
DOI 10.1007/s00705-003-0017-9
In vivo distribution of receptor for ecotropic murine
leukemia virus and binding of envelope
protein of Friend Murine leukemia virus
Brief Report
S. Yamaguchi
1,2
, M. Hasegawa
1,2
, T. Suzuki
3
,H.Ikeda
4
, S. Aizawa
2
,
K. Hirokawa
1
, and M. Kitagawa
1,2
1
Department of Pathology and Immunology, Aging and Developmental Sciences,
Tokyo Medical and Dental University, Graduate School, Tokyo, Japan
2
Radiation Hazards Research Group, National Institute of Radiological Sciences,
Chiba, Japan
3
Laboratory of Immunogenetics, National Institute of Animal Health, Tsukuba,
Ibaraki, Japan
4
Laboratory of Infectious Diseases, National Institute of Animal Health, Tsukuba,
Ibaraki, Japan
Received October 31, 2002; accepted January 31, 2003
Published online April 9, 2003
c
Springer-Verlag 2003
Summary. Ecotropic infection by Murine leukemia virus (MuLV) infection is
initiated by the interaction between the receptor-binding domain of the viral sur-
faceglycoprotein (SU) and thecell-surface receptor, mCAT-1.Tostudy the in vivo
localization of viral binding site in mice, green fluorescence protein (GFP)-tagged
FriendSU(F-SU/GFP)wasincubatedwith tissue sections. Lymphohematopoietic
organsandapartoftheglandulartissuesofC3Haswellas C57BL/6mice revealed
positive signals for F-SU/GFP binding on the cell surface. In contrast, C4W mice,
which is a partial congenic mouse strain carrying the Fv-4
r
gene on a BALB/c
genetic background, exhibited negative signals in most of the organs except for a
veryweak binding in the pancreas. The expression of mCAT-1 mRNA determined
by reverse transcriptase (RT)-polymerase chain reaction (PCR) revealed a similar
distribution in C3H, C57BL/6 and C4W mice. Most of the organs including
lymphohematopoieticorgansandglandularorgansrevealedsignificantexpression
of mRNA for mCAT-1 gene, while the liver, heart and muscle did not. The results
from binding assay were consistent with the fact that Friend MuLV-induced
pathogenesiswasusuallyassociatedwithlymphohematopoieticsystems,although
mRNA expression for mCAT-1 was rather ubiquitous. The discrepancy between
1176 S.Yamaguchi et al.
F-SU/GFP binding and mRNA expression for mCAT-1 in lymphohematopoietic
organs of C4W mice would support the receptor interference effect by the Fv-4
r
gene causing the resistance of C4W mouse to Friend MuLV infection.
∗
Elucidation of the molecular basis for retrovirus-receptor interaction is thought
to contribute to the understanding of the viral pathogenic mechanisms and de-
velopment of useful systems for retrovirus-mediated gene transduction. The re-
ceptor for ecotropic MuLV is a cationic amino acid transporter, mCAT-1 [2, 11],
whose mRNA is expressed in various organs [1, 11]. Thus, the distribution of the
mCAT-1 gene product would be useful information for clarifying the mCAT-1
function in vivo. However, at this moment, no suitable antibody for the immuno-
histochemical detection of mCAT-1 protein is available.
Retroviruses have two envelope protein subunits, a surface glycoprotein (SU)
and a transmembrane protein (TM). In the previous studies [3, 4], the MuLV
SU proteins were successfully used for the study of receptor binding. Thus, we
prepared a soluble SU protein, an mCAT-1 binding protein of ecotropic Friend
MuLV (F-SU) by a baculovirus expression system [22]. The protein was tagged
with a green fluorescent protein (GFP) so that we could specifically trace the
binding portion. Using this construct, F-SU/GFP, we clarified the cell surface
binding of F-SU on hematopoietic cells [22]. Then, to demonstrate the precise
distribution of ecotropic MuLV receptor in vivo, this SU protein was incubated
with frozen tissue sections and the binding portion of the cell was determined
in the present study. Further, we demonstrated the mRNA expression for the
mCAT-1 gene by RT-PCR method and compared the organ distribution of mRNA
expression with the F-SU binding ability. We examined organs from three mouse
strains, C3H, C4W and C57BL/6 mice.The C3H mice are susceptible to infection
with ecotropic MuLV including Friend leukemia virus (FLV), whereas C4W
mice, which are Fv-4
r
congenic mice on a BALB/c genetic background [7], are
refractoryto ecotropic MuLVinfection.The Fv-4
r
geneis a truncated endogenous
MuLV locus that expresses the ecotropic MuLV envelope (ENV) glycoprotein
and confers resistance to infection by exogenous ecotropic MuLV probably via
receptor interference as well as disturbed expression of the receptor to the cell
surface [7, 8, 23]. On the other hand, the C57BL/6 mice are susceptible to
infection with ecotropic MuLV but are resistant to Friend leukemia virus (FLV)-
inducedleukemogenesisrestrictedbyFv-2
r
function.Thus,bindingdistributionof
ecotropicMuLVreceptorsinsystemicorgansofthesemicestrainswerecompared.
Micewerepreparedas the specific pathogen-free (SPF) C3H/HeMsNrs (C3H)
and C57BL/6 male mice of 6- to 8-week-old that were bred from our colonies at
theAnimal Production Facility of the National Institute of Radiological Sciences,
Chiba, Japan. BALB/c-Fv-4W
r
(C4W) mice, which are Fv-4
r
congenic with
BALB/c mice [7], weremaintainedinourlaboratory.All animals were maintained
SPF by our criteria [16].
The fusion gene F-SU/GFP was derived from the SU gene of Friend MuLV
clone 57 [17] and the GFP gene (Clontech Laboratories, Palo Alto, CA). The
Distribution of receptor for MuLV 1177
DNAconstructionprocedurewasreportedelsewhereindetail[22].TheF-SU/GFP
proteincontained97%oftheFriendSUdomain,includingtheputativemCAT-1re-
ceptor binding region. The mCAT-1 specific binding of the F-SU/GFP fusion pro-
tein was demonstrated by flow cytometric analysis using mCAT-1 gene-negative
rabbit SIRC cells and mCAT-1 gene-transfected SIRC cells [22].
Binding procedure of F-SU/GFP was performed on six- to eight-micron thick
frozen sections prepared from the systemic organs of C3H, C4W and C57BL/6
mice. The sections were mixed with 20µL of F-SU/GFP solution for 1hr at
4
◦
C. After washing with PBS the sections were stained with a polyclonal anti
GFP antibody (Clontech Laboratories, Inc., Palo Alto, CA) followed by FITC-
conjugated anti rabbit IgG (DAKO, Carpinteria, CA). Negative control stain-
ing was performed by the substitution of recombinant GFP protein (Santa Cruz
Biotechnology, Santa Cruz, CA) instead of F-SU/GFP followed by the secondary
and tertiary procedures.
To determine the minimum expression of mRNA for the mCAT-1 gene, a
reverese transcriptase (RT)-polymerase chain reaction (PCR) reaction was per-
formed in samples from each mouse strain. The RNA was extracted from the
systemic organs using an RNeasy Mini Kit (Qiagen, Valencia, CA) according
to the manufacturer’s directions. Tissue RNA (100ng) was used as a template
for the amplification reactions. Complementary (c) DNA was synthesized using
Rous-associated virus reverse transcriptase (Takara Biomedicals, Kyoto, Japan).
The PCR reaction was performed as described elsewhere [20]. The sequences
of primers synthesized by a commercial laboratory (Life Technologies Oriental,
Tokyo Japan) were as follows: mCAT-1: 5
PCR primer GTCCCGCTGCCTCAA
CACCTA, 3
PCR primer GAACCCGGACACCACGATGAA [24]; β-actin: 5
PCR primer TGGAATCCTGTGGCATCCATGA, 3
PCR primer ATCTTCATG
GTGCTAGGAGCCAG. Reactions were run with 35 cycles of 94
◦
C for 30sec,
55
◦
C for 30sec, and 72
◦
C for 1min, followed by 10min at 72
◦
C. The expected
sizes of the PCR products were 544bp for mCAT-1 and 175bp for β-actin.
φX174/HaeIII-cut DNA was run in parallel as a molecular size marker.
To localize the F-SU binding site in the systemic organs, F-SU/GFP was incu-
bated with frozen sections and the binding site was observed under the fluorescent
microscopy. Because the receptor-F-SU binding would occur in a one molecule
to one molecule manner, we had to enhance the signals by using the second and
the third antibodies. Significant binding was observed in lymphohematopoietic
organsof C3H and C57BL/6 mice, including the spleen, thymus and lymph nodes.
Positive signals were essentially localized at the cell surface. In the spleen of C3H
mice, germinal center (G.C.) B-cells were almost all negative for F-SU/GFP-
binding,whereaspositivereactionswerestrongincellsoftheT-cellzone(Fig.1A).
Myeloid cells and megakaryocytes of the spleen also appeared positive, although
erythroid cells were difficult to identify in the frozen sections. In the thymus of
C3H mice, the cells in thymic medulla were more strongly stained compared with
the cells of the cortex (Fig. 1B). Lymph node cells were also positively stained,
however, the T-, B-difference in staining intensity was not clear. In contrast, as
expected from the previous data by flow cytometry [22], the cells of C4W mice
1178 S.Yamaguchi et al.
Distribution of receptor for MuLV 1179
wereessentially negativefor binding byF-SU/GFP in these lymphohematopoietic
organs (Fig. 1E and F).
In other organs, some of the glandular tissues from C3H mice including the
salivary gland (Fig. 1C) and pancreas (Fig. 1D) exhibited significant binding of
F-SU/GFP. The binding was observed mainly on the cell surface of acinar cells of
the salivary gland and pancreas. In addition, a few gastrointestinal tract epithelial
cells and a part of the lung alveolar epithelial cells were weakly positive for
F-SU/GFP binding. These organs from C3H and C57BL/6 mice revealed similar
staining intensity. Although brain tissue (cerebrum and cerebellum) also revealed
very weak signals on the cell surface of nerve cells and glial cells, it was difficult
to distinguish the signal from high background staining. On the other hand, the
C4Wsalivarygland wasnegative(Fig.1G),whereasthe pancreas from C4W mice
was weakly positive for F-SU/GFP binding (Fig. 1H). Although figures are not
shown, negative control staining using recombinant GFP protein substituted with
F-SU/GFP did not reveal any significant reaction.
Other organs including the liver, kidney, heart and muscle appeared negative
for the binding of F-SU/GFP. The staining results for the binding of F-SU/GFP to
the systemic organs are summarized in Table 1.
To determine the organ distribution of mCAT-1 gene expression at the mRNA
level, mRNAs for the mCAT-1 gene were identified by the RT-PCR method. The
straindifferenceintheintensityofexpressionwasnotclearinC3HandC4Wmice.
As shown in Fig. 2, many of the organs tested expressed mRNA for mCAT-1 gene,
although some organs such as the heart, muscle and liver did not show positive
bands by RT-PCR. However, the gastrointestinal tract and heart exhibited positive
bands in C57BL/6 mice, although the signals were negative or very weak in C3H
andC4Wmice.TheorgandistributionofmCAT-1expressioninC3HandC57BL/6
mice was almost comparable to the data by binding assay, although severalorgans
such as the lung, brain and kidney showed very weak or negative binding of
F-SU/GFP but definitely positive signals for mRNA expression. We could specu-
late several reasons for the difficulty in detecting the F-SU/GFP binding in organs
where mCAT-1 mRNA was detected by RT-PCR. One possibility would be that
the density of receptor molecules on the cell surface was so low as to detect F-SU
Fig.1. A–D.F-SU/GFPbindingtothespleen(A),thymus(B),salivarygland(C)andpancreas
(D) of C3H mouse (original magnification, x200). Note the positive signals on the cell surface
oflymphohematopoieticcells.Inthespleen,germinalcenter(G.C.)cellswerealmostnegative.
The F-SU/GFP binding in thymocytesof the thymic medulla (left half) appeared more intense
compared with the cells of the thymic cortex (right half). In glandular organs such as the
salivary gland and pancreas, the cell surface of acinar cells revealed positive signals which
appeared as linear staining along the cell border. E–H: F-SU/GFP binding to the spleen (E),
thymus (F), salivary gland (G) and pancreas (H) of C4W mouse. In contrast to the C3H
mouse organs, the C4W spleen, thymus and salivary gland did not exhibit significant binding
of F-SU/GFP (x200). Among the C4W organs, positive staining was observed only in the
pancreas, although the reaction was weak and only partial
1180 S.Yamaguchi et al.
Table 1. In vivo distribution of F-SU/GFP binding site in systemic organs from C3H,
C57BL/6 and C4W mice
Organs Mouse strains
C3H C57BL/6 C4W
Spleen +, germinal center cells were negative −
Thymus +, medulla> cortex −
Lymph node +, diffuse −
Salivary gland +, cell border −
Pancreas +, cell border ±, cell border, only partial
GI tract −∼±, cell border, only partial −
Lung −∼±, alveolar septum, only partial −
Brain −∼±, very weak −
Kidney −−
Heart −−
Muscle −−
Liver −−
The staining pattern was as follows; +: the majority of cells were positively stained;
±: only partial or focal binding of F-SU/GFP was observed;and −: no significant binding
was observed
Fig. 2. RT-PCR analysis of mRNA expression for the mCAT-1 gene in organs from C3H,
C57BL/6 and C4W mice. RNA samples were prepared from the systemic organs of each
mouse. An RT-PCR technique revealed significant expression for mCAT-1 in the spleen,
thymus, lymph node, salivary gland, pancreas, lung, brain and kidney, while gastrointestinal
tract exhibited negative or very weak signals in C3H and C4W mice. The heart, muscle and
liverwere negative. In C57BL/6 mice, positivesignalswereadditionallyobservedin theheart.
As indicated in the lower column, mRNAexpression for β-actin was identified in each sample
Distribution of receptor for MuLV 1181
binding. The other possibilities might include the low level of translation of
receptor proteins from mRNA in several organs. Further, we could not preclude
the influence of blood cells contained in the organs when we detected mRNA
expression.
In contrast, C4W exhibited positive expression of mRNA for mCAT-1 gene in
many organs but revealed negative binding of F-SU/GFP to these organs. These
findings were consistent with the Fv-4
r
-mediated resistance mechanisms of C4W
mice to MuLV infection via receptor interference [9, 10, 14].
Twogenes,mCAT-1andmCAT-2,encoderelatedmultiplemembrane-spanning
proteins that share substantial amino acid sequence identity and virtually super-
imposable hydrophilicity profiles. The function of these two proteins in amino
acid transport appears indistinguishable, however, the tissue distribution patterns
are different. The mCAT-1 gene expression is nearly ubiquitous, while mCAT-2
is highly tissue-specific [18]. Among the CAT family proteins, mCAT-1 is the
dominant ecotropic receptor in mouse in vivo [19]. From the study of mCAT-1
gene knockout mice [20], mCAT-1 also plays a critical role in the development of
hematopoietic organs, and thus, these mice died immediately after birth.
Concerning the morphological analysis of the in vivo distribution of
ecotropic MuLV receptor, references have been scarce because no suitable an-
tibody for detecting the receptor protein immunohistochemically is available.
Several studies have reported that mCAT-1 could be detected by an anti-mCAT-
1 antiserum, regretably with a higher level of background signals [12, 19]. Our
systemcoulddemonstratethebindingsiteofF-SUexpectedasthemajorecotropic
receptor, mCAT-1 [22]. To detect the ENV-receptor complex on the cell surface,
previous studies used antibodies to viral ENV protein [9, 10]. However, soluble
ENV protein interferes with the reaction between antibodies and ENV-receptor
complex.AlthoughYu et al. have suggested that ENV detected on the cell surface
bytheFACS assay is protein that has rebound to its receptor after being secreted or
shed, rather than actual surface-expressed protein [26], exogenous and endogen-
ous virus antigens are very difficult to distinguish when antibodies against viral
proteins are used. In this sense, our system can specifically detect the sites of
empty receptor which are ready to bind to viral ENV.
The mCAT-1 sequences encoding loop 3 are hypervariable in different strains
of mice [1, 5, 6]. Thus, interactions between the envelope glycoproteins of
ecotropic MuLV and the receptor molecule would cause different pathogenic con-
sequences of MuLV infection in different strains of mice [25].Although the three
strainsofmiceusedinthepresentstudyrevealedsimilarpatternsofdistributionfor
mCAT-1 mRNA expression, these mice reacted differently against FLV-infection.
C3H mice were highly susceptible for FLV-induced leukemia, while C4W and
C57BL/6 mice were refractory to FLV-induced pathogenesis. It is well known
that many host genes regulate FLV-induced leukemogenicity after FLV-infection,
however, the molecular mechanisms for controlling receptor-ENV protein inter-
action should also be taken into account for clarifying the pathogenesis of MuLV
infection.
1182 S.Yamaguchi et al.
The basis of the resistance to infection by ecotropic viruses conferred by the
Fv-4
r
gene was clearly defined as SU subunit mutation resulting in the instability
to membrane fixation of the ENV protein in addition to the receptor interference
mechanism [8, 14, 23], although the immune response has been also suggested
to play a role [27]. The present study revealed the receptor interference effect
of C4W mice in the systemic organs. Namely, the F-SU/GFP could not bind to
the cell surface of C4W mice despite the fact that mRNA for mCAT-1 gene was
similarly expressed in the systemic organs of C4W mice as C3H or C57BL/6
mice. The Fv-4
r
product existed densely on the salivary gland and pancreas other
than hematological cells of C4W mice [15], which is consistent with the present
findings that F-SU/GFP bound well to these glandular organs of C3H as well
as C57BL/6 mice. We can speculate that the soluble Fv-4
r
product produced by
hematopoietic cells binds to the cell surface of the salivary gland and pancreas in
C4W mice. Although the significance of these organs in MuLV infection is still
uncertain, they can serve as a reservoir of integrated viral genome or the viral
infection may induce virus-associated dysfunction of these organs.
Adenovirus vector has been used to transduce the ecotropic MuLV receptor
gene to human cells in gene therapy [24]. Generally, an adenovirus-based gene
transduction system evokes broad but transient gene expression, while retrovirus-
based gene transduction reveals a rather restricted and low but relatively stable
expression[13,16].Therefore,acombinationofthesetwosystemswouldcompen-
satefortheirweak-points witheachother[21].Forexample,in humancancergene
therapy, pre-infection of recombinant adenovirus expressing mCAT-1 permits the
efficient ecotropic retroviral gene transduction into human cells [24]. Our method
to directly detect the ecotropic MuLV receptor distribution should be promising
for localizing transduced receptors in vivo.
Acknowledgment
ThisworkwassupportedinpartbyResearchGrantsfromtheNationalInstituteofRadiological
Sciences, Chiba, Japan and by a grant-in-aid from the Ministry of Education, Culture, Sports,
Science and Technology of Japan.
References
1. Albritton LM,Tseng L, Scadden D, Cunningham JM (1989)A putative murine ecotropic
retrovirus receptor gene encodes a multiple membrane-spanning protein and confers
susceptibility to virus infection. Cell 57: 659–666
2. Aulak KS, Mishra R, Zhou L, Hyatt SL, Jonges W, Lamers W, Snider M, Hatzoglou M
(1999) Post-transcriptional regulation of the arginine transporter Cat-1 by amino acid
availability. J Biol Chem 274: 30424–30432
3. BattiniJL, Rodrigues P, Muller R, DanosO, Heard JM (1996) Receptor-bindigproperties
of a purified fragment of the 4070A amphotropic murine leukemia virus envelope
glycoprotein. J Virol 70: 4387–4393
4. Davey RA, Hamson CA, Healey JJ, Cunningham JM (1997) In vitro binding of purified
murine ecotropic retrovirus envelope surface protein to its receptor, MCAT-1. JVirol 71:
8096–8102
Distribution of receptor for MuLV 1183
5. Eiden MV, Farrell K, Warsowe J, Mahan LC, Wilson CA (1993) Characterization of a
naturallyoccurringecotropicreceptorthatdoesnot facilitateentryofallecotropicmurine
retroviruses. J Virol 67: 4056–4061
6. Fass D, Davey RA, Hamson CA, Kim PS, Cunningham JM, Berger JM (1997) Structure
of a murine leukemia virus receptor-binding glycoprotein at 2.0 angstrom resolution.
Science 277: 1662–1666
7. Ikeda H, Odaka T (1983) Cellular expression of murine leukemia virus gp70-related
antigenon thymocytesofuninfectedmicecorrelateswith Fv-4 gene-controlled resistance
to Friend leukemia virus infection. Virology 128: 127–139
8. Ikeda H, Sugimura H (1989) Fv-4 resistance gene: a truncated endogenous murine
leukemia virus with ecotropic interference properties. J Virol 63: 5405–5412
9. Kabat D (1989) Cell surface receptors for ecotropic murine retroviruses: Mobile
membrane proteins that mediate binding and slow endocytosis of the viral envelope
glycoprotein. Virology 171: 467–474
10. Kadan MJ, Strum S, French Anderson W, Eglitis MA (1992) Detection of receptor-
specific murine leukemia virus binding to cells by immunofluorescence analysis. JVirol
66: 2281–2287
11. Kim JW, Closs EI, Albritton LM, Cunningham JM (1991) Transport of cationic amino
acids by the mouse ecotropic retrovirus receptor. Nature 352: 725–728
12. Kim JW, Cunningham JM (1993) N-linked glycosylation of the receptor for
murine ecotropic retroviruses is altered in virus-infected cells. J Biol Chem 268:
16316–16320
13. Kitagawa M, Aizawa S, Kamisaku H, Hirokawa K, Ikeda H (1999) Protection of
retrovirus-induced disease by transplantation of bone marrow cells transduced with
MuLV env gene via retrovirus vector. Exp Hematol 27: 234–241
14. Kitagawa M, Aizawa S, Kamisaku H, Ikeda H, Hirokawa K, Sado T (1995) Cell-free
transmission of Fv-4 resistance gene product controlling Friend leukemia virus-induced
leukemogenesis: a unique mechanism for interference with viral infection. Blood 86:
1557–1563
15. Kitagawa M, Aizawa S, Kamisaku H, Sado T, Ikeda H, Hirokawa K (1996) Distribution
of Fv-4 resistant gene product in Friend leukemia virus-resistant Fv-4
r
mouse strain. Exp
Hematol 24: 1423–1431
16. Kitagawa M, Aizawa S, Sado T, Yamaguchi S, Suzuki T, Hirokawa K, Ikeda H (2001)
A gene therapy model for retrovirus-induced disease with a viral env gene: expression-
dependent resistance in immunosuppressed hosts. Leukemia 15: 1779–1784
17. Koch W, Hunsmann G, Friedrich R (1983) Nucleotide sequence of the envelope gene of
Friend murine leukemia virus. J Virol 45: 1–9
18. MacLeod CL, Finley KD, Kakuda DK (1994) y
+
-type cationic amino acid transport:
expression and regulation of the mCAT genes. J Exp Biol 196: 109–121
19. Masuda M, Kakushima N, Wilt SG, Ruscetti SK, Hoffman PM, Iwamoto A (1999)
Analysis of receptor usage by ecotropic murine retroviruses, using green fluorescent
protein-tagged cationic amino acid transporters. J Virol 73: 8623–8629
20. Perkins CP, Mar V, Shutter JR, Castillo JD, Danilenko DM, Medlock ES, Ponting IL,
Graham M, Stark KL, Zuo Yi, Cunningham JM, Bosselman RA (1997) Anemia and
perinatal death result from loss of the murine ecotropic retrovirus receptor mCAT-1.
Genes Dev 11: 914–925
21. QingK, BachelotTB,MukherjeeP,Wang X, Peng L,Yoder MC, LeboulchP,SrivastavaA
(1997) Adeno-associated virus type 2-mediated transfer of ecotropic retrovirus receptor
cDNA allows ecotropic retroviral transduction of established and primary human cells.
J Virol 71: 5663–5667
1184 S.Yamaguchi et al.: Distribution of receptor for MuLV
22. Suzuki T, Aizawa S, Ikeda H (2001) Expression of receptor for murine leukemia virus
on hematopoietic cells. Arch Virol 146: 507–519
23. Taylor GM, GaoYI, Sanders DA (2001) Fv-4: Identification of the defect in env and the
mechanism of resistance to ecotropic murine leukemia virus. J Virol 75: 11244–11248
24. Uto H, Ido A, Hori T, Hirono S, Hayashi K, Tamaoki T, Tsubouchi H (1999) Hepatoma-
specific gene therapy through retrovirus-mediated and targeted gene transfer using an
adenovirus carrying the ecotropic receptor gene. Biochem Biophys Res Comm 265:
550–555
25. Wang H, Klamo E, Kuhmann SE, Kozak SL, Kavanaugh MP, Kabat D (1996)
Modulationofecotropicmurineretrovirusesby N -linkedglycosylationof thecellsurface
receptor/amino acid transporter. J Virol 70: 6884–6891
26. Yu H, Empig C, Xia J, French Anderson W (1998) Quantitation of MoMuLV envelope
protein on the cell surface. Virology 243: 415–422
27. Zhang F, Ya LT, Iwatani Y, Higo K, Suzuki T, Tanaka M, Nakahara T, Ono T, Sakai H,
Kuribayashi K, IshimotoA (2000) Resistance to Friend murine leukemia virus infection
conferred by the Fv-4 gene is recessive but appears dominant from the effect of the
immune system. J Virol 74: 6193–6197
Author’s address: Masanobu Kitagawa, M.D. Department of Pathologyand Immunology,
Aging and Developmental Sciences, Tokyo Medical and Dental University, Graduate School,
1-5-45Yushima, Bunkyo-ku, Tokyo 113-8519, Japan; e-mail: masa.pth2@med.tmd.ac.jp
