West Nile Virus in Farmed Alligators

Abstract

Seven alligators were submitted to the Tifton Veterinary Diagnostic and Investigational Laboratory for necropsy during two epizootics in the fall of 2001 and 2002. The alligators were raised in temperature-controlled buildings and fed a diet of horsemeat supplemented with vitamins and minerals. Histologic findings in the juvenile alligators were multiorgan necrosis, heterophilic granulomas, and heterophilic perivasculitis and were most indicative of septicemia or bacteremia. Histologic findings in a hatchling alligator were random foci of necrosis in multiple organs and mononuclear perivascular encephalitis, indicative of a viral cause. West Nile virus was isolated from submissions in 2002. Reverse transcription-polymerase chain reaction (RT-PCR) results on all submitted case samples were positive for West Nile virus for one of four cases associated with the 2001 epizootic and three of three cases associated with the 2002 epizootic. RT-PCR analysis was positive for West Nile virus in the horsemeat collected during the 2002 outbreak but negative in the horsemeat collected after the outbreak.

Full text

Seven alligators were submitted to the Tifton
Veterinary Diagnostic and Investigational Laboratory for
necropsy during two epizootics in the fall of 2001 and 2002.
The alligators were raised in temperature-controlled build-
ings and fed a diet of horsemeat supplemented with vita-
mins and minerals. Histologic findings in the juvenile alliga-
tors were multiorgan necrosis, heterophilic granulomas,
and heterophilic perivasculitis and were most indicative of
septicemia or bacteremia. Histologic findings in a hatchling
alligator were random foci of necrosis in multiple organs
and mononuclear perivascular encephalitis, indicative of a
viral cause. West Nile virus was isolated from submissions
in 2002. Reverse transcription-polymerase chain reaction
(RT-PCR) results on all submitted case samples were pos-
itive for West Nile virus for one of four cases associated
with the 2001 epizootic and three of three cases associat-
ed with the 2002 epizootic. RT-PCR analysis was positive
for West Nile virus in the horsemeat collected during the
2002 outbreak but negative in the horsemeat collected after
the outbreak.
W
est Nile virus (WNV) has been reported in a variety
of species but primarily endotherms. Arboviruses
have been reported to affect ectotherms, and in some cases
ectotherms are thought to serve as a reservoir (1–4). The
mode of transmission of the arbovirus to ectotherms has
often been presumed to be through ingestion or a bite from
the insect carrier (5).
During the fall of 2001 and 2002, two epizootics
occurred among captive alligators on a south Georgia alli-
gator farm that houses over 10,000 animals.
Approximately 250 alligators died between November and
December 2001, and >1,000 alligators died in 2002. These
epizootics tended to occur approximately 2 weeks after the
first abrupt drop in ambient temperature, which occurred
both years in mid-October and was characterized by mini-
mum temperatures between 0°C and 8°C and maximum
temperatures between 10°C and 18°C for a period of 1 to
3 days.
Methods
Animals and Housing
Animals were housed in six barns that were divided
into 10 pens; each pen contained approximately 100–200
alligators. The nursery animals are obtained either as eggs
from Florida or as hatchlings from onsite breeders.
All pens are cleaned in the morning starting at 6 a.m.
An automatic flushing system is used to drain the pens,
flush them, and fill them with clean water. Well water is
chlorinated with an automated system that injects chloride
gas into the water. The water is then piped into a central
collecting area and heated. The water temperature is main-
tained at 32.2°C year-round, and the buildings are kept
dark to reduce environmental stress on the animals. The
reduced stress and warm environment allow continued
growth (i.e., growth of >
1 m per year rather than 0.30 m
per year).
Alligators are fed in the mid- to late afternoon. The diet
consists of 95% ground raw horsemeat (obtained frozen
from a source in Pennsylvania) to which vitamins and min-
erals are added in a pelleted alligator diet carrier. The
ingredients are thoroughly mixed in a large commercial
mixer. The source of the horsemeat has remained constant
since 1985. The source of the vitamins and minerals has
varied, based upon availability.
The breeding population is maintained in a separate
fenced enclosure on the premises. This enclosure is a
native swampland and therefore subjected to ambient
weather conditions. A rookery was recently established in
the breeding area by native birds. Attempts to depopulate
the rookery (using U.S. Department of Agriculture–
approved methods) have been unsuccessful. The alligators
eat fledglings and older birds that fall from the nests and
branches or otherwise get within reach. Alligators do not
nest under the rookery. No mosquito control is practiced
on the farm.
Tissue Collection
Animals were seen moribund or dead upon arrival at
the laboratory. Blood was collected from the occipital
794 Emerging Infectious Diseases • Vol. 9, No. 7, July 2003
RESEARCH
West Nile Virus in
Farmed Alligators
Debra L. Miller,* Michael J. Mauel,* Charles Baldwin,* Gary Burtle,* Dallas Ingram,*
Murray E. Hines II,* and Kendal S. Frazier*
*University of Georgia, Tifton, Georgia, USA

sinus or caudal vein of live animals. Gross observations
were made, and the animals were humanely euthanized.
Tissues were collected from the eye, thyroid gland, lymph
node, lung, heart, brain, spinal cord, kidney, liver, spleen,
pancreas, adrenal gland, gallbladder, tonsil, trachea, stom-
ach, intestines, and reproductive tract. Fresh tissue speci-
mens were submitted for virus isolation, reverse transcrip-
tion-polymerase chain reaction (RT-PCR), and bacterial
culture. Tissues were also collected in 10% buffered for-
malin, processed, and embedded in paraffin. Five-microm-
eter-thick sections were stained with hematoxylin and
eosin and viewed by light microscopy. Tissues opportunis-
tically collected from an adult clinically normal, free-rang-
ing alligator served as a control.
Multiple aliquots (totaling 1 g) of the ground raw horse-
meat (without additives) that was being fed during the
2002 epizootic (October and November) were collected
and processed for RT-PCR. Subsequent aliquots from
postepizootic horsemeat shipments (in December and
January) were similarly processed.
Virus Isolation
A 10% homogenate in Earle’s minimal essential media
(MEM) containing gentamicin was made of each speci-
men. The homogenate was centrifuged for 10 min at 2,000
RPM and 4°C. The supernatent was filtered and spread
onto a preformed monolayer of Vero cells. In 2001, fathead
minnow (FHM), white sturgeon skin (WSS), epithelioma
papillosum caprini (EPC), and channel catfish ovary
(CCO) cells were used instead of the Vero cells. Inoculated
cells were incubated in a 5% CO
2
atmosphere at 37°C.
Cells were examined each day for viral cytopathic effect
(CPE). If no CPE was observed, aliquots of the first pas-
sage were transferred to a second preformed monolayer of
Vero cells (FHM, WSS, EPC, and CCO cells in 2001) on
day 7. If no CPE was observed after a second 7 days of
passage, the culture was considered negative. Monolayers
demonstrating viral CPE were passaged to chambered
slides. The slides were fixed in cold methanol, and a West
Nile fluorescent-antibody test was conducted to confirm
the isolate.
Fluorescent-Antibody Testing
Mouse anti–WNV-specific polyclonal antibody
(Centers for Disease Control and Prevention [CDC],
Division of Vector-Borne Infectious Diseases, Fort
Collins, CO) was applied to the chamber and the slide
incubated in 5% CO
2
at 37°C for 30 min. The slide was
rinsed two times for 5 min in a sodium carbonate/bicarbon-
ate buffer (pH 9.3). The slide was then air-dried, followed
by an anti-mouse fluorescein-conjugated antibody, and
incubated as before for 30 min. The slide was washed
twice in carbonate buffer, followed by 5 min in 0.5%
Evans blue counter stain. Slides were dipped in distilled
water, and a glycerin/water mounting media and coverslip
was added. Slides were examined with a fluorescent
microscope. All isolates were tested for WNV. All isolates
were also tested for Eastern equine encephalomyelitis
virus (EEEV) by using a similar protocol. We tested for
EEEV because of its known prevalence within the geo-
graphic area. The EEEV-specific monoclonal antibody
(CDC, Atlanta, GA) was prepared against the New Jersey
1960 strain of EEEV.
RNA Extraction
RNA was extracted from various specimens (fresh tis-
sue, virus isolation homogenate or cell culture lysate, and
formalin-fixed paraffin-embedded tissue). For extraction
from fresh specimens, approximately 1 g of tissue was
placed in a whirlpack bag and homogenized by using a
Stomacher Lab Blender 80 (Tekmar Co., Cincinnati, OH)
with three times the tissue volume of phosphate-buffered
saline (PBS). Three milliliters of the tissue homogenate
was processed with a Rneasy Midi kit (QIAGEN, Inc.,
Valencia, CA) per manufacturer’s directions. If a virus iso-
lation homogenate or cell culture lysate in Earle’s MEM
was used, approximately 4 mL of the homogenate or lysate
was washed with 5 mL of PBS, the supernatant removed,
and the pellet processed with the Rneasy Midi kit. For
paraffin sections, several 5-µm sections from paraffin
blocks were cut and deparaffinized with xylene. The
xylene was removed, and samples were washed two times
with 100% ethanol for 10 min, once with 95% and once
with 70% ethanol. Samples were incubated overnight at
56°C in 80 µL of proteinase K with 5 mL of Buffer RLT
from the Rneasy Midi kit and then processed per manufac-
turer’s directions.
RT-PCR
RT-PCR for WNV was performed on the tissues
according to the procedure described by Kuno (6) and
using the RT-nested primer sets described by Johnson et al.
(7). In brief, a RT-PCR mixture was prepared by using the
outside primer set (P1401 – ACCAACTACTGTGGAGTC
and P1845 – TTCCATCTTCACTCTACACT) to amplify a
445-bp product. Forty microliters of the RT-PCR mixture
and 10 µL of sample were dispensed into a 0.2-mL thin
wall PCR tube, and 10 µL of Rnase-free water was added
for a final volume of 50 µL. With the use of a model PTC-
200 thermal cycler (MJ Research, Inc., Waltham,
Massachusetts), cycling conditions for the RT-PCR were
as follows: 53°C for 30 min, followed by 40 cycles of
94°C for 1 min, 53°C for 1 min, 72°C for 1 min, and then
held at 4°C. Ten microliters of RT-PCR first-round product
was used for the nested PCR (nPCR). The nPCR mixture
was prepared by using 40 µL of PCR mixture (now with
Emerging Infectious Diseases • Vol. 9, No. 7, July 2003 795
RESEARCH

the inside primer set [P1485 – GCCTTCATACACAC-
TAAAG and P1732 – CCAATGCTATCACAGACT]) to
amplify a 248-bp product. The cycling conditions for the
nPCR were as described above, but the first ramp was
omitted (53°C for 30 min). A 10-µL aliquot of each reac-
tion with 1 µL of loading buffer added was loaded onto a
1.5 % agarose gel in Tris-borate-EDTA (TBE) buffer and
run at 70 V for approximately 1.5 h.
This protocol was repeated on all samples with primer
sets for EEEV and St. Louis encephalitis virus (SLEV).
For the 262-bp EEEV genomic fragment, an outer set of
forward (P4 (EEE-4) - CTAGTTGAGCACAAACACCG-
CA) and reverse (P7 (cEEE-7) - CACTTGCAAGGT-
GTCGTCTGCCCTC) primers, followed by a nested set of
forward (P5 (EEE-5) - AAGTGATGCAAATCCAACTC-
GAC) and reverse (P6 (cEEE-6) - GGAGCCACACG-
GATGTGACACAA) primers, was used (8). The RT-PCR
mixture was similar to that described by Kuno (6). The
thermal cycling parameters varied from those of WNV as
follows: 94°C for 90 s followed by 30 cycles of 94°C for
20 s, 65°C for 35 s, 72°C for 17 s, and then a final elonga-
tion step of 72°C for 4 min. A single RT-PCR procedure
was used for SLEV. The 393-bp genomic fragment was
generated by using forward (SLE727 – GTAGCCGACG-
GTCAATCTCTGTGC) and reverse (SLE119c - ACTCG-
GTAGCCTCCATCTTCATCA) primers and using param-
eters as for WNV (9).
Bacterial Culture
Swabs of individual tissues were streaked onto 5%
bovine blood agar (BBA), Wilkins-Chalgren anaerobe
agar, mycoplasma agar, Lowenstein-Jensen agar slant, and
Hektoen Enteric agar (HE) agar (intestines only). Blood
was inoculated into thioglycolate broth and streaked onto
BBA. Inoculated media were incubated at 30°C with
duplicate blood agar plates incubated in the presence or
absence of 5% CO
2
, with the exception of the anaerobic
cultures, which were incubated at 37°C. The thioglycolate
broth was subcultured onto BBA after 24 h. Plates were
examined each day for growth and subcultured onto BBA
as needed. Bacterial colonies selected from pure cultures
were Gram stained. Cultures were injected into Sensititre
(Trek Diagnostic Systems, Westlake, OH) gram-negative
AP80 or gram-positive AP90 autoidentification plates and
the antibiotic sensitivity plate CMVIECOF and allowed to
incubate for 18 h at 37°C before automated reading of the
reactions per the manufacturer’s directions. Any isolates
that failed to be identified by the Sensititre system were
identified by using the RapID NF Plus System (Remel,
Norcross, GA) or the API20E system (API Analytab
Products, Plainview, NY).
Results
Clinical Findings
The affected alligators appeared to “star gaze” in the
water just before death, suggesting neurologic lesions (10).
Alligators sometimes became stranded in the dry part of
the pen with loss of leg control and neck spasms. No long-
term signs of stress were noted, and most animals were
eating well until a few days before death. The hatchlings
(approximately 30-cm long at the time of the epizootic)
and juveniles (1–2 m long) seemed to be more severely
affected.
A specific pattern of transmission was not noted in
2001. However, in 2002, the alligator deaths initially
occurred in one building and spread throughout the build-
ing in the opposite direction from that taken to feed and
clean the animals. At least one interruption of chlorine
addition to flush water occurred before the 2002 epizootic.
Deaths were not incurred in the breeding colony, and no
deaths were reported in birds that inhabited the rookery.
Gross Findings
2001
Both Florida and Georgia stock animals were affected,
but, in general, the Florida stock was affected first.
Initially, three juvenile alligators were sent for necropsy
during the 2001 epizootic. In general, the alligators were in
good to excellent body condition. One alligator had
approximately 25 mL of serosanguinous fluid in the peri-
cardial sac and 50 mL yellow serous fluid in the peritoneal
cavity. Two of the three had yellow-tan, caseous necrosis
of the palatine tonsils and multiple caseous yellow-tan
plaques, 2- to 10-mm in diameter, on the mucosal surfaces
of the esophagus, corpus, and pars pylorica. Only scant
ingesta were noted throughout the gastrointestinal (GI)
tract, and the intestinal mucosa was hemorrhagic in rare
instances. The liver and spleen of one alligator had multi-
ple 1- to 3-mm tan foci scattered throughout the parenchy-
ma. One alligator was in poor to moderate body condition
and had scattered bronchiectasis, no ingesta throughout the
GI tract, and mild multifocal serous atrophy of fat. No
other gross lesions were noted.
Approximately 2 months after the 2001 epizootic
began, another juvenile, live alligator was submitted to our
laboratory. The gross lesions were similar to those
described above but with numerous 1- to 3-mm tan foci in
the parenchyma of the liver, spleen, and kidneys.
2002
Three alligators were examined from the fall 2002 epi-
zootic, two juveniles and a hatchling. The two juveniles
had lesions similar to those described in the previous year.
796 Emerging Infectious Diseases • Vol. 9, No. 7, July 2003
RESEARCH

The liver and kidneys of the hatchling were pale and mot-
tled tan/brown. Ingesta were scant throughout the GI tract.
The free-ranging alligator was in excellent body condition.
No significant gross changes were noted in its tissues.
Light Microscopic Findings
2001
Tissues of the alligators from the 2001 epizootic were
examined and were similar in two of the three alligators. In
the brain, rare glial nodules that contained occasional het-
erophils were present (Figure 1). The spleen was congest-
ed with moderate diffuse reticuloendothelial hyperplasia
and moderate numbers of heterophils. The tonsil had
severe multifocal coalescing areas of caseous necrosis and
heterophilic inflammation with reactive lymphoid follicu-
lar hyperplasia. In the esophagus, a focally extensive,
mixed ulcerative, and proliferative lesion was present; it
had a marked mixed but predominantly mononuclear
inflammation, colonies of bacteria, and extensive fibrin
deposition. In the liver, multifocal lymphoplasmacytic
aggregates and heterophilic granulomas were present, con-
sisting of caseous necrotic foci with degenerate heterophils
surrounded by an outer layer of macrophages, lympho-
cytes, and heterophils. The lungs were congested with mild
diffuse or patchy lymphoplasmacytic and heterophilic
interstitial infiltrates. The kidney had multifocal het-
erophilic granulomas. The pars pylorica region of the
stomach had multifocal mucosal abscesses and moderate
diffuse lymphoplasmacytic and heterophilic infiltrates of
the lamina propria. The small intestine had moderate, dif-
fuse mucosal and submucosal infiltrates of lymphocytes,
heterophils, and plasma cells and multifocal areas of acute
necrosis associated with bacteria. The remaining tissues
appeared within normal limits. Special stains for fungi and
acid-fast bacteria were negative. A population of primarily
gram-negative and fewer gram-positive bacteria was
observed in the heterophilic granulomas.
The third alligator had primarily pulmonary changes.
The airways contained moderate numbers of heterophils,
occasional mucous plugs with degenerate inflammatory
cells, and scattered bacterial colonies. The remaining tis-
sues were as described for the first two alligators.
Tissues from the alligator seen 2 months after the epi-
zootic had similar findings to those of the first two alliga-
tors with the addition of rare, small caseating granulomas
within the lungs. The granulomas contained numerous
large macrophages and multinucleated cells. Acid-fast
stains demonstrated low numbers of slender, beaded, acid-
fast positive bacilli consistent with mycobacteria.
2002
Multiple tissues from the two juvenile alligators from
the 2002 epizootic were examined. The tissue changes
were similar to those described for the 2001 epizootic
except that the inflammatory component was primarily
heterophils. The meninges within the brain and all spinal
cord sections except those from the sacral spinal cord had
stasis of heterophils within the blood vessels and perivas-
cular infiltration of mild numbers of heterophils (Figure 1).
One alligator had a small focus of macrophages and het-
erophils noted within the endocardium.
Multiple tissues were examined from the hatchling alli-
gator, and lesions differed from the previous submissions
on the basis of cellular composition of the inflammatory
cell infiltrates. Lymphoplasmacytic perivascular cuffs were
present throughout the brain and meninges (Figure 1).
Rarely, heterophils were admixed within the cuffs. Similar
changes were not seen within the spinal cord. Random foci
of necrosis were seen within the liver, pancreas, and tonsil.
Mild to moderate perivascular infiltrates of lymphocytes,
plasma cells, and heterophils were seen within the kidney
and heart, and similar but fewer numbers of infiltrates were
seen within the pulmonary interstitium. The heart had mul-
tiple, random foci of patchy vacuolar degeneration of the
myocytes and random aggregates of lymphocytes, plasma
cells and heterophils. Mild numbers of mixed inflammato-
ry cells were seen within the intestinal lamina propria. The
remaining tissues were unremarkable. Major pathologic
changes were not observed by light microscopy in the tis-
sues from the free-ranging alligator.
Virus Isolation/RT-PCR
Virus isolation was negative for all animals from the
2001 epizootic. WNV was isolated from tissues from all
animals in the 2002 epizootic. Additionally, all animals
from the 2002 epizootic and one animal from the 2001 epi-
zootic were positive for WNV by RT-PCR from fresh or
Emerging Infectious Diseases • Vol. 9, No. 7, July 2003 797
RESEARCH
Figure 1. Perivascular changes observed within the brain of alliga-
tors infected with West Nile virus (400x). A. Perivascular infiltrates
were composed of primarily lymphocytes, plasma cells, and
macrophages in the hatchling alligator. B. Perivascular infiltrates
were composed of primarily heterophils (arrows) in juvenile alliga-
tors.

formalin-fixed, paraffin-embedded tissues (Figure 2). In
general, liver was the most likely tissue to yield positive
results. Positive results were not obtained from any of the
tissues from the free-ranging alligator. All tissues tested
negative by RT-PCR for EEEV and SLEV. Retrospective
attempts to culture WNV at both 37°C and room tempera-
ture on FHM, CCO, EPC, and WWS cells were negative.
Aliquots from the horsemeat that was being fed during
the 2002 epizootic tested positive for WNV by RT-PCR
(Figure 2). Aliquots of the horsemeat from two postepi-
zootic shipments were negative for WNV by RT-PCR.
Bacterial Culture
Aeromonas sobria and Edwardsiella tarda were consis-
tently cultured from the intestines. These organisms and
occasionally others (Escherichia coli, Pseudomonas fluo-
rescens, α- and β-hemolytic Streptococcus) were isolated
from various tissues (liver, lung, and kidney) from the alli-
gators dying during the 2001 epizootics and the juveniles
from the 2002 epizootics. Alcaligenes spp. were isolated
from a tonsil swab in one of the animals in 2001.
Salmonella Group D was isolated from the intestines of the
hatchling alligator submitted in 2002.
Discussion
The histologic findings from the hatchling alligator
were most suggestive of a viral etiology, whereas those of
the older alligators were most suggestive of a primary bac-
terial cause. Given that both the RT-PCR and virus isola-
tion were positive for WNV, that virus is suspected to be
the underlying cause of both epizootics. Contaminated
horsemeat is the presumed source of the outbreak. We
speculate that the WNV infection led to the alligators’
immune systems’ becoming immunocompromised, which
resulted in the animals being more susceptible to various
environmental stressors and subsequent invasion by
opportunistic pathogens. Failure to isolate virus from the
alligators in 2001 may have been due to the inability of the
virus to propagate in the four cell lines used (FHM, CCO,
EPC, and WWS cells), as determined by retrospective cul-
ture attempts, rather than absence of virus.
Two important points to examine further are time of
year and age of affected animals. Both epizootics occurred
in the late fall to early winter. Although the epizootics
appeared to be correlated with the first abrupt drop in envi-
ronmental temperature, this finding was likely coinciden-
tal, especially given that the animals were housed in envi-
ronmentally controlled barns. The most likely factor in the
time of year is correlation with the occurrence of WNV
infection in horses. Historically, horses become infected
with WNV during the mosquito season (summer through
early fall). Undiagnosed WNV-infected animals sold for
food would most likely end up in the food supply during
the late summer and early fall months. As was found in this
study, deaths traced to consumption of contaminated food
would taper off in late fall or early winter as the food sup-
ply was less likely to contain virus. Furthermore, all ani-
mals have equal potential for viral exposure through con-
sumption because individual packages of horsemeat are
combined before mixing with the vitamin supplements and
being divided between all barns. In general, reptiles
achieve immunocompetence at an early age (often in a
matter of days), but this immunocompetence may be tem-
perature dependent until the animals are several months of
age (11). This fact may partially explain why the hatchling
alligators tended to die from the viral infection, whereas
the juveniles tended to die from infections caused by sec-
ondary invaders.
Extrinsic stressors may have increased certain animals’
susceptibility to the virus or opportunistic pathogens. For
example, the pens where the epizootics originated tended
to be the first to be washed out at 6 a.m., the coolest time
of the day. During the first abrupt drop in environmental
temperature, the first wash water was possibly cooler
because of colder water in the line between the boiler and
the pens. This cold stressor would serve as a shock to the
animals’ systems. During the 2002 outbreak, an additional
stress was internal construction, undertaken 2 weeks before
the epizootic within the initially affected building. The
environmental (temperature and darkness) control of the
building was maintained during this time, but silence was
not maintained. Additionally, sanitation-related stress may
have occurred during periods of intermittent flushing, such
as over weekends and during pen renovation activities.
Whether brood stock source had an affect on the sus-
ceptibility of the animals is not clear. Although Florida
stock animals were those initially affected, this finding
was likely coincidental because of their location in the
pens. The pens that were more exposed to external stres-
798 Emerging Infectious Diseases • Vol. 9, No. 7, July 2003
RESEARCH
Figure 2. West Nile virus (WNV) reverse transcription-polymerase
chain reaction results from epizootic die-offs in farm-raised alliga-
tors. The expected amplicon is 248 bp. Lane 1, a 100-bp molecu-
lar weight ladder. Lane 2, the positive WNV control. Lane 3, fresh
tissue samples from a juvenile alligator in the 2002 epizootic. Lane
4, virus isolation cell homogenate from a juvenile alligator in the
2002 epizootic. Lane 5, horsemeat that was being fed to alligators
during the 2002 epizootic. Lane 6, initial postepizootic horsemeat
shipment. Lanes 7, 8, and 9, formalin-fixed, paraffin-embedded tis-
sues of juvenile alligators in 2001 and 2002. Lane 10, fresh tissue
from a wild alligator. Lane 11, negative WNV control.

sors contained Florida animals. Additionally, most animals
in the production unit are from Florida brood stock.
Several management recommendations were suggested
to the producer. The primary recommendation was to stop
feeding horsemeat and switch to another food source such
as beef or fish. We also recommended that the water tem-
perature be reduced to 29.4°C in an attempt to reduce the
stress of rapid growth and perhaps produce an environment
less conducive for viremia. To date, neither of these rec-
ommendations has been implemented, but subsequent
horsemeat shipments have tested negative. Future investi-
gation will include the testing of the eggs from the brood
stock, clinically healthy animals, rookery birds, and free-
ranging alligators to explore the epidemiology of this virus
in ectotherms.
Acknowledgments
We thank the staff of The University of Georgia Tifton
Veterinary Diagnostic and Investigational Laboratory for help in
processing the samples.
Dr. Miller is an assistant professor in the Department of
Pathology at the University of Georgia (UGA) College of
Veterinary Medicine. She works as a veterinary pathologist at the
UGA Tifton Veterinary Diagnostic and Investigational
Laboratory. Her research interests are in wildlife disease and
reproduction.
References
1. Doi R, Oya A, Shirasaka A, Yabe S, Sasa M. Studies on Japanese
encephalitis virus infection of reptiles. II. Role of lizards on hiberna-
tion of Japanese encephalitis virus. Jpn J Exp Med 1983;53:125–34.
2. McLean RG, Ubico SR, Bourne D, Komar N. West Nile virus in live-
stock and wildlife. Curr Top Microbiol Immunol 2002;267:271–308.
3. Nir Y, Lasowski Y, Avivi A, Cgoldwasser R. Survey for antibodies to
arboviruses in the serum of various animals in Israel during
1965–1966. Am J Trop Med Hyg 1969;18:416–22.
4. Thomas LA, Patzer ER, Cory JC, Coe JE. Antibody development in
garter snakes (Thamnophis spp.) experimentally infected with west-
ern equine encephalitis virus. Am J Trop Med Hyg 1980;29:112–7.
5. Oya A, Doi R, Shirasaka A, Yabe S, Sasa M. Studies on Japanese
encephalitis virus infection of reptiles. I. Experimental infection of
snakes and lizards. Jpn J Exp Med 1983;53:117–23.
6. Kuno G. Universal diagnostic RT-PCR protocal for arboviruses. J
Virol Methods 1998;72:27–41.
7. Johnson DJ, Ostlund EN, Pedersen DD, Schmitt BJ. Detection of
North American West Nile virus in animal tissue by a reverse tran-
scription-nested polymersase chain reaction assay. Emerg Infect Dis
2001;7:739–41.
8. Linssen B, Kinney RM, Aquilar P, Russell KL, Watts DM, Kaaden
OR, et al. Development of reverse transcription-PCR assays specific
for detection of equine encephalitis viruses. J Clin Microbiol
2000;38:1527–35.
9. Lanciotti RS, Kerst AJ. Nucleic acid sequence-based amplification
assays for rapid detection of West Nile and St. Louis encephalitis
viruses. J Clin Microbiol 2001;39:4506–13.
10. Done LB. Postural Abnormalities. In: Mader DR, editor. Reptile med-
icine and surgery. Philadelphia: W.B. Saunders Co; 1996. p. 406–11.
11. Frye FL. Biomedical and surgical aspects of captive reptile hus-
bandry, Vol 1. 2nd edition. Malabar (FL): Krieger Publishing Co;
1991.
Address for correspondence: Debra L. Miller, University of Georgia,
Veterinary Diagnostic and Investigational Laboratory, Tifton, GA 31793,
USA; fax: 229-386-7128; email: dmiller@tifton.uga.edu
Emerging Infectious Diseases • Vol. 9, No. 7, July 2003 799
RESEARCH
The opinions expressed by authors contributing to this journal do
not necessarily reflect the opinions of the Centers for Disease
Control and Prevention or the institutions with which the authors
are affiliated.