Project

Transcriptomics of Leishmania

Goal: Annotation of transcripts for Leishmania major, L. infantum, L. donovani and L. braziliensis --
See: http://leish-esp.cbm.uam.es

Methods: RNA sequencing (RNA-seq)

Updates
0 new
19
Recommendations
0 new
27
Followers
0 new
38
Reads
2 new
661

Project log

Jose M Requena
added a research item
Abrupt environmental changes are faced by Leishmania parasites during transmission from a poikilothermic insect vector to a warm-blooded host. Adaptation to harsh environmental conditions, such as nutrient deprivation, hypoxia, oxidative stress and heat shock needs to be accomplished by rapid reconfiguration of gene expression and remodeling of protein interaction networks. Chaperones play a central role in the maintenance of cellular homeostasis, and they are responsible for crucial tasks such as correct folding of nascent proteins, protein translocation across different subcellular compartments, avoiding protein aggregates and elimination of damaged proteins. Nearly one percent of the gene content in the Leishmania genome corresponds to members of the HSP40 family, a group of proteins that assist HSP70s in a variety of cellular functions. Despite their expected relevance in the parasite biology and infectivity, little is known about their functions or partnership with the different Leishmania HSP70s. Here, we summarize the structural features of the 72 HSP40 proteins encoded in the Leishmania infantum genome and their classification into four categories. A review of proteomic data, together with orthology analyses, allow us to postulate cellular locations and possible functional roles for some of them. A detailed study of the members of this family would provide valuable information and opportunities for drug discovery and improvement of current treatments against leishmaniasis.
Jose M Requena
added an update
A new assembly for the Leishmania major (Friedlin strain) genome has been generated
The genome sequence for the L. major Friedlin strain was published in 2005 (Ivens et al., 2005). This represented a milestone for Leishmania molecular biology studies, and it continues to be the reference genome in the field. However, despite its relevance, this genome assembly cannot be considered as the definitive ‘set on stone’ genome. In fact, previous studies documented some deficiencies (Alonso et al., 2016).
As reported in a recent article, we have sequenced and de novo assembled the L. major (Friedlin) genome by a combination of two sequencing procedures: the Pacific Biosciences (PacBio) technology, which provides long reads able to span long repeats, and the Illumina technology, which generates paired-end short-reads, but useful to correct PacBio sequencing errors and to extend the chromosomal ends (Camacho et al., 2021). A comparison between the recently assembled genome (named LMJFC) and the previous one (known as LmjF) evidenced that the LmjF assembly was excellent, but the LMJFC assembly incorporates those previously sequences noted as absent and adds some refinements regarding the number of gene copies and gene organization in some loci. We have contacted TriTrypDB to deposit the new L. major genome (LMJFC) sequence and annotation. Meanwhile, these are available at:
Finally, it should be noted that in the indicated article (Camacho et al., 2021), it was published the transcriptome and gene models. This information may be also accessed through the Leish-ESP web page.
References
- Alonso, G., Rastrojo, A., López-Pérez, S., Requena, J.M., and Aguado, B. (2016). Resequencing and assembly of seven complex loci to improve the Leishmania major (Friedlin strain) reference genome. Parasites and Vectors 9, 74.
- Camacho, E., González-de la Fuente, S., Solana, J.C., Rastrojo, A., Carrasco-Ramiro, F., Requena, J.M., and Aguado, B. (2021). Gene annotation and transcriptome delineation on a de novo genome assembly for the reference leishmania major Friedlin strain. Genes (Basel). 12, 1359.
- Ivens, A.C., Peacock, C.S., Worthey, E.A., Murphy, L., Aggarwal, G., Berriman, M., Sisk, E., Rajandream, M.A., Adlem, E., Aert, R., et al. (2005). The Genome of the Kinetoplastid Parasite, Leishmania major. Science 309, 436–442.
 
Jose M Requena
added an update
The genome for Leishmania donovani HU3 strain is now available at TriTryp.DB
We are proud to announce that the genome assembly for the HU3 strain (MHOM/ET/67/HU3) of L. donovani has been incorporated in the TriTryp database (https://tritrypdb.org/). Thus, interested people may use the valuable resources and tools available at TriTryp for scrutiny genes, proteins, sequences and other data for this strain, which is a classical strain of L. donovani, used by many laboratories.
The genome for this strain was assembled by a combination of Illumina and PacBio sequencing methodologies (Camacho et al., 2019). Additionally, the poly-A transcriptome was determined for promastigotes of this strain by RNA sequencing (RNA-seq). This information is not yet available at TriTryp, but we are working on it. Meanwhile, people interested in getting information about the annotated transcripts and download their sequences can visit our laboratory webpage Leish-ESP(http://leish-esp.cbm.uam.es/). Additionally, in order to maintain all these data curated and updated, we are creating Wikidata(www.wikidata.org) and Mendeley data(data.mendeley.com) entries. These entries are also interlinked with the Leishmania infantum ones, which incorporate data from scientific literature for those already studied genes/proteins. We will inform you further about this initiative in a near future.
Reference
Camacho, E., Gonzalez-de la Fuente, S., Rastrojo, A., Peiro-Pastor, R., Solana, J.C., Tabera, L., Gamarro, F., Carrasco-Ramiro, F., Requena, J.M., and Aguado, B. (2019). Complete assembly of the Leishmania donovani (HU3 strain) genome and transcriptome annotation. Sci Rep 9, 6127. https://rdcu.be/bxaEi
 
Jose M Requena
added 2 research items
Leishmania parasites must deal with stressful environmental conditions (thermal, nutritional and oxidative) along their digenetic life cycles. This requires drastic changes in gene expression, which in this parasite occurs mainly through post-transcriptional mechanisms involving RNA binding proteins (RBPs). PUF proteins, a class of RBPs existing in most eukaryotic organisms, might play too an essential role modulating the fate of mRNAs and regulating gene expression in Leishmania parasites. A proteomic approach to identify putative protein partners (interactome) of the Leishmania major PUF1 protein was performed. The PUF1 interactome was characterized by co-immunoprecipitation using L. major cellular extracts and an anti-LiPUF1 antibody, and a subsequent analysis of the co-immunoprecipitated proteins by mass-spectrometry, identifying 90 LmPUF1 candidate partners. Remarkably, many of the identified proteins are other RBPs and/or putative P bodies and mRNA-exporting machinery components. Raw mass spectrometry data are available via ProteomeXchange with identifier PXD022581.
Leishmania major is the main causative agent of cutaneous leishmaniasis in humans. The Friedlin strain of this species (LmjF) was chosen when a multi-laboratory consortium undertook the objective of deciphering the first genome sequence for a parasite of the genus Leishmania. The objective was successfully attained in 2005, and this represented a milestone for Leishmania molecular biology studies around the world. Although the LmjF genome sequence was done following a shotgun strategy and using classical Sanger sequencing, the results were excellent, and this genome assembly served as the reference for subsequent genome assemblies in other Leishmania species. Here, we present a new assembly for the genome of this strain (named LMJFC for clarity), generated by the combination of two high throughput sequencing platforms, Illumina short-read sequencing and PacBio Single Molecular Real-Time (SMRT) sequencing, which provides long-read sequences. Apart from resolving uncertain nucleotide positions, several genomic regions were reorganized and a more precise composition of tandemly repeated gene loci was attained. Additionally, the genome annotation was improved by adding 542 genes and more accurate coding-sequences defined for around two hundred genes, based on the transcriptome delimitation also carried out in this work. As a result, we are providing gene models (including untranslated regions and introns) for 11,238 genes. Genomic information ultimately determines the biology of every organism; therefore, our understanding of molecular mechanisms will depend on the availability of precise genome sequences and accurate gene annotations. In this regard, this work is providing an improved genome sequence and updated transcriptome annotations for the reference L. major Friedlin strain.
Jose M Requena
added a research item
Leishmania infantum causes visceral leishmaniasis (kala-azar), the most severe form of leishmaniasis, which is lethal if untreated. A few years ago, the re-sequencing and de novo assembling of the L. infantum (JPCM5 strain) genome was accomplished, and now we aimed to describe and characterize the experimental proteome of this species. In this work, we performed a proteomic analysis from axenic cultured promastigotes and carried out a detailed comparison with other Leishmania experimental proteomes published to date. We identified 2352 proteins based on a search of mass spectrometry data against a database built from the six-frame translated genome sequence of L. infantum. We detected many proteins belonging to organelles such as glycosomes, mitochondria, or flagellum, as well as many metabolic enzymes and many putative RNA binding proteins and molecular chaperones. Moreover, we listed some proteins presenting post-translational modifications, such as phosphorylations, acetylations, and methylations. On the other hand, the identification of peptides mapping to genomic regions previously annotated as non-coding allowed for the correction of annotations, leading to the N-terminal extension of protein sequences and the uncovering of eight novel protein-coding genes. The alliance of proteomics, genomics, and transcriptomics has resulted in a powerful combination for improving the annotation of the L. infantum reference genome.
Jose M Requena
added an update
Articles in this Special Issue are being published, some on-coming articles are announced and interested authors are on time for submitting their works. The success of this Special Issue depends on renowned authors as you. Thank you for your support!
For further reading, please follow the link to the Special Issue Website at: https://www.mdpi.com/journal/genes/special_issues/kinetoplastid_genomics
 
Jose M Requena
added an update
Mechanisms of gene expression in Leishmania are similar to those found in other kinetoplastids, like Trypanosoma brucei and Trypanosoma cruzi. Moreover, these organisms share the doubtful honour of being terrible pathogens. However, within this group of organisms, there are parasites for plants (Phytomonas spp.) and insects (Leptomonas, Crithidia, and other genera), having also a tremendous economic impact. In addition, free-living kinetoplastids are abundant and active microbial predators in terrestrial and aquatic ecosystems. Therefore, by comparing the molecular biology aspects for each one of this diverse and successful group of protists, a huger knowledge of the peculiar mechanisms of gene expression in kinetoplastids will result.
Bearing this aim in mind, we are editing a Special Issue on “Kinetoplastid Genomics and Beyond” in the journal Genes (ISSN 2073-4425; IF 3.331). The purpose of this Special Issue is to bring together a set of reviews and research articles addressing aspects like genome organization, mechanisms of gene expression, specific metabolic pathways, evolutionary relationships and databases, among others, focused on any species belonging to this group of protists.
Authors will obtain a 15% discount from the publication fees. For further reading, please follow the link to the Special Issue Website at: https://www.mdpi.com/journal/genes/special_issues/kinetoplastid_genomics
 
Jose M Requena
added an update
Utilizing Wikidata to improve gene annotations through individual contributions.- Genome sequencing of a given organism is a basic step for deciphering gene content, genome structure, transcriptome, proteome and so on. However, the biological data are not deduced straightforward from the primary sequence. On the other hand, the contributions of thousands of scientists around the world have to be integrated into the genome databases to enrich the knowledge of a given organism. Although this is the objective of database curators, they are overtaken by the increasing number of genomes that are continuously deposited. The ideal situation would be that every time a scientist uncovers a biological feature of a given organism, these new data may be incorporated directly by the scientist into the database. However, this is not favoured by the closed structure of the databases themselves.
Nevertheless, Wikidata, a resource operated by the Wikimedia Foundation, may be useful to fill the gap between scientists and databases. In order to improve the gene annotations of the Leishmania infantum genome, we are creating Wikidata for every gene in this organism. Currently, there are around one thousand of them that can be acceded directly by the gene ID (e.g. LINF_240014100) and/or protein product name. Functional annotations, orthologs, sequences can be found. Importantly, within each entry, we are incorporating bibliographic information from the primary literature.
The relevance of this initiative is found in the fact that these Wikidata can be freely modified by anybody (scientists and scholars) that has/finds a piece of new information for a given gene/protein/transcript. Moreover, there is not a restriction in the language usage, information can be added in some of the many languages supported by Wikipedia.
References
Burgstaller-Muehlbacher S, Waagmeester A, Mitraka E, Turner J, Putman T, Leong J, Naik C, Pavlidis P, Schriml L, Good BM et al. 2016. Wikidata as a semantic framework for the Gene Wiki initiative. Database (Oxford) 2016: 1-10. PMID: 26989148
 
Jose M Requena
added a research item
Besides their medical relevance, Leishmania is an adequate model for studying post-transcriptional mechanisms of gene expression. In this microorganism, mRNA degradation/stabilization mechanisms together with translational control and post-translational modifications of proteins are the major drivers of gene expression. Leishmania parasites develop as promastigotes in sandflies and as amastigotes in mammalians, and during host transmission, the parasite experiences a sudden temperature increase. Here, changes in the transcriptome of Leishmania major promastigotes after a moderate heat shock were analysed by RNA-seq. Several of the up-regulated transcripts code for heat shock proteins, other for proteins previously reported to be amastigote-specific and many for hypothetical proteins. Many of the transcripts experiencing a decrease in their steady-state levels code for transporters, proteins involved in RNA metabolism or translational factors. In addition, putative long noncoding RNAs were identified among the differentially expressed transcripts. Finally, temperature-dependent changes in the selection of the spliced leader addition sites were inferred from the RNA-seq data, and particular cases were further validated by RT-PCR and Northern blotting. This study provides new insights into the post-transcriptional mechanisms by which Leishmania modulate gene expression.
Jose M Requena
added an update
The combination of Illumina and PacBio sequencing has allowed the complete assembly of the genome (36 chromosomes) for the strain HU3 (MHOM/ET/67/HU3) of L. donovani. A total of 8,595 genes were annotated. Additionally, the poly-A transcriptome was determined for promastigotes of this strain by RNA sequencing (RNA-seq). As a result, 10,893 transcripts/gene models were defined. Among them, 2,410 would represent novel genes (currently lacking protein-coding annotation). cis-splicing was demonstrated for two genes (LDHU3_07.0430 and LDHU3_29.3990). This work has been published in the journal Scientific Reports (see below). The genome sequence, gene annotation and transcriptome files can be downloaded at Leish-ESP (http://leish-esp.cbm.uam.es/). Furthermore, at this website, particular information for individual genes can be easily obtained through the browser tool.
Reference
Camacho, E., Gonzalez-de la Fuente, S., Rastrojo, A., Peiro-Pastor, R., Solana, J.C., Tabera, L., Gamarro, F., Carrasco-Ramiro, F., Requena, J.M., and Aguado, B. (2019). Complete assembly of the Leishmania donovani (HU3 strain) genome and transcriptome annotation. Sci Rep 9, 6127.
 
Jose M Requena
added a research item
Leishmania donovani is a unicellular parasite that causes visceral leishmaniasis, a fatal disease in humans. In this study, a complete assembly of the genome of L. donovani is provided. Apart from being the first published genome of this strain (HU3), this constitutes the best assembly for an L. donovani genome attained to date. The use of a combination of sequencing platforms enabled to assemble, without any sequence gap, the 36 chromosomes for this species. Additionally, based on this assembly and using RNA-seq reads derived from poly-A + RNA, the transcriptome for this species, not yet available, was delineated. Alternative SL addition sites and heterogeneity in the poly-A addition sites were commonly observed for most of the genes. After a complete annotation of the transcriptome, 2,410 novel transcripts were defined. Additionally, the relative expression for all transcripts present in the promastigote stage was determined. Events of cis-splicing have been documented to occur during the maturation of the transcripts derived from genes LDHU3_07.0430 and LDHU3_29.3990. The complete genome assembly and the availability of the gene models (including annotation of untranslated regions) are important pieces to understand how differential gene expression occurs in this pathogen, and to decipher phenotypic peculiarities like tissue tropism, clinical disease, and drug susceptibility.
Jose M Requena
added an update
We are proud to announce that an improved assembly for the genome of Leishmania braziliensis (strain M2904) has been generated. The combination of Illumina (short reads) and PacBio (long reads) sequencing data has allowed the assembling, without gaps, of the genome into 35 contigs, i.e. the 35 chromosomes existing in this species. Additionally, a new gene annotation has been created. The work has been published in the journal Memórias do Instituto Oswaldo Cruz (see below). The genome sequence and gene annotation files can be downloaded at Leish-ESP (http://leish-esp.cbm.uam.es/). Furthermore, at this web page, particular information for an individual gene can be easily obtained through the browser tool.
Reference.
Gonzalez-de la Fuente, S., Camacho, E., Peiro-Pastor, R., Rastrojo, A., Carrasco-Ramiro, F., Aguado, B. and Requena, J.M. (2018). Complete and de novo assembly of the Leishmania braziliensis (M2904) genome. Mem Inst Oswaldo Cruz 114, e180438.
 
Jose M Requena
added a research item
Leishmania braziliensis is the etiological agent of American mucosal leishmaniasis, one of the most severe clinical forms of leishmaniasis. Here, we report the assembly of the L. braziliensis (M2904) genome into 35 continuous chromosomes. Also, the annotation of 8395 genes is provided. The public availability of this information will contribute to a better knowledge of this pathogen and help in the search for vaccines and novel drug targets aimed to control the disease caused by this Leishmania species.
Jose M Requena
added a research item
We have assembled the Leishmania braziliensis genome; this file contains the gene annotation for this new assembly
Jose M Requena
added an update
As it is announced in the TriTrypDB 39 Release (30 August 2018; http://tritrypdb.org/tritrypdb/showXmlDataContent.do?name=XmlQuestions.News#TriTrypDB08_18_release), the genome sequence and annotation for L. infantum JPCM5 (MCAN/ES/98/LLM-724) has been updated through the incorporation of the data generated by our group (Gonzalez-de-la-Fuente et al, 2017). As a result, the genomic information of this Leishmania species has been integrated into the TriTrypDB database and it is fully searchable using the excellent resources available at this valuable Server. Our gratitude to the TriTryp team for their hard work in incorporating this information into the database.
Our commitment with TriTryp database in particular and with all you is to make a continuous curation of the information and the incorporation of additional data generated by us or other groups. In parallel, we will maintain (and curate) this information at our web site, Leish-ESP (http://leish-esp.cbm.uam.es/).
Reference:
Gonzalez-de la Fuente, S., Peiro-Pastor, R., Rastrojo, A., Moreno, J., Carrasco-Ramiro, F., Requena, J.M., and Aguado, B. (2017). Resequencing of the Leishmania infantum (strain JPCM5) genome and de novo assembly into 36 contigs. Sci Rep 7, 18050.
 
Jose M Requena
added an update
A few days ago, a new version (v2/2018) of the genome for this L. infantum strain has been generated. The FASTA file of the genome and the annotation file are available at Leish-ESP to be downloaded.
In the new version, around a hundred of point deletions has been corrected. For the assembly of this genome, two sequencing platforms (Illumina and PacBio) were used. It is well known that Illumina sequencing is more accurate than PacBio sequencing. Thus, after assembling the genome based on PacBio reads, the sequence was corrected by mapping the Illumina reads on the genome assembly (see Gonzalez-de-la-Fuente et al (2017) for further details). However, recently we realized that PacBio sequencing, in G/C-rich homopolymers, sometimes generate sequences with point deletions at frequencies above 90%. To solve this, Sandra Gonzalez de la Fuente and Esther Camacho have combined ad hoc scripts and visual revision to correct these sequence errors existing in the previous version. Interestingly, as a result, several pseudogenes are now bona fide genes.
There is not any genome assembly that can be considered as set in stone, and the L. infantum genome is not an exception. Nevertheless, we can affirm that the new version is better than the previous one. Furthermore, it is our commitment to actively curate this assembly and incorporate possible modifications quickly in our web site. Additionally, we are in contact with TriTrypDB to have this assembly also available in this database.
Finally, we encourage to the users of this genome assembly to contact (leish-esp@cbm.csic.es) and inform us about inconsistencies or suggestions.
References:
Gonzalez-de la Fuente, S., Peiro-Pastor, R., Rastrojo, A., Moreno, J., Carrasco-Ramiro, F., Requena, J.M., and Aguado, B. (2017). Resequencing of the Leishmania infantum (strain JPCM5) genome and de novo assembly into 36 contigs. Sci Rep 7, 18050.
 
Jose M Requena
added an update
Transcriptomic and proteomic data are generating lists of genes and proteins whose expression levels vary according to environmental changes. On the other hand, there is an extremely valuable work done by thousands of scientists, described in scientific articles, about the functional characterization of proteins, the phenotypic analysis of specific mutant lines, the subcellular location of proteins and so on. A better knowledge of the Leishmania biology will emerge when both experimental approaches had converged.
Bearing in mind this objective, we are doing an active search in the scientific literature for descriptions of molecular and cellular aspects related to particular genes of Leishmania. In addition, we have compiled relevant studies of ortholog genes/proteins that have been conducted on related trypanosomatids.
Currently, we have linked more than 800 articles to specific gene entries of Leishmania.
Steps to get this information at Leish-ESP (http://leish-esp.cbm.uam.es):
1. Go to the L. major Browser.
2. Search for the gene of interest by gene ID or associated function. Gene IDs correspond to L. major genes, but it is possible to find the gene correspondence between L. major and L. infantum using the L. infantum browser. For other Leishmania species, orthology can be found at GeneDB.org and TriTrypDB.org.
3. Click on ‘Additional Information’ and a new page will be opened. At the bottom of the page, you will find the ‘Associated PubMed publications’ with active links to the PubMed server.
If you find inconsistencies or have suggestions (additional references), please, feel free to contact us at leish-esp@cbm.csic.es
 
Jose M Requena
added 2 research items
In the present paper we describe the isolation and characterization of four novel genes of the parasitic protozoan Leishmania infantum. These genes are organized as two independent gene clusters, and they are related by nucleotide sequence to eukaryotic genes encoding acidic ribosomal proteins. Each gene cluster contains two tandemly linked genes coding for identical proteins. Each of the proteins coded by the gene clusters (called LiP and LiP') are highly divergent in sequence, showing the characteristic features of eukaryotic P-proteins from the P2 group. In spite of the sequence conservation of the coding regions of each of the genes in the cluster, the 5'- and 3'-untranslated regions are heterogeneous in sequence. The analysis of the expression of these genes indicates that logarithmic phase promastigotes show increased levels of LiP- and LiP'-specific transcripts compared with stationary phase promastigotes. The steady state RNA levels of the LiP and LiP' genes show a similar dependence of the growth phase of the parasite. Using specific probes for the divergent 3'-untranslated regions of each of the genes, it was found that the abundance of the mature transcripts is different even when the transcripts are derived from the same gene cluster. These findings probably indicate that the 3'-untranslated regions may influence the stability or turnover of the transcripts derived from both LiP and LiP' gene clusters.
Two tandemly linked genes are present in the Leishmania infantum genome that code for the acidic ribosomal PO protein. The genes are identical in the coding region, although a striking lack of nucleotide sequence conservation is observed when the boundaries of the coding regions between both genes are compared. The 3' untranslated regions of the two genes are, moreover, different in size. The deduced amino acid sequence of the L. infantum PO protein (LiPO) shows a high degree of sequence conservation, including the highly charged conserved C-terminal domain, with the ribosomal PO proteins of other eukaryotic organisms. Northern blot experiments showed that two different size class transcripts are expressed in the gene cluster and that the steady state level of each of the transcripts in logarithmic phase promastigotes is markedly different. The abundance of both transcripts is down-regulated in parasite cultures on reaching stationary phase. Since it seems that the two Leishmania ribosomal PO genes are expressed in a single polycistronic transcript, it is likely that the different levels of PO mRNAs observed in cultured cells is due to a postranscriptional regulatory mechanism.
Jose M Requena
added a research item
Leishmaniasis is a serious medical issue in many countries around the World, but it remains largely neglected in terms of research investment for developing new control and treatment measures. No vaccines exist for human use, and the chemotherapeutic agents currently used are scanty. Furthermore, for some drugs, resistance and treatment failure are increasing to alarming levels. The aim of this work was to identify genomic and trancriptomic alterations associated with experimental resistance against the common drugs used against VL: trivalent antimony (SbIII, S line), amphotericin B (AmB, A line), miltefosine (MIL, M line) and paromomycin (PMM, P line). A total of 1006 differentially expressed transcripts were identified in the S line, 379 in the A line, 146 in the M line, and 129 in the P line. Also, changes in ploidy of chromosomes and amplification/deletion of particular regions were observed in the resistant lines regarding the parental one. A series of genes were identified as possible drivers of the resistance phenotype and were validated in both promastigotes and amastigotes from Leishmania donovani, Leishmania infantum and Leishmania major species. Remarkably, a deletion of the gene LinJ.36.2510 (coding for 24-sterol methyltransferase, SMT) was found to be associated with AmB-resistance in the A line. In the P line, a dramatic overexpression of the transcripts LinJ.27.T1940 and LinJ.27.T1950 that results from a massive amplification of the collinear genes was suggested as one of the mechanisms of PMM resistance. This conclusion was reinforced after transfection experiments in which significant PMM-resistance was generated in WT parasites over-expressing either gene LinJ.27.1940 (coding for a D-lactate dehydrogenase-like protein, D-LDH) or gene LinJ.27.1950 (coding for an aminotransferase of branched-chain amino acids, BCAT). This work allowed to identify new drivers, like SMT, the deletion of which being associated with resistance to AmB, and the tandem D-LDH-BCAT, the amplification of which being related to PMM resistance.
Jose M Requena
added a research item
5. Omics approaches for understanding gene expression in Leishmania: clues for tackling leishmaniasis Jose M Requena, Pedro J Alcolea, Ana Alonso and Vicente Larraga Pages: 77-112. DOI: https://doi.org/10.21775/9781910190838.05 Leishmaniases, a group of parasitic diseases caused by species of the genus Leishmania, afflict millions of people across the globe and cause significant morbidity and mortality. Unfortunately, vaccine and chemotherapy options are limited. The advances in whole genome sequencing have led to renewed impetus in identifying druggable targets for future development of more effective treatments. Hence, the last decade has witnessed a revolution in our understanding of the Leishmania genomes through the completion of an increasing number of genome sequencing projects for several species and strains. However, the completion of a genome sequence is not the final product, rather it is just the beginning towards the objective of linking the wealth of data encoded in millions of bases to the biological processes of an organism. Moreover, the genome features (genomics) is only a part of the problem to be solved: the genome yields on transcription, the transcriptome, which in turn yields the proteome on translation, and ultimately the proteins either produce metabolites or are modulated by them. The size of genomics, transcriptomics, proteomics and metabolomics datasets has impelled a new way of analyzing data together with the development of potent bioinformatics tools. During their life cycles, Leishmania parasites undergo significant changes in their morphology and metabolism. These changes clearly demand a developmental regulation of differential gene expression. Moreover, it is now becoming clear that epigenetic control can also regulate other aspects of the parasitic life cycle, including the control of the switch from proliferative to developmental programs, and the adaptations required for host and cellular tropisms. In: Protozoan Parasitism: From Omics to Prevention and Control | Book Publisher: Caister Academic Press Edited by: Luis Miguel de Pablos Torró and Jacob-Lorenzo Morales DOI: https://doi.org/10.21775/9781910190838
Jose M Requena
added an update
We are proud to announce the following improvements, recently incorporated into this Web server:
  • Fasta files of the de novo assembled L. infantum genome
  • File (gff) of the genes annotated in the improved L. infantum genome. Also, we have created a browser to easily find equivalent genes (orthologues) between L. major and L. infantum
  • More than 600 bibliographic references, linked to specific L. major transcripts, have been incorporated into the Additional information sheets.
  • An interactive viewer for CDS and transcripts has been added to the L. major transcriptomics section.
We hope you find helpful these novelties and would be delighted of receiving feedbacks from the users.
 
Jose M Requena
added an update
The article entitled "Resequencing of the Leishmania infantum (strain JPCM5) genome and de novo assembly into 36 contigs" have been published in Scientific Reports. This article can be freely accessed by anyone at: http://rdcu.be/C39w
As indicated in the title, the main achievement obtained in this work has been the complete assembly of the L. infantum genome by the combination of two NGS technologies. In addition to the gene annotation data, which are provided as electronic supplementary material in the journal web site, the fasta files containing the sequences of the 36 chromosomes can be downloaded at the web page Leish-ESP (https://leishseq.neocities.org/major_site.html). This information will be available soon at ENA-NCBI databases.
 
Jose M Requena
added 2 research items
Background The study of RNA binding proteins (RBPs) is of great relevance for understanding processes like post-transcriptional control of gene expression. The post-transcriptional mechanisms are particularly important in Leishmania parasites and related trypanosomatids since transcriptional regulation is almost absent in them. Thus, RBPs should be essential during the development of these parasites and for survival strategies against the adverse conditions that they face during their life-cycle. This work was aimed to do a structural and biochemical characterization of two Leishmania braziliensis proteins, which were previously found in pull-down assays using an HSP70 RNA as bait. At that time, these proteins were annotated as hypothetical proteins (LbrM.25.2210 and LbrM.30.3080) in the GeneDB database. ResultsStructural analysis indicated that these two proteins belong to evolutionarily conserved families; thus, they have been renamed accordingly as LbSCD6 (LbrM.25.2210) and LbRBP42 (LbrM.30.3080). We have demonstrated experimentally that these proteins are RBPs, in agreement with their structural features. Both proteins were able to bind to the complete 3′ UTR-II region of HSP70-type II mRNA, and to an A + U rich element (ARE) present in that UTR. Cellular localization assays suggested that both proteins are mainly distributed in the cytoplasm of promastigotes growing at 26 °C, but they accumulate in foci around the nucleus when the parasites are under heat-shock conditions. Also, our study showed that steady-state levels of LbSCD6 and LbRBP42 transcripts decreased significantly during incubation of L. braziliensis promastigotes at heat-shock temperatures. However, in these conditions, the cellular content of both proteins remained unaltered. Conclusions Our data suggest that LbSCD6 and LbRBP42, as occurs for their orthologues in other organisms, are involved in mRNA regulation, and probably they have a relevant role facing the stress conditions that L. braziliensis encounters during insect-to-mammalian transmission.
Leishmania parasites are the causative of leishmaniasis, a group of potentially fatal human diseases. Control strategies for leishmaniasis can be enhanced by genome based investigations. The publication in 2005 of the Leishmania major genome sequence, and two years later the genomes for the species Leishmania braziliensis and Leishmania infantum were major milestones. Since then, the L. infantum genome, although highly fragmented and incomplete, has been used widely as the reference genome to address whole transcriptomics and proteomics studies. Here, we report the sequencing of the L. infantum genome by two NGS methodologies and, as a result, the complete genome assembly on 36 contigs (chromosomes). Regarding the present L. infantum genome-draft, 495 new genes have been annotated, a hundred have been corrected and 75 previous annotated genes have been discontinued. These changes are not only the result of an increase in the genome size, but a significant contribution derives from the existence of a large number of incorrectly assembled regions in current chromosomal scaffolds. Furthermore, an improved assembly of tandemly repeated genes has been obtained. All these analyses support that the de novo assembled L. infantum genome represents a robust assembly and should replace the currently available in the databases.
Jose M Requena
added a research item
The genomic organization and transcription of the genes encoding the histone H3 of the protozoan parasite Leishmania infantum have been studied. It was found that there are multiple copies of the histone H3 genes distributed in chromosomal bands XIX and XIV. The nucleotide sequence of two of the L. infantum H3 genes, each one located in a different chromosome, is reported. Although the nucleotide sequence of the coding region of both genes is identical, the sequence of the 3' untranslated region is highly divergent. It was found also that there exist two different size classes of histone H3 transcripts, each one derived from a different gene, and that they are polyadenylated. The steady-state level of the transcripts dramatically decreases when the parasites enter the stationary phase of growth, suggesting a mode of regulation which is linked to the proliferation status of the cell. Unlike the replication-dependent histones, the L. infantum H3 mRNA levels do not decrease after treatment with DNA synthesis inhibitors. A comparative analysis of the sensitivity of the histone mRNA levels to DNA inhibition in the parasites L. infantum and Trypanosoma cruzi revealed the existence of different control mechanisms in histone expression in these two phylogenetically related protozoan parasites.
Jose M Requena
added a research item
Trypanosomatids represent one of the earlier groups of eukaryotic organisms in evolution. During their long evolutionary history, the trypanosomatids have developed an impressive variety of life styles and adaptations to parasitism. The parasitic cycle of these organisms is characterized by a succesion of different forms adapted to the different environments they encounter in their mammalian hosts and insect vectors. Perhaps as a reflection of their ancient origin, these organisms posses a variety of unusual molecular mechanisms that result in regulated gene expression. In this context, a general feature of gene expression in these protozoan parasites is its high regulation at post-transcriptional level. In this work, some recent advances in understanding the mechanisms of gene expression in trypanosomatids and its regulation are discussed.
Jose M Requena
added an update
An updated version for the L. major (Friedlin strain) transcriptome is now available at the web page Leish-ESP (https://leishseq.neocities.org/major_site.html). In addition, a down-loadable, fasta archive is available. This archive may be used with local BLAST software (e.g. BioEdit or similar) for searching specific transcripts using nucleotide sequences as the query.
Accordingly, the information included in the transcriptome browser (http://leishseq.cbm.uam.es/browser2.php) has been updated. By the way, we will be happy to add information providing by users regarding particular Leishmania transcripts (either from L. major or other Leishmania species).
 
Jose M Requena
added a research item
The genomic organization and expression of the hsp70 genes of Leishmania infantum were examined. In the cluster there are at least six copies of the hsp70 genes arranged in a head-to-tail tandem of 3.8-kilobase repetition units. The hsp70 gene copy (gene 6) located at the 3′ end of the tandem has a 3′-untranslated region highly divergent in sequence relative to the 3′-untranslated region of the rest of hsp70 gene copies (genes 1-5). Nuclease S1 protection assays indicated that the steady-state level of the mRNAs derived from gene 6 is about 50-fold more abundant than the transcript level derived from genes 1-5. Nuclear run-on assays showed, however, that all hsp70 genes are transcribed at similar rates. Thus, it is likely that the differences in the steady-state levels of the transcripts from the hsp70 genes should be associated with variations in their processing or maturation rates. While the abundance of the mRNAs derived from hsp70 genes 1-5 is increased by heat shock, the hsp70 gene 6 mRNA level remains unaffected. Our data showed that ongoing protein synthesis is required for the maintenance of the heat inducement, depicting, thus, a post-transcriptional mechanism of positive regulation involving a labile protein factor that would be either induced or activated during heat shock.
Jose M Requena
added a research item
In the present work, we describe the sequence, organization and expression of histone H4 genes in the protozoan parasite Leishmania infantum. The predicted L. infantum histone H4 is a polypeptide of 100 amino acids with a molecular mass of 11.5 kDa. Comparison of the amino acid sequence of Leishmania histone H4 with the rest of histone H4 sequences indicates that this is the most divergent sequence reported to date. The genomic distribution analysis of histone H4 genes indicates that there must be up to seven gene copies. A single size-class histone H4 mRNA of 0.6 kb was detected, whose level dramatically decreases from logarithmic to stationary phase. However, the Leishmania histone H4 mRNAs do not decrease in abundance following treatment with inhibitors of DNA synthesis, suggesting a regulation by a replication-independent mechanism.
Jose M Requena
added a research item
We have analysed the regulation of histone synthesis in Leishmania infantum following inhibition of DNA replication. Run-on experiments indicated that transcription rates of the genes coding for the four core histones (H2A, H2B, H3 and H4) were not affected by the inhibition with hydroxyurea of DNA synthesis. However, a dramatic decrease was observed in the newly synthesized histones after inhibition of DNA synthesis. Furthermore, the synthesis of both the histones and DNA resumed in promastigotes after removal of hydroxyurea, indicating that inhibition was reversible. Unlike most eukaryotes, in which the replication-dependent histone transcripts decrease upon a replication blockade, the levels of L. infantum histone mRNAs do not change under similar conditions. Thus the present data indicate that histone synthesis in Leishmania is tightly coupled to DNA replication by a mechanism operating at the translational level.
Jose M Requena
added a research item
The regulation of HSP70 gene expression in Leishmania infantum, in contrast to most eukaryotes, occurs by mechanisms that operate exclusively at the post-transcriptional level. During the normal growth of L. infantum promastigotes at 26 degrees C the mRNAs derived from the sixth gene of the HSP70 locus are more abundant than the mRNAs derived from the other five HSP70 genes, but only the latter transcripts accumulate after incubation at 37 degrees C. Here, it was found that the full-length 3'untranslated region (UTR) and downstream sequences of the HSP70 genes are necessary for a correct polyadenylation of both types of transcripts and responsible for the differences in the steady-state levels of the transcripts. Also, it was found that the addition of the 3'-UTR-I (common to the first five genes of the L. infantum HSP70 gene cluster) to a reporter gene is sufficient to achieve an accumulation of the corresponding transcripts at 37 degrees C. This effect was, furthermore, found to be strand dependent. A progressive shortening of the 1063-base 3'-UTR-I has shown that the temperature-dependent accumulation was lost after deletion of 364-nucleotides from the 3' end. In addition, the accumulation of reporter transcripts at 37 degrees C was not observed in a plasmid construct containing an internal deletion (region 699-816) of the 3'-UTR-I. Thus, our data suggest that RNAs derived from L. infantum HSP70 genes 1-5 contain a cis-acting sequence that functions as a positive element during heat shock.
Jose M Requena
added a research item
We have studied the genomic organization and transcription of the histone H2A genes in the protozoan parasite Leishmania infantum. In the parasite genome 2 gene clusters exist, each containing 3 H2A gene copies. Sequence analyses showed the existence of significant sequence divergence among the H2A genes, mainly in their 5'- and 3'-untranslated regions (UTRs). Also, the existence of allelic alternatives has been evidenced. Based on the divergence in the 3'UTR regions, we have defined 3 classes of H2A transcripts, which are present at different levels in L. infantum promastigotes. However, transcription of the 3 classes of H2A genes occurs at similar levels, as measured by nuclear run-on assays, indicating that their abundance is regulated post-transcriptionally. Also, differences in regulation were observed among the H2A transcripts: the levels of transcripts with 3'-UTR type I and type III are affected by growth phase whereas transcripts with 3'-UTR type II, that are barely detected, remain constant. It is likely that the complexity, in both gene organization and differential expression exhibited by the L. infantum H2A genes, is imposed by the nature of the post-transcriptional mechanisms of regulation operating in this parasite.
Jose M Requena
added a research item
The cell-cycle-dependent expression of the four core histones (H2A, H2B, H3 and H4) has been studied in the protozoan parasite Leishmania infantum. For that purpose, the cell cycle was arrested by incubation of promastigotes with the DNA synthesis inhibitor hydroxyurea, which induced an accumulation of cells stalled in G1 phase. Hydroxyurea release resulted in a semi-synchronous entry into the cell cycle, as determined by flow cytometry. The steady-state levels of histone mRNAs in the G1, S and G2/M phases were found to be constant along the cell cycle. However, the levels of histone synthesis increased when parasites enter the S phase, in agreement with previous results showing that histone synthesis in Leishmania is tightly coupled with DNA replication. In addition, we analysed the distribution of histone mRNAs on polyribosomes at different stages of the cell cycle by separation of cytoplasmic RNAs in sucrose gradients. Remarkably, a drastic change in the polysome profiles of histone mRNAs was observed during the progression from G1 to S phase. Thus, in the S phase, histone mRNAs are present in ribosome-bound fractions, but in the G1 phase, the histone transcripts are exclusively found in the ribosome-free fractions. These results support a regulatory model in which the cell-cycle-regulated synthesis of histones in Leishmania is controlled through a reversible interaction between translational repressors and histone mRNAs.
Jose M Requena
added 5 research items
Exposure of Leishmania promastigotes to the temperature of their mammalian hosts results in the induction of a typical heat shock response. It has been suggested that heat shock proteins play an important role in parasite survival and differentiation. Here we report the studies on the expression of the heat shock protein 83 (HSP83) genes of Leishmania infantum. Confirming previous observations for other Leishmania species, we found that the L. infantum HSP83 transcripts also show a temperature-dependent accumulation that is controlled by a post-transcriptional mechanism involving sequences located in the 3'-untranslated region (3'-UTR). However, contrary to that described for L. amazonensis, the accumulation of the HSP83 transcripts in L. infantum is dependent on active protein synthesis. The translation of HSP83 transcripts is enhanced during heat shock and, as first described in L. amazonensis, we show that the 3'-UTR of the L. infantum HSP83 gene is essential for this translational control. Measurement of the steady-state levels of HSP83 transcripts along the promastigote-to-amastigote differentiation evidenced a specific profile of HSP83 RNAs: after an initial accumulation of HSP83 transcripts observed short after (2 h) incubation in the differentiation conditions, the amount of HSP83 RNA decreased to a steady-state level lower than in undifferentiated promastigotes. We show that this transient accumulation is linked to the presence of the 3'-UTR and flanking regions. Again, an 8-fold increase in translation of the HSP83 transcripts is observed short after the initiation of the axenic differentiation, but it is not sustained after 9 h. This transient expression of HSP83 genes could be relevant for the differentiation of Leishmania, and the underlying regulatory mechanism may be part of the developmental program of this parasite.
Exposure of Leishmania promastigotes to the temperature of their mammalian hosts induces a typical heat-shock response. In Leishmania infantum, HSP70 is encoded by two types of genes that differ in their 3′-untranslated regions (3′-UTRs). Previously, we have shown that specific transcripts for each gene are present in promastigotes growing at normal temperature (26 °C), but only transcripts with 3′-UTR-type I (3′-UTRI) accumulate in a temperature-dependent manner. Here, we have investigated the translational efficiencies of both types of HSP70 transcripts at the different temperatures that the parasite encounters in the insect (26 °C, normal temperature) or in the mammalian host (heat-shock temperatures). Interestingly, 3′-UTRI-bearing transcripts (HSP70-I) were found associated with ribosomes in promastigotes at normal and heat-shock temperatures, whereas the HSP70-II transcripts appear to be preferentially translated at heat-shock temperatures but not at 26 °C. We have analyzed the function of these UTRs in the translational control by use of plasmid constructs in which the CAT reporter gene was flanked by UTRs of the HSP70 genes. Unexpectedly, it was found that CAT transcripts with 3′-UTRII bind to ribosomes at 26 °C, and, indeed, the CAT protein is synthesized. A valid conclusion of these experiments was that both types of 3′-UTRs are essential for translation of HSP70 mRNAs at heat shock temperatures, although the 3′-UTRII is more efficient during severe heat shock (39 °C). In addition, these results suggest that sequence region other than the 3′-UTR of HSP70-II gene is involved in the translational silent state of HSP70-II transcripts at 26 °C. Finally, a null mutant has been created by targeted disruption of both HSP70-II alleles. Remarkably, the ΔHSP70 mutant synthesizes HSP70 at a lower rate than the wild-type parasites. Overall, our data suggest that the biological function of the HSP70-II gene is to top up HSP70 levels under conditions of stress.
Gene-array technologies have been applied in a wide number of organisms to study gene expression profiling under several physiological and experimental conditions. Gene-array implementations combined with the information arising from emerging genome sequencing projects are expected to be in the near future a major tool to characterize genes involved in different processes. So far, gene expression profile studies in trypanosomatids have been performed in microarrays that use a glass support to immobilize fragments of genomic DNA followed by fluorescent detection. Here, we wanted to test the potential of genomic DNA macroarrays of Leishmania infantum using nylon membranes and radioactive detection. Nylon macroarrays present a number of advantages since the processing of the membranes is based on standard Southern blotting protocols familiar to molecular biologists, and the data acquisition equipment is available to most research institutions. Nylon macroarrays were employed to search for genes showing increased mRNA abundance during an axenic differentiation of L. infantum promastigotes to amastigotes. Several clones were rescued and, after validation by Northern blot assays, these L. infantum sequences were used to screen the Leishmania major gene database. The L. major contigs with high homology to the L. infantum sequences allowed a consistent identification of the regulated genes.
Jose M Requena
added an update
Jose M Requena
added a research item
RNA-binding proteins of the PUF family share a conserved domain consisting of tandemly repeated 36-40 amino acid motifs (typically eight) known as Puf repeats. Proteins containing tandem repeats are often dominant targets of humoral responses during infectious diseases. Thus, we considered of interest to analyze whether Leishmania PUF proteins result antigenic during visceral leishmaniasis (VL). Here, employing whole-genome databases, we report the composition, and structural features, of the PUF family in Leishmania infantum. Additionally, the 10 genes of the L. infantum PUF family were cloned and used to express the Leishmania PUFs in bacteria as recombinant proteins. Finally, the antigenicity of these PUF proteins was evaluated by determining levels of specific antibodies in sera from experimentally infected hamsters. The Leishmania PUFs were all recognized by the sera, even though with different degree of reactivity and/or frequency of recognition. The reactivity of hamster sera against recombinant LiPUF1 and LiPUF2 was particularly prominent, and these proteins were subsequently assayed against sera from human patients. High antibody responses against rLiPUF1 and rLiPUF2 were found in sera from VL patients, but these proteins resulted also recognized by sera from Chagas' disease patients. Our results suggest that Leishmania PUFs are targets of the humoral response during L. infantum infection and may represent candidates for serodiagnosis and/or vaccine reagents; however, it should be kept in mind the cross-reactivity of LiPUFs with antibodies induced against other trypanosomatids such as Trypanosoma cruzi.
Jose M Requena
added an update
Recently, we announced the development of a WEB server named Leish-ESP (https://leishseq.neocities.org), which is devoted to providing mainly transcriptomics data for Leishmania species. What can be found in this server that currently it is not available at well-known databases like GeneDB and TriTrypDB? I will try to explain it briefly in the next paragraphs.
When you search the sequence of a particular gene in GeneDB, for instance, LmjF.01.0010 gene, you retrieve the following sequence (999 nucleotides in length):
ATGCGCTGCGCTCTCGTCTTCGTGCTGGTCGTGGCGGTGCTCGCGTGTTTTGCACCGGCAATGACGCACGCCTACTCGACAACGTATACCGCGCGCAGCGCCGGCAGTGGGGCCTTTGCCTTCGATCCCCTAGAAATCGATTTCTGCAAGTTGCAGGACGCGGGGTCGCACACGGCCATGTCGACCTCCGCCTCTATTCAAGAGGCTCTCGAGAGTGCCTATCAACGCGAGGGCATTCGCGGCAATATCCCCCTTGGCGGCATGACGGAGCAGGCGGTGTGCGCGGGAACCCAATGCGAGTGGCGGTGGTATCGCGGGCTCTTCCGCACCACCCGCCCGCTGTTCCTGCGCGGTGTCAACTACTGGGGAGTAAACGATGACGCGACTCCAGTGGACAGAACTACTGCTGTGTCGGGCTCCTACACCAATTTCGAGACCAACTACCCGCGTTCCTGGGGAAACCTGAGCTACTGGGGCAAGCGCCTGGTTGTGATGCAGCCGTCCGGGAAGTGGGTGAACACGGAGGTGTCCACATCGTTTACGAATTTCCTCTGCGAGTACTACGTCTACGCCGACTCCGATGGCGTGAATCGGCTTGTGCCCACCTTCCCGGGCGGCAGCGCCATTCCCTTCGTTAGCAGCTCCGGCCACACGTACAAGTACTGCGGCAAAAAGGTTGAGGTAGACTCGCAGAGCCGCTGGATCCTCCCGAAGTGCAACGAAACGTTCCCATGGTGGGGCGGCCTCCTCATTGCCGTCGTGCTCTATATCATCCTGATTGCTCTCATCATTAGCATCTGGTGCTGCTGCTGCATCCGCCGCCGCAACAAAGAGGAGAAGCGCCGCCGTAATATCATCGGATCGCAGTATGATAATCAGGGCGCTATTCCCACGCAGTCGGAGCTCGGGCTGAGCCGTCACAACTCTTTCCGAGGCACCAGCATGTACAACTCCGACGACACCGACTCCGATGCAGATGCGTACTCTTCGCGCGAGTAG
The same sequence is retrieved when you search for the mRNA Sequence of LmjF.01.0010 gene in TriTrypDB.
However, when you retrieve the sequence for transcript LmjF.01.T0010 in the Leish-ESP database, the result is the following sequence (3614 nucleotides)
tcctagcggacccttggcgcaaccactgccccgcctttctccttctccgttctctcgcttccttgcttttcttgtttttgttggttcttctccggcacgcaccagcgtttccaccaccggcgcggaggggggggggtggactgtgcttgatcttcagcgttcctctcgtattcgttttcggcttcttggctcactgtctttttcccttctcccccctcggccctcacgcccgacattcaccgccggctcacgcatcaccactcgctcgtccaccgtctgtgttcccgtccatttcgtacactctttctctcctcgttttctccgcttgtctttctctcccgctgctgacaagATGCGCTGCGCTCTCGTCTTCGTGCTGGTCGTGGCGGTGCTCGCGTGTTTTGCACCGGCAATGACGCACGCCTACTCGACAACGTATACCGCGCGCAGCGCCGGCAGTGGGGCCTTTGCCTTCGATCCCCTAGAAATCGATTTCTGCAAGTTGCAGGACGCGGGGTCGCACACGGCCATGTCGACCTCCGCCTCTATTCAAGAGGCTCTCGAGAGTGCCTATCAACGCGAGGGCATTCGCGGCAATATCCCCCTTGGCGGCATGACGGAGCAGGCGGTGTGCGCGGGAACCCAATGCGAGTGGCGGTGGTATCGCGGGCTCTTCCGCACCACCCGCCCGCTGTTCCTGCGCGGTGTCAACTACTGGGGAGTAAACGATGACGCGACTCCAGTGGACAGAACTACTGCTGTGTCGGGCTCCTACACCAATTTCGAGACCAACTACCCGCGTTCCTGGGGAAACCTGAGCTACTGGGGCAAGCGCCTGGTTGTGATGCAGCCGTCCGGGAAGTGGGTGAACACGGAGGTGTCCACATCGTTTACGAATTTCCTCTGCGAGTACTACGTCTACGCCGACTCCGATGGCGTGAATCGGCTTGTGCCCACCTTCCCGGGCGGCAGCGCCATTCCCTTCGTTAGCAGCTCCGGCCACACGTACAAGTACTGCGGCAAAAAGGTTGAGGTAGACTCGCAGAGCCGCTGGATCCTCCCGAAGTGCAACGAAACGTTCCCATGGTGGGGCGGCCTCCTCATTGCCGTCGTGCTCTATATCATCCTGATTGCTCTCATCATTAGCATCTGGTGCTGCTGCTGCATCCGCCGCCGCAACAAAGAGGAGAAGCGCCGCCGTAATATCATCGGATCGCAGTATGATAATCAGGGCGCTATTCCCACGCAGTCGGAGCTCGGGCTGAGCCGTCACAACTCTTTCCGAGGCACCAGCATGTACAACTCCGACGACACCGACTCCGATGCAGATGCGTACTCTTCGCGCGAGTAGacaggagggcgaacaagagaagaacagcgcatcagtgaccaagcgactctgcagaaacatcgcctctgctgccttgcttcccttgcccttctcacctctctcccgctggcccgctactgctgacgtgcgctcacgtcgaccacatcgccccattttctctctgcgcaaactgaatcgccactttgcgcccgactatgtgcctgtgcgggcgtctgtgggctgcccttctctcagtagagcgcacacgctgaacacacacacacacacacattttctcgtgttgttgggctgcatagcttcttctgtttggctcctattccttctccgcttcacaccgtgttccggcgttttcacgtttcagctctctcctttcgcttcccttgctttccccctctccgggcatctatatgtgtatgtatgtatgcgtgtgtatgtgtgtgtgtgtgtgtctttgcgcgagagagagcgagagcgcgcgtatgcttccagtatgcactgccatcttcccccttctctctttttatgtgacctttagctgttccctcctcctccctatctttcggcctattgttcttgtgtctgccttatgtgtgtcgcctctcctctgcactctctccttccgtcggtatctctcctgtctttctgctttttctctctctctctctcgctcgctctttggatctggggtacacagcacaacgaagcagcggtgaaaggggcatggaaaagaaagacgacggtgacagagagcgaggcagacagaggaaacggcggtggagagcagaacggcgctgcttgtcatgcctctgatctctctcgtaaccttctttctctcgttgtgctccatttttggttctcgacacccatccgtggtctgtttcatgtaatccgtctctctttgtcctcctcccatgtgcgtctccgcccatctcattctgtactgtctgttttcgtttgagaatctcttgtctctctctccccctacctttccgctacctcatagtgtcgtctccatcgcgtggcgcgccgcccccttgagcgtcacgtcttgccgacggtcaggcttcgtcgagtttttggcggcactacttcgcttctccgcatccatcgatgaatggcatgcctatgcgcgatttagtcgagggcgactctgcacttccgtttttttttttgtttgtttccccttcgttgaccaacgatgaggctgctactggtgatgcagtcgcgagcacggagaccttcgtattcaacggacagccacgtgctctactttgttttgctcttctctttcgcgtgactccgtcttcccgatgctctctctctctctctctcttggcgtatgtgtctgccgtcacatgtacgcttcttttcattttttatttttactggcctccttgtcctgtcgaactgcttcattgaacgtgtcgatgtcgccgcgaatgtcaccgcagaatcggcgtcgcctcacgagcctccactgctgccttccctcccaccgtgggcgtgcctccgctgcacatggaggaggtgagcgccggcggcctcggaaggtgccacgagcaccaaagcaacagaatagacacatgcgcattatgtgaacagctcagcagtaccgcggggaactttttgtgagcaacgacaacaccgagcacacacacgcacgcacgaaaacaaaaacgctcgataggcataccggcagaagacaacaacccatgacggcggttggcaaagatacacgacgaaactaaaagagccgagaaacaaaaaaaatagaaagcgaacaatggaggacaaccgtgagagggtggtcacatgcttgcgtgcgtgcaaccgctgcagttacaactggagaaaaagaaagaagactcgctcatcagccagcagtcgcaaggcagcaggaaattcgcccttgctcacacctgtcatagtttcgcttgtgctcccatgtggtctgtcgtccttgtccgtctcgttctccttgacaccgtgtcgtcggtgtgatgttccactttcgaagtcctttagctatctcttctttttcttgctgttttatgcatcaggagaaactttgttttgctcacaacataggctccgttgttctctctctctctctctctcgcggtgcgcctttcgtgattgccgtgtgggtgtgttgatgaatggctagcgtggctcaccgtgcttcgtctctcttctctttggtctgtgtttccttcgtcttgattgctggagtgttttgaaatgatcagcacccataccgcag
Why the sequence for LmjF.01.T0010 is near four times longer than the LmjF.01.0010 mRNA? The question is quite simple to answer. In both, GeneDB and TriTrypDB databases the terms ‘gene’ and ‘mRNA’ are misuse. In these databases, only the protein-coding sequences (i.e., ORF) are provided. Note that the upper case text in the sequence for LmjF.01.T0010 transcript is the same as the sequences retrieved for LmjF.01.0010 in the mentioned databases.
A protein-coding gene, and its corresponding mRNA, contains apart from the ORF, two other relevant regions, the 5’- and 3’-untranslated regions (UTRs) located upstream and downstream, respectively, from the ORF.
If somebody has some doubt about the relevance of the UTRs, I suggest reading the article by Mazumber et al (2003). By the way, I have borrowed in part the title of that article.
References.
Mazumder B, Seshadri V, Fox PL. 2003. Translational control by the 3'-UTR: the ends specify the means. Trends Biochem Sci 28: 91-98.
 
Jose M Requena
added a research item
The heat stress suffered by Leishmania sp during its digenetic life-cycle is a key trigger for its stage differentiation. In Leishmania subgenera two classes of HSP70 genes differing in their 3' UTR were described. Although the presence of HSP70-I genes was previously suggested in Leishmania (Viannia) braziliensis, HSP70-II genes had been reluctant to be uncovered. Here, we report the existence of two types of HSP70 genes in L. braziliensis and the genomic organization of the HSP70 locus. RT-PCR experiments were used to map the untranslated regions (UTR) of both types of genes. The 3' UTR-II has a low sequence identity (55-57%) when compared with this region in other Leishmania species. In contrast, the 5' UTR, common to both types of genes, and the 3' UTR-I were found to be highly conserved among all Leishmania species (77-81%). Southern blot assays suggested that L. braziliensis HSP70 gene cluster may contain around 6 tandemly-repeated HSP70-I genes followed by one HSP70-II gene, located at chromosome 28. Northern blot analysis indicated that levels of both types of mRNAs are not affected by heat shock. This study has led to establishing the composition and structure of the HSP70 locus of L. braziliensis, complementing the information available in the GeneDB genome database for this species. L. braziliensis HSP70 gene regulation does not seem to operate by mRNA stabilization as occurs in other Leishmania species.
Jose M Requena
added an update
We are developing a WEB server named Leish-ESP (https://leishseq.neocities.org) aimed to facilitate the access to transcriptomics data from different Leishmania species. Currently, in this website, you can download the complete transcriptome of Leishmania major, but also you can find the sequence and complementary information of individual transcripts using the browser tool.
In the Leish-ESP server, you can find a different information that is not available in other well-known databases like GeneDB and TriTrypDB. First, we are providing the complete sequence of transcripts, including 5’- and 3’-untranslated regions (UTRs) together with the coding region (CDR). In the mentioned databases, only CDR sequences for the protein-coding transcripts are available. Second, the transcriptome is based on a revised version of the L. major (Friedlin strain) genome (Alonso et al., 2016) that is not yet incorporated into the mentioned databases.
This website is constantly being updated, including, apart from our research data, information derived from the scientific literature. Thus, if you find out that you can complement the transcript information with some of your findings, please feel free to contact us. We will be glad to incorporate your data duly referenced.
References
Alonso, G., Rastrojo, A., Lopez-Perez, S., Requena, J.M., and Aguado, B. (2016). Parasites & vectors 9, 74.
 
Jose M Requena
added a research item
Introducción La regulación génica en tripanosomatidos ocurre durante la maduración, localización, estabilización y traducción de los transcritos, eventos gobernados por la interacción entre motivos de las regiones no traducidas del ARN (UTR) y factores proteicos. La identificación de factores que interactúan con regiones UTR de genes importantes para la sobrevivencia de Leishmania es de utilidad para el descubrimiento de blancos terapéuticos. Así, dado que la proteína HSP70 es requerida para la infectividad y supervivencia del parásito, se desarrollaron ensayos de unión ARN/proteína para identificar proteínas de unión a las regiones UTR de los genes HSP70 de L. braziliensis. Materiales y métodos El ARN de las regiones 5´ y 3´ UTR, obtenido por transcripción in vitro, fue unido a microperlas, la cuales se enfrentaron al lisado citoplasmático total del parasito en presencia de inhibidores de proteasas y ARNasas y ARN competidor. La elución de la proteína específica se hizo en amortiguador de rehidratación y fue resuelta mediante electroforesis en 2 dimensiones. El análisis se hizo mediante el software ImageMaster 2D Platinum 6.0. Los puntos fueron identificados por MALDI TOF/TOF. Resultados Se identificaron entre otras las proteínas: RPA1, unida a todas las UTR; el factor de elongación 1, unido a la 5´ UTR; el factor eucariótico de iniciación 4, asociado a la 3´ UTR-I y dos proteínas hipotéticas asociadas a la 3´ UTR I y II. Conclusión Las proteínas identificadas constituyen factores potencialmente implicados en la regulación de los genes HSP70 de L. braziliensis. Se requieren más estudios para confirmar estos hallazgos.
Jose M Requena
added a research item
Alpha tubulin is a fundamental component of the cytoskeleton which is responsible for cell shape and is involved in cell division, ciliary and flagellar motility and intracellular transport. Alpha tubulin gene expression varies according to the morphological changes suffered by Leishmania in its life cycle. However, the objective of studying the mechanisms responsible for the differential expression has resulted to be a difficult task due to the complex genome organization of tubulin genes and to the non-conventional mechanisms of gene regulation operating in Leishmania. We started this work by analyzing the genomic organization of alpha-tubulin genes in the Leishmania braziliensis genome database. The genomic organization of L. braziliensis alpha-tubulin genes differs from that existing in the L. major and L. infantum genomes. Two loci containing alpha-tubulin genes were found in the chromosomes 13 and 29, even though the existence of sequence gaps does not allow knowing the exact number of genes at each locus. Southern blot assays showed that alpha-tubulin locus at chromosome 13 contains at least 8 gene copies, which are tandemly organized with a 2.08-kb repetition unit; the locus at chromosome 29 seems to contain a sole alpha-tubulin gene. In addition, it was found that L. braziliensis alpha-tubulin locus at chromosome 13 contains two types of alpha-tubulin genes differing in their 3[prime] UTR, each one presumably containing different regulatory motifs. It was also determined that the mRNA expression levels of these genes are controlled by post-transcriptional mechanisms tightly linked to the growth temperature. Moreover, the decrease in the alpha-tubulin mRNA abundance observed when promastigotes were cultured at 35[degree sign]C, was accompanied by parasite morphology alterations, similar to that occurring during the promastigote to amastigote differentiation. Information found in the genome databases indicates that alpha-tubulin genes have been reorganized in a drastic manner along Leishmania speciation. In the L. braziliensis genome database, two loci containing alpha-tubulin sequences were found, but only the locus at chromosome 13 contains the prototypic alpha-tubulin genes, which are repeated in a head-to-tail manner. Also, we determined that the levels of alpha-tubulin mRNAs are down-regulated drastically in response to heat shock by a post-transcriptional mechanism which is dependent upon active protein synthesis.
Jose M Requena
added a research item
Unlabelled: HSP70 protein is involved in Leishmania differentiation, apoptosis, antimony-resistance and host-immune response. Therefore, this protein and the regulatory mechanisms of HSP70 gene expression are promising targets for therapeutic intervention against leishmaniasis. The regulation of mRNA expression in trypanosomatids operates mostly through the interaction of trans-acting proteins, and elements located in the untranslated regions of mRNAs. The aim of this work was to identify protein factors interacting specifically with the Leishmania braziliensis HSP70 mRNAs. Thus, the 5' UTR and the two types of 3' UTRs (UTR-I and UTR-II) from L. braziliensis HSP70 genes were used as baits in pull down assays using total protein extracts from parasites cultured at 26 or 35°C. The captured proteins were resolved by two-dimensional gel electrophoresis (2-DE) and identified by mass spectrometry (MS) analysis. As a result, 52 different proteins were identified based on their binding to the L. braziliensis HSP70-mRNAs. As expected, several of the identified proteins were related to RNA metabolism (27%) and translation process (7%). In addition, five hypothetical conserved proteins having motifs related with RNA interaction were also identified (9.6%). Nevertheless, unexpected proteins, apparently unrelated to the mRNA expression, were also identified. The biological significance of these and others L. braziliensis detected proteins, including the HSP70 itself, is discussed. Biological significance: For the first time, a riboproteomic analysis of the proteins interacting with the untranslated regions of the heat shock protein 70 (HSP70) mRNA from Leishmania braziliensis was carried out. This work provides new insights related to protein factors putatively involved in the regulation of HSP70 gene expression in L. braziliensis, and thereby, contributes to a better understanding of the parasite biology, and ultimately to the development of novel therapeutic interventions for controlling the important diseases caused by this parasite.
Jose M Requena
added a research item
Background Replication factor A (RPA) is a single-strand DNA binding protein involved in DNA replication, recombination and repair processes. It is composed by the subunits RPA-1, RPA-2 and RPA-3; the major DNA-binding activity resides in the subunit 1 of the heterotrimeric RPA complex. In yeast and higher eukaryotes, besides the three basic structural DNA-binding domains, the RPA-1 subunit contains an N-terminal region involved in protein-protein interactions with a fourth DNA-binding domain. Remarkably, the N-terminal extension is absent in the RPA-1 of the pathogenic protozoan Leishmania (Leishmania) amazonensis; however, the protein maintains its ability to bind ssDNA. In a recent work, we identify Leishmania (Viannia) braziliensis RPA-1 by its specific binding to the untranslated regions of the HSP70 mRNAs, suggesting that this protein might be also an RNA-binding protein. Methods Both rLbRPA-1 purified by His-tag affinity chromatography as well as the in vitro transcribed L. braziliensis 3′ HSP70-II UTR were used to perform pull down assays to asses nucleic acid binding properties. Also, homology modeling was carried out to construct the LbRPA-1 tridimensional structure to search relevant amino acid residues to bind nucleic acids. Results In this work, after obtaining the recombinant L. braziliensis RPA-1 protein under native conditions, competitive and non-competitive pull-down assays confirmed the single-stranded DNA binding activity of this protein and demonstrated its interaction with the 3′ UTR from the HSP70-II mRNA. As expected, this protein exhibits a high affinity for ssDNA, but we have found that RPA-1 interacts also with RNA. Additionally, we carried out a structural analysis of L. braziliensis RPA-1 protein using the X-ray diffraction structure of Ustilago maydis homologous protein as a template. Our results indicate that, in spite of the evolutionary divergence between both organisms, the structure of these two RPA-1 proteins seems to be highly conserved. Conclusion The LbRPA-1 protein is a ssDNA binding protein, but also it shows affinity in vitro for the HSP70 mRNA; this finding supports a possible in vivo role in the HSP70 mRNA metabolism. On the other hand, the three dimensional model of Leishmania RPA-1 serves as a starting point for both functional analysis and its exploration as a chemotherapeutic target to combat leishmaniasis. Keywords Replication protein A (RPA) RPA subunit 1 Single-stranded DNA binding protein RNA binding protein Leishmania braziliensis
Jose M Requena
added a research item
Faithful inheritance of eukaryotic genomes requires the orchestrated activation of multiple DNA replication origins (ORIs). Although origin firing is mechanistically conserved, how origins are specified and selected for activation varies across different model systems. Here, we provide a complete analysis of the nucleosomal landscape and replication program of the human parasite Leishmania major, building on a better evolutionary understanding of replication organization in Eukarya. We found that active transcription is a driving force for the nucleosomal organization of the L. major genome and that both the spatial and the temporal program of DNA replication can be explained as associated to RNA polymerase kinetics. This simple scenario likely provides flexibility and robustness to deal with the environmental changes that impose alterations in the genetic programs during parasitic life cycle stages. Our findings also suggest that coupling replication initiation to transcription elongation could be an ancient solution used by eukaryotic cells for origin maintenance.
Jose M Requena
added a research item
Background Replication factor A (RPA) is a single-strand DNA binding protein involved in DNA replication, recombination and repair processes. It is composed by the subunits RPA-1, RPA-2 and RPA-3; the major DNA-binding activity resides in the subunit 1 of the heterotrimeric RPA complex. In yeast and higher eukaryotes, besides the three basic structural DNA-binding domains, the RPA-1 subunit contains an N-terminal region involved in protein-protein interactions with a fourth DNA-binding domain. Remarkably, the N-terminal extension is absent in the RPA-1 of the pathogenic protozoan Leishmania (Leishmania) amazonensis; however, the protein maintains its ability to bind ssDNA. In a recent work, we identify Leishmania (Viannia) braziliensis RPA-1 by its specific binding to the untranslated regions of the HSP70 mRNAs, suggesting that this protein might be also an RNA-binding protein. Methods Both rLbRPA-1 purified by His-tag affinity chromatography as well as the in vitro transcribed L. braziliensis 3′ HSP70-II UTR were used to perform pull down assays to asses nucleic acid binding properties. Also, homology modeling was carried out to construct the LbRPA-1 tridimensional structure to search relevant amino acid residues to bind nucleic acids. Results In this work, after obtaining the recombinant L. braziliensis RPA-1 protein under native conditions, competitive and non-competitive pull-down assays confirmed the single-stranded DNA binding activity of this protein and demonstrated its interaction with the 3′ UTR from the HSP70-II mRNA. As expected, this protein exhibits a high affinity for ssDNA, but we have found that RPA-1 interacts also with RNA. Additionally, we carried out a structural analysis of L. braziliensis RPA-1 protein using the X-ray diffraction structure of Ustilago maydis homologous protein as a template. Our results indicate that, in spite of the evolutionary divergence between both organisms, the structure of these two RPA-1 proteins seems to be highly conserved. Conclusion The LbRPA-1 protein is a ssDNA binding protein, but also it shows affinity in vitro for the HSP70 mRNA; this finding supports a possible in vivo role in the HSP70 mRNA metabolism. On the other hand, the three dimensional model of Leishmania RPA-1 serves as a starting point for both functional analysis and its exploration as a chemotherapeutic target to combat leishmaniasis.
Jose M Requena
added an update
Regulation of gene expression in Leishmania.
Initial studies dealing with the analysis of transcriptional activity of particular Leishmania genes showed somewhat unexpected results: transcription of individual genes remains constant irrespective of the abundance of the mRNA products. The heat shock protein (HSP) genes of Leishmania were among the first to be analyzed, because it was easy to find them due to their remarkable sequence conservation along the evolutionary scale and, by the other hand, because that they seemed to be ideal candidates for identification of inducible RNA polymerase II promoters (reviewed in Folgueira and Requena, 2007). Such analyses were based on the technically demanding nuclear-run-on procedure. Thus, run-on analyses of the expression of the HSP70 and HSP83/90 genes in several Leishmania species concluded that there was not transcriptional activation of these genes when the parasites are exposed to a heat shock, in spite that accumulation of the respective mRNAs occurred (Brandau et al., 1995; Quijada et al., 1997). Subsequent studies analysing the transcriptional regulation of other genes fostered the idea that most protein-coding genes in Leishmania, and related trypanosomatids, do not have their own promoters, and are transcribed as part of polycistronic transcripts (Clayton, 2002). In an outstanding article, Martínez-Calvillo and co-workers (2003), by using strand-specific nuclear run-on assays, showed that most of the transcriptional activity occurs on the sense DNA strand, and that RNA polymerase II-mediated transcription initiates within the strand-switch regions (SSRs) and radiate bi-directionally from them. However, currently, it is not clear where transcription precisely starts or how RNA pol II is recruited to the DNA. Furthermore, the principle that SSRs are the sole sites of transcription initiation is not absolute, since resistance genes introduced into a copy of L. major chromosome 1 lacking the divergent SSR can still be transcribed at levels sufficient for selection (Dubessay et al., 2002).
- Brandau, S., Dresel, A., and Clos, J. (1995). High constitutive levels of heat-shock proteins in human-pathogenic parasites of the genus Leishmania. Biochem J 310, 225-232.
- Clayton, C.E. (2002). Life without transcriptional control? From fly to man and back again. Embo J 21, 1881-1888.
- Dubessay, P., Ravel, C., Bastien, P., Crobu, L., Dedet, J.P., Pages, M., and Blaineau, C. (2002). The switch region on Leishmania major chromosome 1 is not required for mitotic stability or gene expression, but appears to be essential. Nucleic Acids Res 30, 3692-3697.
- Folgueira, C., and Requena, J.M. (2007). A postgenomic view of the heat shock proteins in kinetoplastids. FEMS Microbiol Rev 31, 359-377.
- Martinez-Calvillo, S., Yan, S., Nguyen, D., Fox, M., Stuart, K., and Myler, P.J. (2003). Transcription of Leishmania major Friedlin chromosome 1 initiates in both directions within a single region. Mol Cell 11, 1291-1299.
- Quijada, L., Soto, M., Alonso, C., and Requena, J.M. (1997). Analysis of post-transcriptional regulation operating on transcription products of the tandemly linked Leishmania infantum hsp70 genes. J Biol Chem 272, 4493-4499.

 
Jose M Requena
added a research item
A novel repetitive DNA element has been isolated from the Leishmania infantum genome. The 348 bp long element, designated LiR3, was found to be located downstream from the 3'-end of the ribosomal RNA (rRNA) genes. This LiR3 element has short sequences with potential to form stem-loop structures similar to those of the bacterial rho-independent transcriptional terminators. Given both the structural features and the genomic location of this element we searched for a possible functional implication of these structures in the termination of rRNA transcription. Nuclear run-on assays indicated that indeed there is a transcriptional blockage associated with the LiR3 element. Several chi-like elements, resembling the recombination-promoting sites of Escherichia coli, were identified within the sequences associated with the stem-loop structures. A possible implication of these chi-like elements in rRNA gene conversion events is discussed.
Jose M Requena
added 3 research items
This article contains data related to the research article entitled “Genomic cartography and proposal of nomenclature for the repeated, interspersed elements of the Leishmania major SIDER2 family and identification of SIDER2-containing transcripts” [1]. SIDER2 elements are repeated sequences, derived from, nowadays, extinct retrotransposons, that populate the genomes of protist of the genera Leishmania. This dataset (Supplementary File 1), an inventory of 1100 SIDER2 elements, was generated by surveying the L. major complete genome using bioinformatics tools with further manual refinements. In addition to the genomic distribution of these elements (summarized in Fig. 1), this dataset contains information regarding their association with specific transcripts, based on the recently established transcriptome for L. major [2].
Jose M Requena
added an update
It is relevant to briefly summarize the history leading to the uncovering of the genome structure in Leishmania parasites. In 1992, P. Bastien and co-workers published an article entitled “Leishmania: Sex, Lies and Karyotype” (Bastien et al., 1992); this outstanding article clearly shows the particular difficulties that scientists had to solve the features of Leishmania genome. In fact, nowadays, questions like ploidy and genetic exchange remains unsolved. As Leishmania chromosomes do not condense during mitosis (Solari, 1995), their number and sizes were studied by pulsed field gel electrophoresis (PFGE), a technique that allows the separation of DNA molecules of very different size (from some kilobases (Kb) to megabase (Mb)-size molecules). The image derived from this analysis was called “molecular karyotype”. These analyses indicated that the karyotype of Leishmania should be extremely polymorphic, since strains of the same Leishmania species yielded PFGE-pictures very different, with chromosomal bands of different size and staining intensities (Blaineau et al., 1991). However, this puzzling finding does not discouraged to the Montpellier team in its objective of determining the Leishmania karyotype and chromosomal structures. For this purpose, they decided to stablish physical linkage groups by hybridization of specific DNA probes to PFGE-separated chromosomes. After individual hybridization of 244 different probes, they concluded that L. infantum genome comprises 36 chromosomes ranging in size from 0.35 to ~3 Mb (Wincker et al., 1996). Moreover, these authors demonstrated that the linkage groups were consistently conserved in different species, such as L. major, L. tropica and L. aethiopica. This finding contrasted with the size heterogeneity of the chromosomal bands, even within the same species, and pointed to a high conservation of the chromosomal scaffolds within the genus Leishmania (Wincker et al., 1996). This outstanding work paved the way for deciphering the genome sequence for this genus, first in L. major (Ivens et al., 2005), afterwards for L. infantum and L. braziliensis (Peacock et al., 2007) and, nowadays, for many others (www. tritrypdb.org). Nevertheless, as demonstrated recently, the L. major (Friedlin) genome, which is the best assembled genome for a Leishmania species, cannot be considered as set in stone (Alonso et al., 2016), and the users should be aware that a genome sequence is only a hypothesis.
References:
- Alonso, G., Rastrojo, A., Lopez-Perez, S., Requena, J.M., and Aguado, B. (2016). Parasites & vectors 9, 74.
- Bastien, P., Blaineau, C., and Pages, M. (1992). Parasitol Today 8, 174-177.
- Blaineau, C., Bastien, P., Rioux, J.A., Roizes, G., and Pagés, M. (1991). Mol Biochem Parasitol 46, 292-302.
- Ivens, A.C., Peacock, C.S., Worthey, E.A., Murphy, L., Aggarwal, G., Berriman, M., Sisk, E., Rajandream, M.A., Adlem, E., Aert, R., et al. (2005). Science 309, 436-442.
- Peacock, C.S., Seeger, K., Harris, D., Murphy, L., Ruiz, J.C., Quail, M.A., Peters, N., Adlem, E., Tivey, A., Aslett, M., et al. (2007). Nat Genet 39, 839-847.
- Solari, A.J. (1995). Biocell 19, 65-84.
- Wincker, P., Ravel, C., Blaineau, C., Pages, M., Jauffret, Y., Dedet, J.P., and Bastien, P. (1996). Nucleic Acids Res 24, 1688-1694.
 
Jose M Requena
added 3 research items
Regulation of gene expression is one of the most intriguing aspects of Leishmania biology. This review deals with current knowledge concerning gene organization and regulation of gene expression in this protozoan parasite, which cause serious illness and death in humans living in tropical and subtropical regions. Post-transcriptional regulation is especially important for Leishmania, and other trypanosomatids, due to the unusual features related to transcription and mRNA maturation. In these organisms, genes are organized into polycistronic transcription units, whereby many genes are cotranscribed by RNA polymerase II from not well characterized, upstream promoters. These organisms represent an extreme in which the expression of their genome is almost exclusively controlled post-transcriptionally. Because the regulatory needs of these parasites are considerable as they undergo complex developmental transitions, post-transcriptional mechanisms that involve RNA and protein regulatory processes are of paramount importance for these protozoa. This review summarizes recent results on the post-transcriptional mechanisms in Leishmania that regulate protein abundance through influencing RNA splicing, nuclear-cytoplasmic mRNA stability, translation, or post-translational events such as protein stability and modification.
Heterologous reporter genes are widely used for the characterization of gene expression in many organisms. Particularly, constructs bearing reporter genes have greatly contributed to our understanding of gene regulation in kinetoplastids. In some specific circumstances, however, such heterologous reporter has a risk of resulting in irrelevant observations and conclusions, which are primarily due to the introduction of foreign sequence elements. This communication describes our recent experience using the chloramphenicol acetyltransferase (CAT) gene as a reporter for analysis of the translational regulation of HSP70 genes in Leishmania infantum. We show that chimeric mRNAs consisting of the CAT open reading frame (ORF) and the untranslated regions (UTRs) from HSP70-II genes behave differently as endogenous HSP70-II mRNAs and that this difference is due to the presence of CAT sequences. Thus, the main purpose of this communication is to alert researchers working in gene regulation to be cautious when interpreting results based on heterologous reporter genes.
Jose M Requena
added 2 research items
Background Although the genome sequence of the protozoan parasite Leishmania major was determined several years ago, the knowledge of its transcriptome was incomplete, both regarding the real number of genes and their primary structure. Results Here, we describe the first comprehensive transcriptome analysis of a parasite from the genus Leishmania. Using high-throughput RNA sequencing (RNA-seq), a total of 10285 transcripts were identified, of which 1884 were considered novel, as they did not match previously annotated genes. In addition, our data indicate that current annotations should be modified for many of the genes. The detailed analysis of the transcript processing sites revealed extensive heterogeneity in the spliced leader (SL) and polyadenylation addition sites. As a result, around 50% of the genes presented multiple transcripts differing in the length of the UTRs, sometimes in the order of hundreds of nucleotides. This transcript heterogeneity could provide an additional source for regulation as the different sizes of UTRs could modify RNA stability and/or influence the efficiency of RNA translation. In addition, for the first time for the Leishmania major promastigote stage, we are providing relative expression transcript levels. Conclusions This study provides a concise view of the global transcriptome of the L. major promastigote stage, providing the basis for future comparative analysis with other development stages or other Leishmania species.
The genomes of most eukaryotic organisms contain a large number of transposable elements that are able to move from one genomic site to another either by transferring of DNA mobile elements (transposons) or transpose via reverse transcription of an RNA intermediate (retroposons). An exception to this rule is found in protists of the subgenus Leishmania, in which active retroposons degenerated after a flourishing era, leaving only retroposon remains; these have been classified into two families: SIDER1 and SIDER2. In this work, we have re-examined the elements belonging to the family SIDER2 present in the genome of Leishmania major with the aim of providing a nomenclature that will facilitate a future reference to particular elements. According to sequence conservation, the 1100 SIDER2 elements have been grouped into subfamilies, and the inferred taxonomic relationships have also been incorporated into the nomenclature. Additionally, we are providing detailed data regarding the genomic distribution of these elements and their association with specific transcripts, based on the recently established transcriptome for L. major. Thus, the presented data can help to study and better understand the roles played by these degenerated retroposons in both regulation of gene expression and genome plasticity.
Jose M Requena
added an update
Adding of a few genomic regions missing in the database for the L. major reference genome
 
Jose M Requena
added a project goal
Annotation of transcripts for Leishmania major, L. infantum, L. donovani and L. braziliensis --