Vincenzo Piccialli

Vincenzo Piccialli
University of Naples Federico II | UNINA · Department of Chemical Sciences

PhD

About

174
Publications
11,149
Reads
How we measure 'reads'
A 'read' is counted each time someone views a publication summary (such as the title, abstract, and list of authors), clicks on a figure, or views or downloads the full-text. Learn more
2,204
Citations
Introduction
Vincenzo Piccialli currently works at the Department of Chemical Sciences, University of Naples Federico II. Vincenzo does research in Catalysis and Organic Chemistry. Their most recent publication is 'Smenamide A Analogues. Synthesis and Biological Activity on Multiple Myeloma Cells'.

Publications

Publications (174)
Article
The first general synthesis of bis-α-acyloxy-1,4- and -1,5-diketones has been accomplished in a catalytic oxidative opening of bis-acylated THF and THP (tetrahydropyran) diols, which were synthesised by osmium- or ruthenium-catalysed oxidative cyclisation of 1,5- and 1,6-dienes. The overall sequence corresponds to the regioselective double ketoacyl...
Article
Full-text available
Abstract: In the last years ruthenium tetroxide is increasingly being used in organic synthesis. Thanks to the fine tuning of the reaction conditions, including pH control of the medium and the use of a wider range of co-oxidants, this species has proven to be a reagent able to catalyse useful synthetic transformations which are either a valuable a...
Article
The synthesis of 2,6-dialkyl(aryl)purine nucleosides by application of a double addition of Grignard reagents to N1-oxide purine nucleosides is described. The synthetic protocol exploits the reactivity of both the C6–N1–O– and C2–N1–O– moieties of the purine base. The overall process consists of initial Grignard reagent addition to the C6 of nebula...
Article
Full-text available
A small collection of ring-expanded nucleosides (RENs), containing the unprecedented bis-alkylated imidazo[4,5-d][1,2,6]oxadiazepine heterocyclic ring system, has been synthesized through a new general approach. Results of preliminary cytotoxicity tests on breast (MCF-7) and lung (A549) cancer cell lines are also reported.
Article
The cKit87up sequence d((5')AGGGAGGGCGCTGGGAGGAGGG(3')) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a...
Article
Full-text available
The recent development of mRNA vaccines against the SARS-CoV-2 infection has turned the spotlight on the potential of nucleic acids as innovative prophylactic agents and as diagnostic and therapeutic tools. Until now, their use has been severely limited by their reduced half-life in the biological environment and the difficulties related to their t...
Article
Full-text available
Cyclic adenosine diphosphate ribose (cADPR) is a cyclic nucleotide involved in the Ca2+ homeostasis. In its structure, the northern ribose, bonded to adenosine through an N1 glycosidic bond, is connected to the southern ribose through a pyrophosphate bridge. Due to the chemical instability at the N1 glycosidic bond, new bioactive cADPR derivatives...
Article
Full-text available
Mycalin A, a polybrominated C15 acetogenin isolated from the encrusting sponge Mycale rotalis, displays an antiproliferative activity on human melanoma (A375) and cervical adenocarcinoma (HeLa) cells and induces cell death by an apoptotic mechanism. Various analogues and degraded derivatives of the natural substance have been prepared. A modificati...
Article
Full-text available
Herein, we report on the synthesis of a small set of linear precursors of an inosine analogue of cyclic ADP-ribose (cADPR), a second messenger involved in Ca2+ mobilization from ryanodine receptor stores firstly isolated from sea urchin eggs extracts. The synthesized compounds were obtained starting from inosine and are characterized by an N1-alkyl...
Article
Full-text available
Smenamides are an intriguing class of peptide/polyketide molecules of marine origin showing antiproliferative activity against lung cancer Calu-1 cells at nanomolar concentrations through a clear pro-apoptotic mechanism. To probe the role of the activity-determining structural features, the 16-epi-analogue of smenamide A and eight simplified analog...
Preprint
Full-text available
Smenamides are an intriguing class of peptide/polyketide molecules of marine origin showing antiproliferative activity against lung cancer Calu-1 cells at nanomolar concentrations through a clear pro-apoptotic mechanism. To probe the role of the activity-determining structural features, the 16-epi-analogue of smenamide A and eight simplified analog...
Article
Full-text available
In this note, we report the discovery of a novel pyridinium chlorochroamte-catalyzed process in which an α-bromomethyl-tetrahydrofuran bond was oxidatively cleaved to give a γ-lactone functionality. The title compound was synthesized from a C15 polybrominated acetogenin compound, isolated from the marine sponge Mycale rotalis, by benzoylation follo...
Article
Full-text available
The title compound, C 31 H 48 O 6 , is a polyoxygenated epoxy steroid obtained by a multi-step synthesis involving oxidation of 7-dehydrocholesterol. It crystallizes in the P 2 1 2 1 2 1 space group; however, the absolute structure of the molecule in the crystal could not be determined by resonant scattering. The configuration at the C5 and C6 posi...
Article
Full-text available
The title compound, C 22 H 34 O 6 , is one of the products obtained by oxidation of squalene with the catalytic system RuO 4 (cat.)/NaIO 4 . It crystallizes in the P -1 space group, with four crystallographically independent molecules related by a pseudo- C2 symmetry axis. The structural analysis also shows that the title compound is isomeric with...
Article
Herein, we report on the synthesis and the evaluation of preliminary antitumor properties of a small collection of platinum(II) complexes in which a cisplatin-like unit is tethered to 7-deazaadenosine through linear alkyl chains (from 1 to 6 carbon atoms) installed at the C6 purine position. The complexation is performed by exploiting the reactivit...
Article
Full-text available
A thorough investigation of the minor oxidation products of two penta-tetrahydrofuran compounds with pyridinium chlorochromate has been carried out. Isolation of ring-B oxygenated spiroketal and degradation products, including polycyclic mono- and bis-lactone compounds, supports the previously postulated involvement of cyclic enolether intermediate...
Article
The title compound, C 22 H 34 O 6 , is a product of oxidation of squalene with the catalytic system RuO 4 (cat.)/NaIO 4 . The asymmetric unit contains two crystallographically independent molecules of very similar geometry approximately related by the non-crystallographic translation vector c /2. As a consequence, the average diffracted intensity i...
Article
A chiral pool protocol toward the synthesis of the smenamide family of natural products is described. Two stereoisomers of smenamide A, namely, ent-smenamide A and 16-epi-smenamide A were synthesized with a 2.6 and 2.5% overall yield, respectively. Their carboxylic acid moieties were assembled starting from S-citronellene via two Wittig reactions a...
Article
Full-text available
The title compound, C22H34O6, is a product of oxidation of squalene with the catalytic system RuO4(cat.)/NaIO4. The asymmetric unit contains two crystallographically independent mol-ecules of very similar geometry approximately related by the non-crystallographic translation vector c/2. As a consequence, the average diffracted intensity in the hkl...
Article
Full-text available
The title compound, C 12 H 20 N 4 O 5 , crystallizes in the monoclinic space group P 2 1 , with four crystallographically independent molecules in the asymmetric unit. The four molecules have a very similar conformation that is basically determined by the formation of two intramolecular hydrogen bonds between the amino NH 2 donors and the carbonyl...
Article
Background: G-quadruplex DNA is involved in many physiological and pathological processes. Both clinical and experimental studies on DNA G-quadruplexes are slowed down by their enzymatic instability. In this frame, more stable chemically modified analogs are needed. Methods: The bis-end-linked-(gggt)2 PNA molecule (BEL-PNA) was synthesized using...
Article
Full-text available
Acid-mediated condensation of diones (I) with diamino triazole (II) produces nitrogen-rich fused heterocycles.
Article
Full-text available
A new class of N-rich fused heterocyclic compounds containing the triazolo-triazine moiety was synthesized and studied by cyclic voltammetry, UV/Vis spectroscopy, X-ray diffraction, and first principle computations. All the compounds show reversible or quasi-reversible reduction processes, with reduction potentials easily tunable within the class....
Article
Full-text available
Cyclic N (1)-pentylinosine monophosphate (cpIMP), a novel simplified inosine derivative of cyclic ADP-ribose (cADPR) in which the N (1)-pentyl chain and the monophosphate group replace the northern ribose and the pyrophosphate moieties, respectively, was synthesized. The role played by the position of the phosphate group in the key cyclization step...
Article
Full-text available
This unit contains four basic protocols describing the synthesis of 5-aminoimidazole-4-carboxamide riboside (AICAR), 5-aminoimidazole-4-carboxamide riboside (ZPM), their 4-N functionalized derivatives, and two sugar-modified analogs of AICAR. The first and second basic protocols reveal the importance of solid-phase synthesis to obtain novel AICAR a...
Article
Herein, the synthesis of a nucleoside platinum(II) complex in which a cisplatin-like unit is joined to 7-deazaadenosine through an amino alkyl chain installed at the C6 position of purine was explored. The capability of the new complex to react with DNA purine bases was confirmed by a model reaction with deoxyguanosine monophosphate, whereas its an...
Article
A general synthesis of C6-pyridylpurine nucleosides is described. The reported synthetic procedure exploits the regioselective addition of pyridinyl Grignard reagents, obtained by bromine/magnesium exchange between mono- or dihalopyridines and iPrMgCl, to the C6–N1–O– moiety of nebularine N1-oxide. The regioselective transmetallation of unsymmetric...
Article
Full-text available
The synthesis of four novel platinum complexes, bearing N6-(6-amino-hexyl)adenosine or a 1,6-di(adenosin-N6-yl)-hexane respectively, as ligands of mono-functional cisplatin or monochloro(ethylendiamine)platinum(II), is reported. The chemistry exploits the high affinity of the charged platinum centres towards the N7 position of the adenosine base sy...
Article
Full-text available
In recent years considerable attention has been given to the use of natural substances as anticancer drugs. The natural antioxidant dipeptide L-carnosine belongs to this class of molecules because it has been proved to have a significant anticancer activity both in vitro and in vivo. Previous studies have shown that L-carnosine inhibits the prolife...
Article
Full-text available
The title compound, C20H16O7, contains a cis-fused γ-lactone tetra­hydro­furan ring system functionalized with two benzo­yloxy groups. Both rings adopt an envelope conformation. The mol­ecule assumes an elongated shape and exibits non-crystallographic C 2 symmetry. The benzo­yloxy groups are almost planar [maximum deviations of 0.0491 (15) and 0.03...
Article
Full-text available
The title compound, C20H18O6, prepared from d-mannitol by a two-step procedure, is a functionalized fused bis-tetra-hydro-furan. In the central fragment, consisting of two fused tetra-hydro-furan rings, one O atom and its two adjacent C atoms, a methyl-ene and a bridgehead C atom, are disordered over two sets of sites with an occupancy ratio of 0.7...
Article
Full-text available
The antiviral activity of certain acyclic nucleosides drew our attention to the fact that the replacement of the furanose ring by an alkyl group bearing hydroxyl(s) could be a useful structural modification to modulate the biological properties of those nucleosides. Herein, we report on the synthesis of some novel acadesine analogues, where the rib...
Article
Full-text available
The title compound, C31H48O7, a polyoxygenated steroid, was obtained by chemical oxidation of 7-de-hydro-cholesteryl acetate. The mol-ecular geometry features trans A/B and C/D junctions at the steroid core with the acetyl groups in the equatorial position and a fully extended conformation for the alkyl side chain. A chair conformation is observed...
Article
Full-text available
The title compound, C8H13N10 +·Cl−, is the monochlorhydrate salt of an aromatic bis­(di­amino­triazole). The cation is centrosymmetric, lying about an inversion centre (Ci symmetry) because the acidic H atom is disordered over two centrosymmetrically related ring N atoms, with equal multiplicity. It is noteworthy that protonation occurs at an N ato...
Article
Full-text available
The title compound, C31H48O7, a polyoxygenated steroid, was obtained by chemical oxidation of 7-de­hydro­cholesteryl acetate. The mol­ecular geometry features trans A/B and C/D junctions at the steroid core with the acetyl groups in the equatorial position and a fully extended conformation for the alkyl side chain. A chair conformation is observed...
Article
Full-text available
The title compound, C31H48O7·0.04CH3COOH, is a polyoxy­genated steroid obtained by selective chemical oxidation of 7-de­hydro­cholesteryl acetate. The asymmetric unit comprises three mol­ecules of the steroid (Z′ = 3) and a mol­ecule of acetic acid which has occupancy factor 0.131 (5). The geometric parameters of the independent mol­ecules do not r...
Article
Tautomerism in the [1,2,4]triazolo[3,2-c][1,2,4]triazole fused aromatic system has been investigated by single-crystal X-ray analysis, UV/Vis spectroscopy and theoretical calculations on selected new heterobicycle derivatives. The reactions of 3,4-diamino-1,2,4-triazoles with acyl chlorides or acetic anhydride in pyridine at reflux led to ring clos...
Article
Full-text available
The title compound, C14H10N2O3, is a π-conjugated mol-ecule containing a benzoxazole aromatic fused heterobicycle. The benzoxazole ring system is planar within 0.01 Å. The mol-ecule assumes an approximately flat conformation, the benzoxazole ring system forming dihedral angles of 6.52 (12) and 7.4 (3)° with the benzene ring and the nitro group, res...
Article
Full-text available
The title compound, C17H15N7O4, is a push–pull non-linear optical chromophore containing a di­alkyl­amino donor group and the di­cyano­imidazolyl acceptor separated by a π-conjugated path. The benzene and imidazole rings are not coplanar, making a dihedral angle of 10.0 (2)°. In the crystal, mol­ecules are linked by an extended set of hydrogen bond...