Thomas Naderer

Thomas Naderer
Monash University (Australia) · Department of Biochemistry and Molecular Biology

PhD

About

86
Publications
15,278
Reads
How we measure 'reads'
A 'read' is counted each time someone views a publication summary (such as the title, abstract, and list of authors), clicks on a figure, or views or downloads the full-text. Learn more
2,406
Citations
Additional affiliations
January 2004 - December 2010
University of Melbourne
Position
  • Researcher

Publications

Publications (86)
Article
Neisseria gonorrhoeae causes the sexually transmitted disease gonorrhoea. The treatment of gonorrhoea is becoming increasingly challenging, as N. gonorrhoeae has developed resistance to antimicrobial agents routinely used in the clinic. Resistance to penicillin is wide-spread partly due to the acquisition of β-lactamase genes. How N. gonorrhoeae su...
Chapter
The NLRP3 inflammasome senses the activity of pore-forming toxins secreted by Staphylococcus aureus. The bacterial toxins compromise plasma membrane integrity which activates the NLRP3 inflammasome to induce host pore-forming proteins and cellular suicide, termed pyroptosis. Host cell death rates are routinely determined at pre-defined time points...
Article
To control infections phagocytes can directly kill invading microbes. Mpeg1, a pore‐forming protein sometimes known as perforin‐2, is reported to be essential for bacterial killing following phagocytosis. Mice homozygous for the mutant allele Mpeg1tm1Pod succumb to bacterial infection and exhibit deficiencies in bacterial killing in vitro. Here we...
Article
Full-text available
The opportunistic pathogen Acinetobacter baumannii possesses stress tolerance strategies against host innate immunity and antibiotic killing. However, how the host-pathogen-antibiotic interaction affects the overall molecular regulation of bacterial pathogenesis and host response remains unexplored. Here, we simultaneously investigate proteomic cha...
Article
Full-text available
Cell death plays an important role during pathogen infections. Here, we report that interferon-γ (IFNγ) sensitizes macrophages to Toll-like receptor (TLR)-induced death that requires macrophage-intrinsic death ligands and caspase-8 enzymatic activity, which trigger the mitochondrial apoptotic effectors, BAX and BAK. The pro-apoptotic caspase-8 subs...
Preprint
Full-text available
Macrophages can prevent infections from intracellular pathogens by restricting access to essential nutrients, termed nutritional immunity. With the exception of tryptophan depletion, it is unclear if other amino acids are similarly regulated in infected macrophages. Here, we show that the expression of nutrient transporters in Legionella-infected m...
Article
The programmed cell death pathways of pyroptosis and apoptosis protect mammals from infections. The activation of host cell death signaling depends on cell surface and cytosolic receptors that bind bacterial molecules or sense their activity. The formation of cytosolic protein complexes, such as the inflammasome and apoptosome, activates caspases,...
Article
Full-text available
Sensing of microbes activates the innate immune system, depending on functional mitochondria. However, pathogenic bacteria inhibit mitochondrial activity by delivering toxins via outer membrane vesicles (OMVs). How macrophages respond to pathogenic microbes that target mitochondria remains unclear. Here, we show that macrophages exposed to OMVs fro...
Article
Innate immunity is crucial for the host to defend against infections, and understanding the effect of polymyxins on innate immunity is important for optimizing their clinical use. In this study, we investigated the potential toxicity of polymyxins on human macrophage-like THP-1 and neutrophil-like HL-60 cells. Differentiated THP-1 human macrophages...
Article
Full-text available
The NLRP3 inflammasome has emerged as a central immune regulator for sensing virulence factors expressed by microbial pathogens for triggering antimicrobial inflammation. Inflammation can be harmful and therefore this response must be tightly controlled. The mechanisms by which immune cells, such as macrophages, discriminate benign from pathogenic...
Article
Staphylococcus aureus causes necrotizing pneumonia by secreting toxins such as leukocidins that target front‐line immune cells. The mechanism by which leukocidins kill innate immune cells and trigger inflammation during S. aureus lung infection, however, remains unresolved. Here, we explored human‐induced pluripotent stem cell‐derived macrophages (...
Article
Antimicrobial drug resistance is threatening to take us to the "pre-antibiotic era", where people are dying from preventable and treatable diseases and the risk of hospital-associated infections compromises the success of surgery and cancer treatments. Development of new antibiotics is slow, and alternative approaches to control infections have eme...
Article
Full-text available
The Beta-barrel assembly machinery (BAM) complex is essential for localization of surface proteins on bac- terial cells, but the mechanism by which it functions is unclear. We developed a direct stochastic optical reconstruction microscopy (dSTORM) methodology to view the BAM complex in situ . Single-cell analysis showed that discrete membrane prec...
Article
To fight infections, macrophages undergo a metabolic shift whereby increased glycolysis fuels antimicrobial inflammation and killing of pathogens. Here we demonstrate that the pathogen Candida albicans turns this metabolic reprogramming into an Achilles' heel for macrophages. During Candida-macrophage interactions intertwined metabolic shifts occur...
Article
The intracellular pathogen Legionella pneumophila influences numerous eukaryotic cellular processes through the Dot/Icm‐dependent translocation of more than 300 effector proteins into the host cell. Although many translocated effectors localize to the Legionella replicative vacuole, other effectors can affect remote intracellular sites. Following i...
Article
Full-text available
Author summary Neisseria gonorrhoeae causes the sexually transmitted disease gonorrhoea in more than 100 million people worldwide every year. The bacteria replicate in the reproductive tract by evading innate and adaptive immunity. In the absence of effective vaccines and the rise of antibiotic resistance, understanding the molecular interactions b...
Data
The proteome of purified and crude N. gonorrhoeae OMVs. N. gonorrhoeae MS11-A OMVs were isolated from culture supernatants (crude) or further purified by gradient ultracentrifugation (pure) and their proteome determined by LC-MS/MS. The complete list shows all identified proteins and their relative abundance. (XLSX)
Data
OMVs deliver PorB to human macrophages mitochondria. Human THP-1 macrophages were incubated with N. gonorrhoeae OMVs and PorB and Tom20 localization was determined by immunofluorescence analysis after 24 hours. (TIF)
Data
NGFG_01788 promotes OMV biogenesis. (A) Purified OMVs and whole bacterial lysates (WBL) from equal numbers of wild type (WT) and ΔNGFG_01788 deletion mutant were stained with coomassie after gel-electrophoresis. PorB is indicated based on immune blot analysis. NR indicates not-relevant lane. (B) Total protein content of purified OMVs from WT and ΔN...
Data
Ectopically expressed PorB targets mitochondria and induces apoptosis. Tet-On advanced Hela cells were transiently transfected with pTRE-Tight response plasmids (pTRE.PorB.IVS.IRES.eGFP and pTRE.Puro.PorB). (A) Doxycycline dependent ectopically expressed PorB (green) colocalized with Tom20 (red) in a time dependent manner, causing the loss of mitoc...
Data
N. gonorrhoeae OMVs induce sequential loss of mitochondrial health, caspase activation and cell death in macrophages. BMDMs were labelled with TMRM (red), exposed to OMVs and incubated with caspase-3/7 specific fluorogenic substrate (green) and Draq7 (blue). Time-lapse images are shown from indicated time frames. Arrow indicates a macrophage that s...
Data
Live cell imaging of OMV treated macrophages. BMDMs were labelled with TMRM (red), exposed to OMVs and incubated with Draq7 (blue) and caspase-3/7 fluorogenic substrate (green). Time-lapse movie showing bright field and fluorescent images every 30 minutes for 48 hours. (AVI)
Data
Live cell imaging of PBS treated macrophages. BMDMs were labelled with TMRM (red), treated with PBS and incubated with Draq7 (blue) and caspase-3/7 fluorogenic substrate (green). Time-lapse movie showing bright field and fluorescent images every 30 minutes for 48 hours. (AVI)
Data
Subcellular annotation of the OMV proteome. Proteins identified in N. gonorrhoeae OMVs (crude and pure) were analyzed by subcellular localization predictor tools and their predicted localization was assigned based on the majority of votes. (XLSX)
Article
Full-text available
The human pathogen Legionella pneumophila must evade host cell death signaling to enable replication in lung macrophages and to cause disease. After bacterial growth, however, L. pneumophila is thought to induce apoptosis during egress from macrophages. The bacterial effector protein, SidF, has been shown to control host cell survival and death by...
Data
Genetic deletion of BCL-RAMBO. (A) Gene targeting strategy. The targeting construct replaces exon 2 (black bar on the WT locus) with a neomycin resistance cassette (neo) resulting also in a frame-shift. Restriction sites are indicated (H, Hind III; X, XbaI; S, SacI; B, BamHI). A 3′ probe was designed to recognize a 5.9 kb and 8.7 kb fragment from S...
Data
Detection of caspase-3/7 activity in cycloheximide treated macrophages. The mitochondria of BMDMs were labeled with TMRM (red), treated with cycloheximide and incubated with Draq7 (blue DNA stain) and caspase-3/7 fluorescent substrate (green). Fluorescent and bright field images were acquired every 60 min.
Data
Detection of caspase-3/7 activity in ΔflaA L. pneumophila infected macrophages. The mitochondria of BMDMs were labeled with TMRM (red), infected with ΔflaA L. pneumophila and incubated with Draq7 (blue DNA stain) and caspase-3/7 fluorescent substrate (green). Fluorescent and bright field images were acquired every 60 min.
Data
Detection of caspase-3/7 activity in WT L. pneumophila infected macrophages. The mitochondria of BMDMs were labeled with TMRM (red), infected with WT L. pneumophila and incubated with Draq7 (blue DNA stain) and caspase-3/7 fluorescent substrate (green). Fluorescent and bright field images were acquired every 60 min.
Data
L. pneumophila replicates in BCL-RAMBO deficient macrophages. WT and BCL-RAMBO deficient immortalized macrophages were infected with ΔflaA and ΔflaA/ΔsidF (MOI 10) for 2 h and the colony forming units (CFUs) determined at 6 and 48 h post infection. Mean and SD (from three independent colonies) are shown.
Data
Cell death of caspase-11 deficient BMDMs at high MOl. Draq7 positive (dead) WT, caspase-1/11 DKO and caspase-11 KO BMDMs infected at a MOl of 20 with ΔflaA L. pneumophila. Data are representative of two independent experiments. Mean and S.D. of three independent biological replicates shown.
Article
Full-text available
Bacteria translocate effector molecules to host cells through highly evolved secretion systems. By definition, the function of these effector proteins is to manipulate the host cell biology and the sequence, structural and functional annotations of these effector proteins will provide a better understanding of how bacterial secretion systems promot...
Article
Full-text available
The pathogenic yeast Candida albicans escapes macrophages by triggering NLRP3 inflammasome-dependent host cell death (pyroptosis). Pyroptosis is inflammatory and must be tightly regulated by host and microbe, but the mechanism is incompletely defined. We characterized the C. albicans endoplasmic reticulum (ER)-mitochondrion tether ERMES and show th...
Article
Full-text available
Human pathogenic Legionella replicate in alveolar macrophages and cause a potentially lethal form of pneumonia known as Legionnaires' disease1. Here, we have identified a host-directed therapeutic approach to eliminate intracellular Legionella infections. We demonstrate that the genetic deletion, or pharmacological inhibition, of the host cell pro-...
Article
Full-text available
Autophagy is an essential component of innate immunity, enabling the detection and elimination of intracellular pathogens. Legionella pneumophila, an intracellular pathogen that can cause a severe pneumonia in humans, is able to modulate autophagy through the action of effector proteins that are translocated into the host cell by the pathogen's Dot...
Article
Macrophages can respond to microbial infections with programmed cell death. The major cell death pathways of apoptosis, pyroptosis and necroptosis, are tightly regulated to ensure adequate immune reactions to virulent and persistent invaders. Macrophage death eliminates the replicative niche of intracellular pathogens and induces immune attack. Not...
Article
Full-text available
Author Summary Macrophages are the primary host cells for a number of important microbial pathogens, including protozoan parasites belonging to the genus Leishmania. With few exceptions, little is known about the nutrient composition of the vacuolar compartments occupied by these pathogens. Leishmania proliferate within the mature phagolysosome com...
Article
Background Previous findings have suggested that Helicobacter pylori induces autophagic processes and subsequently takes refuge in autophagosomes, thereby contributing to persistent infection. Recently, a noncanonical form of autophagy, LC3 (microtubule-associated protein 1 light chain 3)-associated phagocytosis (LAP), has been shown to be required...
Article
Full-text available
Key questions remain about how exactly C. albicans filaments are recognised by the caspase-1 inflammasome to trigger pyroptosis. An intriguing C. albicans genetic mutation identified in our lab is in the Srb9 subunit of the Mediator complex (a central eukaryotic transcriptional regulator). While this mutant strain is able to transition to long hyph...
Article
Full-text available
Parasitic protozoa, such as Leishmania species, are thought to express a number of surface and secreted nucleoside triphosphate diphosphohydrolases (NTPDases) which hydrolyze a broad range of nucleoside tri- and diphosphates. However, the functional significance of NTPDases in parasite virulence is poorly defined. The Leishmania major genome was fo...
Article
Full-text available
The fungal pathogen Candida albicans causes macrophage death and escapes, but the molecular mechanisms remained unknown. Here we used live-cell imaging to monitor the interaction of C. albicans with macrophages and show that C. albicans kills macrophages in two temporally and mechanistically distinct phases. Early upon phagocytosis, C. albicans tri...
Article
Full-text available
The causative agent of Legionnaires' disease, Legionella pneumophila, resides within alveolar macrophages by exporting 295 bacterial virulence proteins (effectors) to modulate host cell processes. This leads to the formation of a unique vacuolar niche and the suppression of macrophage cell death pathways, which, in turn, promote bacterial survival...
Article
Leishmania parasites express three highly conserved small myristoylated proteins (SMPs) that are targeted to distinct membranes. SMP-1 is exclusively found in the flagellum, depending on myristoylation and palmitoylation. In contrast, monoacylated SMP-2 and SMP-4 are localized to the flagellar pocket and plasma membrane, respectively. Here, we demo...
Article
Full-text available
Leishmania are protozoan parasites that proliferate within the phagolysome of mammalian macrophages. While a number of anti-oxidant systems in these parasites have been shown to protect against endogenous as well as host-generated reactive oxygen species, the potential role of enzymes involved in the repair of oxidatively damaged proteins remains u...
Article
Full-text available
Autotransporters are secreted proteins that are assembled into the outer membrane of bacterial cells. The passenger domains of autotransporters are crucial for bacterial pathogenesis, with some remaining attached to the bacterial surface while others are released by proteolysis. An enigma remains as to whether autotransporters should be considered...
Data
Full-text available
(A) The barrel-domain of BigE (shaded grey) shares 40% sequence identity (60% sequence similarity) to that of the protein from Ralstonia. A segment of unknown function from 220–528 (green) is repeated 8 times in BigE. BLAST searches revealed proteins related to the autotransporter from Ralstonia in five other species of Beta-Proteobacteria (YP_0013...
Data
Full-text available
Forty-seven autotransporters dataset. (PDF)
Data
Full-text available
Phylogenetic analysis of functional (passenger) domains. The active diagram contains all accession information for the 1523 autotransporter sequences. Sub-domain signatures were identified using Pfam analysis of all sequences, and these are represented as radiating coloured symbols. The length of this line is proportional to the number of residues...
Data
Full-text available
Logos characteristic of the β-signal motif. In order to best represent the conserved features inherent in motif 5, a sequence Logo was constructed for the motif 5 sequences from each of the 13 (of 14) classes of barrel-domains shown in Figure 5. Some subtle differences are evident between the classes. In each case, the height of the letter represen...
Data
Autotransporter detection in E. coli pathotypes. (PDF)
Article
The complexity of the metabolic networks in even the simplest organisms has raised new challenges in organizing metabolic information. To address this, specialized computer frameworks have been developed to capture, manage, and visualize metabolic knowledge. The leading databases of metabolic information are those organized under the umbrella of th...
Article
Full-text available
Author Summary Mitochondrial carrier proteins evolved during endosymbiosis to transport substrates across the mitochondrial inner membrane. As such the proteins are associated exclusively with eukaryotic organisms. Despite this, we identified putative mitochondrial carrier proteins in the genomes of different intracellular bacterial pathogens, incl...
Article
Trypanosomatid parasites express a number of mono- and diacylated proteins that are targeted to distinct regions of the plasma membrane including the cell body, the flagellum and the flagellar pocket. The extent to which the acylation status and other protein motifs regulate the targeting and/or retention of these proteins to the distinct membrane...
Data
LncP is targeted to mitochondria, but does not impact on apoptosis induced by staurosporine treatment. (A) LncP-EGFP was expressed in HeLa cells. Cells were immunostained with antibodies against GFP (green) and active caspase-3 (red). Hoechst 33342 was used as a counterstain to indicate nucleus (blue). The panel at the right shows the cells treated...
Data
Localization of 4HA-LncP in macrophages and HeLa cells. (A) Macrophages were infected with L. pneumophila (either wild type 130b or the ΔdotA mutant) expressing 4HA-LncP. Bacteria were visualized using anti-Legionella antibodies (blue) 4HA-LncP was visualized with antibodies to HA (green). Prior to fixation, cell were stained with MitoTracker Red....
Data
Recombinant expression and purification of LncP. Proteins were separated by SDS-PAGE and stained with Coomassie Blue. Markers in left-hand column (bovine serum albumin, carbonic anhydrase, and cytochrome c); lanes 1–4, Escherichia coli C0214 (DE3) containing the expression vector without (lanes 1 and 3) and with (lanes 2 and 4) the coding sequence...
Data
Predicted membrane proteins in the L. pneumophila Dot/Icm effector repertoire. Two hundred and seventy-five proteins encoded in the genome of L. pneumophila strain Philadelphia were identified as effector proteins in a recent high-throughput study [13]. Here the protein sequences of these effectors as well effectors unique to L. pneumophila strain...
Data
Prevalence of lncP among strains of L. pneumophila. A range of L. pneumophila strains were tested for carriage of lncP by Southern hybridisation as described previously [90]. A digoxigenin (DIG)-labelled probe was generated by PCR amplification according to the manufacturer's instructions (Roche) with the primer pair 5′- caacggatcctatttcatttgtagtcc...
Article
Full-text available
Parasitic protozoa belonging to the genus Leishmania are the cause of a spectrum of diseases in humans, as well as chronic long-term infections. These parasites exhibit a remarkable capacity to survive and proliferate within the phagolysosome compartment of host macrophages. Studies with defined Leishmania mutants in mouse models of infection have...
Article
Full-text available
Leishmania parasites proliferate within nutritionally complex niches in their sandfly vector and mammalian hosts. However, the extent to which these parasites utilize different carbon sources remains poorly defined. In this study, we have followed the incorporation of various (13)C-labeled carbon sources into the intracellular and secreted metaboli...
Article
Leishmania parasites must adapt to elevated temperatures and other environmental stresses during infection of their mammalian hosts. How these environmental cues are sensed is poorly understood. In this study we show that calcium uptake is required for parasite thermotolerance at 34-37°C. To identify potential downstream targets of calcium influx,...
Article
This chapter describes the range of glycan structures and pathways that are found in different parasitic protozoa. All parasitic protists express a range of glycoconjugates that form protective protein-rich or carbohydrate-rich surface coats. Protein-rich coats are typically found on developmental stages that inhabit nonhydrolytic niches, such as t...
Data
Sequence alignment of GND. GND protein sequences of L. major (UniProt: Q4Q4U6), T. cruzi (Q4D0F2), T. brucei (D0AAS0), E. coli (B7LKT5), Y. pestis (A4TNY0), H. sapiens (P46926) and C. albicans (Q04802) were aligned with ClustalW and edited with Boxshade, whereby identical or similar residues are boxed in black or grey, respectively. The arrow marks...
Data
Gene deletion of GND in L. major promastigotes. (A) Strategy for targeted gene replacement via homologous recombination. The knock out cassettes for targeted gene deletion of the L. major GND was generated by PCR amplifying the 5′UTR of GND using the primers gnd5′F (GGAAGCTTCTGCGCGTATGCCTCTGCAC) and gnd5′R (GGCGAATTCGGTCGATAAAAGTATGTGAA) and by amp...
Article
Full-text available
Intracellular parasites, such as Leishmania spp, must acquire suitable carbon sources from the host cell in order to replicate. Here we present evidence that intracellular amastigote stages of Leishmania exploit amino sugars in the phagolysosome of mammalian macrophages as a source of carbon and energy. L. major parasites are capable of using N-ace...