Pilar Brazis

Dechra Pharmaceuticals Plc

Background Sublingual immunotherapy (SLIT) has been deployed in humans and dogs; to the best of the authors’ knowledge, there are no published studies about the use of SLIT in cats. Objectives Evaluate the clinical efficacy of SLIT in atopic cats sensitized to dust and storage mites, assessing immunological changes associated with SLIT treatment....

Background Canine otitis externa (OE) is a common disease characterised by inflammation of the epithelial tissue of the external ear canal. Secondary infections are frequent, and Malassezia pachydermatis and Staphylococcus pseudintermedius are routinely isolated and treated with antifungal and antibiotic compounds. Hypothesis/Objectives To analyse...

Background Canine atopic dermatitis (cAD) is a pruritic allergic skin disease most often caused by Dermatophagoides farinae. Differences in the sensitization profile to D. farinae have been reported between people and dogs. However, allergic dogs traditionally have been treated with extracts intended for human immunotherapy. Hypothesis/Objectives...

Background While the efficacy of allergen-specific immunotherapy (ASIT) to treat canine atopic dermatitis has been well established, it remains unclear why not all dogs show the same response to treatment. The goal of the study was to determine the relationship between duration of ASIT and two measurements of success: disease severity and concomita...

Background The European poultry red mite (PRM) Dermanyssus gallinae, a common ectoparasite of laying chickens and pigeons; it also can feed on other birds, humans and domestic animals, causing clinical signs ranging from mild discomfort to severe dermatitis. Little is known about possible hypersensitivity to PRM or cross‐sensitization with house du...

Background: Autosomal recessive congenital ichthyosis (ARCI) in golden retrievers is due to a PNPLA1 gene mutation, which plays a role in epidermal lipid organization and metabolism. Topical therapies are used to reduce scaling; however, there are few published efficacy studies. Objectives: To examine the efficacy of topical treatment based on g...

Autologous skin grafts are effective for the repair of large skin wounds, but the availability of large amounts of skin is often limited. Through bioengineering, several autologous skin substitutes have been developed for use in human clinical practice. However, few skin substitutes are available for use in animals. The aim of this study was to dev...

Background: Canine atopic dermatitis is a pruritic allergic skin disease. House dust mites have been identified as the main non-seasonal responsible agent. Unlike in human allergic patients, groups 1 and 2 antigens have been described as minor allergens in dogs, while groups 15 and 18 are considered the major allergens. Despite these differences,...

Ceramides (CER) are essential sphingolipids of the stratum corneum (SC) that play an important role in maintaining cutaneous barrier function. Skin barrier defects occur in both human beings and dogs affected with atopic dermatitis, and have been associated with decreased CER concentrations and morphological alterations in the SC. The aim of the pr...

The purpose of our study was to document the continued comparative proficiency of different laboratories that perform a monoclonal antibody-based enzyme-linked immunosorbent assay (macELISA) for detection of allergen-specific immunoglobulin (Ig)E in dogs. Replicate samples of 18 different sera pools were independently evaluated in a single blinded...

Background: There is increasing interest in the biological and pathological study of equine skin owing to the high prevalence of cutaneous diseases in horses. However, knowledge of equine skin cell biology and cultures is limited by the low number of in vitro studies in the literature. Hypothesis/objectives: The objective of the study was to dev...

A canine skin equivalent model has been validated for the assessment of a topical formulation effects. Skin equivalents were developed from freshly isolated cutaneous canine fibroblasts and keratinocytes, after enzymatic digestion of skin samples (n = 8) from different breeds. Fibroblasts were embedded into a collagen type I matrix, and keratinocyt...

Topical treatment with cyclosporine A (CsA) has recently become possible with the development of novel nanotechnology pharmaceutical formulations of CsA able to penetrate through the epidermis providing good absorption and dermal action. The aim of this multicentre, blinded, parallel, randomized, placebo controlled trial was to evaluate the efficac...

Background Adelmidrol is a semisynthetic derivative of azelaic acid and analogue of the anti-inflammatory compound palmitoylethanolamide (PEA). Based upon its physicochemical properties, adelmidrol is suitable for topical application. The main objective of the present study was to evaluate the efficacy of a topical adelmidrol emulsion on early and...

The purpose of this study was to evaluate the reproducibility of results yielded using a monoclonal antibody based ELISA for detection of allergen specific IgE when run in six separate affiliated laboratories. On two separate occasions, duplicate samples of 15 different sera pools were independently evaluated by each laboratory in a single blinded...

Palmitoylethanolamide (PEA) is an endogenous lipid mediator with anti-inflammatory and anti-hyperalgesic properties. The main objective of the present study was to evaluate the effects of PEA on the cutaneous allergic inflammatory reaction induced by different immunological and non-immunological stimuli in hypersensitive dogs. Six spontaneously Asc...

Palmitoylethanolamide (PEA) is an endocannabinoid-like compound and the parent molecule of the aliamide family, a group of fatty acid amides able to act through the down-regulation of mast cell degranulation. PEA has been proven to exert both analgesic and anti-inflammatory activity, and recent studies have shown its ability in reducing clinical sy...

The objective of this study was to evaluate the Susceptibility of 135 Pseudomonas spp strains against the most common quinolones used in veterinary practice: enrofloxacin, marbofloxacin, and ciprofloxacin. Single cultures of Pseudomonas were isolated From samples obtained from otic and cutaneous infections in dogs and cats. For the susceptibility t...

Sensitisation to mites is frequent in atopic dogs. The main mite genus involved in canine atopic dermatitis is Dermatophagoides. The importance of storage mite allergens in dogs has been controversial. The aim of this study was to evaluate the sensitisation rates against storage mites (Lepidoglyphus destructor and Tyrophagus putrescentiae) and hous...

Storage mites may be considered important allergens in dogs with atopic dermatitis. High sensitization rates to Tyrophagus , Acarus , and Lepidoglyphus species have been reported in atopic dogs, and dry pet food has been suggested as a potential source of storage mite exposure. The aim of the present study was to evaluate commercial dry dog food fo...

The development of a complex cellular model, which incorporates the basic cell components of the dog skin, would be a useful tool to investigate the biology and pathology of canine skin and also to replace animal testing partially. The aim of the present study was to develop and characterize a canine skin equivalent. Epidermal keratinocytes and der...

TTAAAGATTAAGCCATGCATGTCTAAGTATAAGCTTTTATACGGCGAAACTGCGAATGGCTCATTAAAACAGTTATAGTTTATTTGATGGTCTTTACTACATGGATAACCGTGGTAATTCTATGGCTAATACATGCGCACATACCTCTTCCTCTGGAAGGGTAGTGTTTATTAGATACAGAACCAACCCACCTTCCGGTGGTCCTCAGGTGATTCATAGTAACCGAACGGATCGCGTTATGACTTCGGTCGGCGACGGATCATTCAAGTTTCTGACCTATCAGCTTTCGACGGTACTGTATTGGACTACCGTGGCAGTGACGGGTAACGGGGAATTAGGGTTCGATTCCG...

To assess binding of IgE to native, whole hydrolyzed, and separated hydrolyzed fractions of soy protein in serum obtained from dogs with experimentally induced soy protein hypersensitivity. 8 naïve Beagles (6 experimentally sensitized to native soy protein and 2 control dogs). 6 dogs were sensitized against soy protein by administration of allergen...

Dermal microdialysis, a relatively noninvasive technique, allows investigation of the changes in cellular mediators released during cutaneous allergic responses. This technique was used to evaluate the effect of cyclosporin A, an immunosuppressive drug used for treatment of canine atopic dermatitis, on the cutaneous release of two pro-inflammatory...

To assess whether dogs with experimentally induced type I hypersensitivity against soy protein would respond to soy hydrolysate and develop cutaneous or gastrointestinal tract reactions after intradermal and oral challenge exposure. 12 naïve Beagle pups (9 sensitized and 3 control dogs). 9 dogs were sensitized against soy protein by administration...

To assess expression and function of cell-surface IgE receptors on the canine mastocytoma cell line C2 maintained in continuous culture. C2 cells maintained in medium lacking IgE for up to 10 passages before being stored at -80 C. Cells were thawed, cultured in medium without IgE for 1 to 3 passages, sensitized for 7 days with IgE-rich serum from d...

The role of IgE on mast cell (MC) activation is well known. Recent studies have demonstrated that IgE also has the ability to up-regulate the high affinity IgE receptor (Fc epsilon RI) on the surface of human and murine MC, leading to an increased production of cytokines and chemokines. In the present study, we have examined the influence of IgE le...

To examine the inhibitory potential of rupatadine, a new H1-antihistamine and anti-PAF agent, on histamine and TNF-alpha release. Comparison with an H1-antihistamine (loratadine) and a PAF-antagonist (SR-27417A). Dispersed canine skin mast cells were used to assess the effect of the drugs tested on FcepsilonRI-dependent and -independent histamine r...

Stem cell factor (SCF), the c-kit receptor ligand, plays a critical role in mast cell (MC) development and differentiation. In addition, SCF has recently been found to both modulate and induce MC activation. To investigate the effect of SCF on canine cutaneous MC function, we have characterized the ability of SCF to modulate the release by mature c...

Forty atopic dogs were studied for 28 days after the oral administration of four randomised treatments: (A) arofylline (1 mg/kg) twice daily for four weeks; (B) prednisone (0.5 mg/kg) twice daily for the first week, once a day during the second week and every 48 hours for the remaining two weeks; (C) prednisone following the same protocol but at a...

Atopic dermatitis results from the interaction between allergen and allergen-specific IgE bound to the mast cell surface receptors. This process triggers mast cell degranulation and accounts at least for early phase reaction. Furthermore, there is increasing in vitro and in vivo evidence that IgE has the ability to induce overexpression of the Fc e...

The dog mastocytoma BR cell line provides us with a permanent source of canine mast cells, allowing a characterization of secretory mediators that exert important effects in canine allergic and nonallergic diseases and in physiological processes. We studied the ultrastructural characteristics and histamine releasing activity after immunological and...