About
46
Publications
56,359
Reads
How we measure 'reads'
A 'read' is counted each time someone views a publication summary (such as the title, abstract, and list of authors), clicks on a figure, or views or downloads the full-text. Learn more
330
Citations
Introduction
twitter.com/joshua_thia
I am broadly interested in evolution, population genetics, ecology and conservation.
Currently, I am working on the genetic mechanisms and constraints of insecticide resistance in various arthropod pest species in the Australian grains industry.
Current institution
Additional affiliations
November 2010 - January 2011
Education
January 2015 - January 2019
January 2012 - July 2014
Publications
Publications (46)
Discriminant analysis of principal components (DAPC) has become a popular method for visualising population structure due to its simplicity, computational speed, and freedom from demographic assumptions. Despite the popularity of DAPC, there has been little discussion on best practise. In this work, I provide guidelines for standardising the use of...
Genomic data are becoming increasingly affordable and easy to collect, and new tools for their analysis are appearing rapidly. Conservation biologists are interested in using this information to assist in management and planning but are typically limited financially and by the lack of genomic resources available for non-model taxa. It is therefore...
Genomic data provide valuable insights into pest management issues such as resistance evolution, historical patterns of pest invasions and ongoing population dynamics. We assembled the first reference genome for the redlegged earth mite, Halotydeus destructor (Tucker, 1925), to investigate adaptation to pesticide pressures and demography in its inv...
Background
Invasive Australian populations of redlegged earth mite, Halotydeus destructor (Tucker), are evolving increasing organophosphate resistance. In addition to the canonical ace gene, the target gene of organophosphates, the H. destructor genome contains many radiated ace‐like genes that vary in copy number and amino acid sequence. In this w...
Insecticides are important for chemical control of arthropod pests in agricultural systems but select for resistance as an adaptive trait. Identifying the genetic mechanism(s) underpinning resistance can facilitate development of genetic markers, which can be used in monitoring programs. Moreover, understanding of genetic mechanisms in a broader po...
The genetic basis of pesticide resistance has been widely studied, but the exact nature of this evolutionary process in the field is often unclear, particularly when a limited number of populations is considered and when there is a lag between the evolutionary event and its investigation. We showed that an unprecedented number of recurrently evolve...
Non-target effects of insecticides used in agriculture can impact the ecosystem services provided by beneficial insects. Understanding the broader effects of chemical usage requires multi-species investigations on the impact of different insecticide active ingredients. In this work, we tested the utility of coated vials as a quick, cheap, and effic...
Populations under similar selection pressures may adapt via parallel evolution or dispersal of advantageous alleles. Here, we investigated insecticide resistance in the invasive blue-green aphid, Acyrthosiphon kondoi, which reproduces clonally in Australia and has rapidly developed resistance across geographic locations. Using genomic, transcriptom...
Heritable genetic versus non-heritable plastic phenotypic variation determine how selection may shape evolutionary responses. Population genomic studies typically aim to identify associations between loci (SNPs) and phenotypes, missing broader insight into heritable basis of polygenic traits with quantitative genomic approaches.
Genomic animal mode...
Evolution of Buchnera –aphid host symbioses is often studied among species at macroevolutionary scales. Investigations within species offer a different perspective about how eco‐evolutionary processes shape patterns of genetic variation at microevolutionary scales. Our study leverages new and publicly available whole‐genome sequencing data to study...
Aphids (Hemiptera: Aphidoidea) are economically important crop pests worldwide. Because of growing issues with insecticide resistance and environmental contamination by insecticides, alternate methods are being explored to provide aphid control. Aphids contain endosymbiotic bacteria that affect host fitness and could be targeted as potential biocon...
The barley yellow dwarf virus (BYDV) of cereals is thought to substantially increase the high-temperature tolerance of its aphid vector, Rhopalosiphum padi, which may enhance its transmission efficiency. This is based on experiments with North American strains of BYDV and R. padi. Here, we independently test these by measuring the temperature toler...
BACKGROUND
The bluegreen aphid (Acyrthosiphon kondoi) is a worldwide pest of alfalfa, pulses, and other legume crops. An overreliance on insecticides to control A. kondoi has potentially placed populations under selection pressure favouring resistant phenotypes, but to date, there have been no documented cases of insecticide resistance. Recently, A...
Coevolution of Buchnera-aphid host symbioses is often studied among species at the macroevolutionary scale. Investigations within species offer a different perspective about how eco-evolutionary processes shape patterns of genetic variation at the microevolutionary scale. Our study leverages new and publicly available whole-genome sequencing data t...
Inbreeding threatens many species of conservation concern. Inbreeding decreases heterozygosity (increases homozygosity) and can drive up a population’s genetic load as deleterious mutations increase in frequency. Understanding how declining heterozygosity translates into declining fitness is of high importance for conservation practitioners. In thi...
Wolbachia (Hertig 1936) (Rickettsiales: Ehrlichiaceae) has emerged as a valuable biocontrol tool in the fight against dengue by suppressing the transmission of the virus through mosquitoes. Monitoring the dynamics of Wolbachia is crucial for evaluating the effectiveness of release programs. Mitochondrial (mtDNA) markers serve as important tools for...
Resistance to pesticides is typically identified via laboratory bioassays after field control failures are observed, but the results of such assays are rarely validated through experiments under field conditions. Such validation is particularly important when only a low-to-moderate level of resistance is detected in the laboratory. Here we undertak...
Chemical resistance in pest organisms threatens global food security and human health, yet resistance issues are mostly dealt with reactively. Predictive models of resistance risk provide an avenue for field practitioners to implement proactive pest management but require knowledge of factors that drive resistance evolution. Despite the importance...
BACKGROUND
Invasive Australian populations of redlegged earth mite, Halotydeus destructor (Tucker), are evolving increasing organophosphate resistance. In addition to the canonical ace gene, the target gene of organophosphates, the H. destructor genome contains many radiated ace -like genes that vary in copy number and amino acid sequence. In this...
Insecticides, herbicides, and fungicides are ubiquitously applied in agricultural production systems to increase yields by managing insect pests, weeds, and diseases. While valuable, these chemicals can also have unwanted off-target effects on human health, biodiversity, and resistance evolution. Pesticide usage data can help to estimate and mitiga...
Despite the popularity of discriminant analysis of principal components (DAPC) for studying population structure, there has been little discussion of best practise for this method. In this work, I provide guidelines for standardising the application of DAPC to genotype datasets. An often‐overlooked fact is that DAPC generates a model describing gen...
We present the first draft genome for an invasive mite, the redlegged earth mite, Halotydeus destructor (Tucker, 1925), a major pest of Australian grains and pasture. Our de novo assembly comprised 132 contigs, with a total length of 48.90 Mb, an N50 of 874,492, an L50 of 14, a GC content of 45.3%, 14,583 putative genes, and a high level of complet...
Genomic studies are uncovering extensive cryptic diversity within reef‐building corals, suggesting that evolutionarily and ecologically relevant diversity is highly underestimated in the very organisms that structure coral reefs. Furthermore, endosymbiotic algae within coral host species can confer adaptive responses to environmental stress and may...
BACKGROUND
Quantifying how chemical tolerance of pest arthropods varies with temperature is important for understanding the outcomes of chemical control, for measuring and monitoring resistance, and for predicting how pesticide resistance will evolve under future climate change. We studied the redlegged earth mite, Halotydeus destructor (Tucker), a...
BACKGROUND
Bryobia (Koch) mites belong to the economically important spider mite family, the Tetranychidae, with >130 species described worldwide. Due to taxonomic difficulties and most species being asexual, species identification relies heavily on genetic markers. Multiple putative Bryobia mite species have been identified attacking pastures and...
Introduction
Chemical resistance in pest organisms threatens global food security and human health, yet resistance issues are mostly dealt with reactively. Predictive models of resistance risk provide opportunity for field practitioners to implement proactive management but require knowledge of variables that drive the evolution of resistance. Desp...
The Scaptodrosophila genus represents a large group of drosophilids with a worldwide distribution and a predominance of species in Australia, but there is little information on the presence and impacts of Wolbachia endosymbionts in this group. Here we describe the first Wolbachia infection from this group, wClay isolated from Scaptodrosophila clayt...
In this issue of Molecular Ecology, Tepolt et al. (2021) illustrate how the genetic architecture of adaptation and life history influence invasive success. A marvel of many invasive species is that they are incredibly successful despite evolutionary expectations that they will have low adaptive potential and suffer inbreeding depression due to init...
The redlegged earth mite, Halotydeus destructor (Tucker, 1925: Trombidiformes, Eupodoidea, Penthaleidae), is an invasive mite species. In Australia, this mite has become a pest of winter pastures and grain crops. We report the complete mitogenome for H. destructor, the first to represent the family Penthaleidae, superfamily Eupodoidea. The mitogeno...
Aim
Globally distributed pelagic fishes are typified by very low to negligible genetic differentiation at oceanic scales arising from high gene flow and (or) large population sizes. However, genomic approaches employing thousands of loci to characterise genetic variation can illuminate subtle patterns of genetic structure and facilitate demographic...
Interactions among selection, gene flow, and drift affect the trajectory of adaptive evolution. In natural populations, the direction and magnitude of these processes can be variable across different spatial, temporal, or ontogenetic scales. Consequently, variability in evolutionary processes affects the predictability or stochasticity of microevol...
Related plants are often hypothesized to interact with similar sets of pollinators and herbivores, but this idea has only mixed empirical support. This may be because plant families vary in their tendency to share interaction partners.
We quantify overlap of interaction partners for all pairs of plants in 59 pollination and 11 herbivory networks ba...
A combination of δ13C and δ15N isotope ratios,capture−mark−recapture and satellite telemetry data were used to investigate the foraging locations supporting nesting loggerhead turtles Caretta caretta on the Woongarra coastline, southeast Queensland, Australia. Known foraging grounds were available for a subset of these turtles and supplemented with...
Koala retrovirus (KoRV) is a recently endogenized retrovirus associated with neoplasia and immunosuppression in koala populations. The virus is known to display sequence variability and to be present at varying prevalence in different populations, with animals in southern Australia displaying lower prevalence and viral loads than northern animals....
Turning SNP data into biologically meaningful results requires considerable computational acrobatics, including importing, exporting, and manipulating data among different analytical packages and programming environments, and finding ways to visualise results for data exploration and presentation. We introduce genomalicious, an R package designed t...
The interaction between granivorous scatterhoarding mammals and plants is a conditional mutualism: scatterhoarders consume seeds (acting as predators), but the movement of seed by scatterhoarders may contribute to dispersal (acting as mutualists). Understanding the ecological factors that shape this relationship is highly relevant in anthropogenica...
Complex life cycles may evolve to dissociate distinct developmental phases in an organism's lifetime. However, genetic or environmental factors may restrict trait independence across life stages, constraining ontogenetic trajectories. Quantifying covariance across life stages and their temporal variability is fundamental in understanding life‐histo...
In this study, we sequenced the full mitochondrial genome of Bathygobius cocosensis, an abundant intertidal fish species, which may provide insights into the evolutionary genetics of chaotic genetic patchiness and range expansion in marine systems. The mitochondrial genome is 16,692 bp, and contains 13 protein-coding genes along with 22 tRNA and 2...
![Fig. 1. (a) Geographic context of our study (modified from [25]). The...](profile/Hazel-Chapman-3/publication/299461965/figure/fig1/AS:345326650183680@1459343697304/a-Geographic-context-of-our-study-modified-from-25-The-Mambilla-Plateau-dark_Q320.jpg)
The montane forests of south-eastern Nigeria are of immense conservation value due to their high levels of biodiversity and endemism. Yet despite increasing anthropogenic disturbance and forest fragmentation, little is known about the genetics of resident tree populations. We used a set of conserved chloroplast simple sequence repeat (SSR) primers...
Large-seeded trees are often heavily dependent on animals to disperse their seeds. However, this also makes them highly sensitive to declines in frugivores. Our study species, Cordia millenii (Boraginaceae), is dispersed primarily by chimpanzees. Apparently low recruitment in our study site, Ngel Nyaki Forest (Mambilla Pleateau, Taraba State, Niger...
We investigate aspects of recruitment ecology and population genetics of a poorly regenerating tree, Cordia millenii (Boraginaceae), on the Mambilla Plateau (a montane region in south-east Nigeria).
Fruit of C. millenii is an important food source for chimpanzees, who are also the primary dispersers of its large seeds.
Increasing anthropogenic de...
While the Mendeley citation manager is a great piece of freeware, many journals are missing from its citation-style depository. While there does exist a means to customise desired citations, the GUI is not particularly user-friendly.
I have put together the code (a ".csl" file) for "African Journal of Ecology", using a pre-exisiting template in th...
The montane forests of Africa represent some of the Earth's most diverse and threatened ecosystems. In particular, those in West Africa have received comparatively little attention from scientists in terms of understanding the ecology and biodiversity of their species. This thesis wishes to understand genetic and ecological factors that underpin th...
Intro West African biota are less well characterised in terms of their species diversity and ecology relative to other geographic locales in Africa and tropics in general (Norris et al. 2010). We chose two tree species, Lovoa trichilioides (Meliaceae) and a Cordia sp. (Boraginaceae), to understand ecologic and genetic processes affecting Afromontan...
Mitochondrial cytochrome oxidase I (COI) gene sequencing (DNA barcoding) of Ciona specimens from New Zealand (NZ) led to the first record of the solitary ascidian Ciona savignyi in the Southern Hemisphere. We sought to quantify C. savignyi COI genetic diversity around the NZ archipelago and to compare this with diversity within C. savignyi's native...
Questions
Questions (22)
Hi all,
I have pooled RAD-seq data (multiple individuals sequenced in a single library prep) and I am interested in haplotype frequencies.
Reads have been mapped to a de novo reference and I have a BAM file for each population.
It seems reasonable to assume that haplotypes frequencies could be called from BAM files in a manner analogous to determining allele frequencies in sequenced pools; e.g. counts of different haplotypes in the sample.
However, I cannot seem to find any good software specifically designed to deal with pooled RAD data. GATK and HaploPool, for example, are extremely limited by ploidy size. Collen Beck's rad_haplotyper (https://github.com/chollenbeck/rad_haplotyper) is nice to use and good for RAD data but assumes individuals as the sequenced unit; at most it would only provide information about which populations are likely fixed for particular haplotypes.
Does anyone have good recommendations?
Cheers,
~ Josh
Hey all.
Been getting a little bit more familiar with R's ape package for phylogenetic analysis.
I am having a difficult time figuring out how to export the bootstrap node support with my tree. I am sure it's an easy answer, but Googling and the ape docos haven't been useful.
I'm currently just doing a NJ tree.
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
# Predefine the tree building params
co1.out = 26
co1.nj.gen <- function(xx) root(phy = nj(dist.dna(xx)), outgroup = co1.out,
resolve.root = TRUE)
# Actually make the tree
co1.nj.tr <- co1.nj.gen(co1.align)
# Bootstrap nodes
# Write tree
write.nexus(co1.nj.tr, file = "TREE_COI.nex")
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
Is there some way of associating the bootstraps (co1.nj.bs) with the phylo object (co1.nj.tr), such that when I export as a NEXUS file, and open in a program like FigTree, I can get my calculated node values?
Many thanks in advance!
~ Josh
I have created a denovo reference "genome" of RAD contigs and have mapped back my reads using BWA. Using the the samtools flagstat option I queried my read alignments. An example:
3232117 + 0 in total (QC-passed reads + QC-failed reads)
0 + 0 secondary
0 + 0 supplementary
0 + 0 duplicates
3226784 + 0 mapped (99.84% : N/A)
3232117 + 0 paired in sequencing
1595145 + 0 read1
1636972 + 0 read2
2662532 + 0 properly paired (82.38% : N/A)
2871947 + 0 with itself and mate mapped
354837 + 0 singletons (10.98% : N/A)
213393 + 0 with mate mapped to a different chr
213393 + 0 with mate mapped to a different chr (mapQ>=5)
Two things are obvious from the alignment: 1) singletons must arise because a mate fails the quality check during the mapping procedure, and 2) in some cases mates map to different "chromosomes" (RAD contigs).
So the questions.
Firstly, I feel like eliminating singletons would essentially be throwing out information. Should these be kept or is there too much uncertainty in their origin to be reliable because their mate hasn't mapped?
Secondly (and more importantly), how do I remove reads in which mate pairs have mapped to different chromosomes? I have played with the samtools view -f 3 option (read paired + read mapped in proper pair) and this reduces the split mates but they are still present; it also removes singletons. From what I gather, there doesn't seem to be a specific option combination to do this (https://broadinstitute.github.io/picard/explain-flags.html). NOTE: I have also tried using -f 11 (read paired + read mapped in proper pair + mate unmapped), but this removes all reads (I think because only reads that are properly paired are allowed make it through, and thus cannot have an unmapped mate).
A follow on question is should such pairs be removed, given that they might be indicative of repetitive sequences?
Thoughts and comments?
I have sequence data from the ezRAD method. Most of the sequences have the cut site "GATC" at the start, however some do not (see example below). I am trying to find a program that will remove any sequence that does not have the "GATC" at the start. However, all I can find are trimming/adapter removal programs.
Suggestions? Was going to write my own script to do this, but would rather not re-invent the wheel.
KEEP:
@D3NT6Q1:329:C6396ACXX:6:1101:11990:3865 2:N:0:GTCCGCTCTTT
GATCTTTCTCCAATTCCCCGCTCTCCAAGTCTCAGGAGTATTCAAAACAAACAACGTCCTATTTATGCCCTGACATCACATCTCTATGGCAACCACACTT
+
BBBFFFFFFFFFFIIIIIIIIIIIIIIIIFIIIIIIIIBFFIIIIIIIIIFIIIIIFFIFIIFFFFFFFFFFFFFFFFFFFFFFFBFFFFFFFFBFBFBB
DISCARD:
@D3NT6Q1:329:C6396ACXX:6:1101:2011:28589 2:N:0:GTCCGCTCTTT
TACGACGCGACGCCGTTCAACCAGATATTGAAGCAGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGGGC
+
BBBFFFFFFFFFFIIFIIIIIIIIIIIIIIIIIIIIFFFFFFFFFBFBBBBBBBBBBBBFFBFFFBFF7BBFB<BBBFBBBBBBB7<77<BBBB<77'00
If the environment is particularly heterogeneous spatially and temporally, we might not expect selection regimes to remain constant. I am particularly interested in this with respect to Johnson and Black's 1982 concept of "chaotic genetic patchiness". What papers do you know of that might fit this description?
