
Dr. Shruthi SD- M.Sc., Ph.D., PGDHRM
- Researcher at BioEdge Solutions
Dr. Shruthi SD
- M.Sc., Ph.D., PGDHRM
- Researcher at BioEdge Solutions
About
65
Publications
69,037
Reads
How we measure 'reads'
A 'read' is counted each time someone views a publication summary (such as the title, abstract, and list of authors), clicks on a figure, or views or downloads the full-text. Learn more
907
Citations
Introduction
"BioEdge Solutions was started in January 2020 with an aim to provide customized support and analysis to serve the scientific community. By understanding that this is an era of researchers at the cutting edge of molecular biology we try to offer affordable, safe and effective solutions using most advanced and latest technologies. Our main aim is to create and promote research interest among students and train them for a better tomorrow”.
Current institution
BioEdge Solutions
Current position
- Researcher
Additional affiliations
September 2010 - May 2013
The Oxford College, Bangalore
Position
- Professor (Assistant)
Publications
Publications (65)
Objective: The green plant waste consists of a high amount of lignocellulosic materials offering an intense environment for the growth of cellulolytic bacteria, which have ability to degrade plant biomass as a carbon source. This cellulase produced can be used to break down plant waste into valuable products such as monomeric sugars, biofuels, comp...
Objective: Moringa oleifera Lam (Moringaceae) is a highly valued plant which has an impressive range of medicinal uses with high nutritional value. Different parts of the plant were being used for the treatment of illness due to the presence of various secondary metabolites that gives the plant anti-bacterial, anti-oxidant and other properties. The...
The health benefits of indoor plants are widely explored now a days and methods of psychological assessment are explored. In this regard we have collected few indoor plants and authenticated them to further investigate for its symbiotic relationship with bacteria. As traditional taxonomic studies possess intrinsic limitations with plant species ide...
Fish fungus is one of the main concerns of people who culture fishes in hatcheries and aquariums as they adversely affect fishes leading to its death. Chemical formulations are used to treat fungus growing on fishes but not all fishes can be cured with the chemical formulations and the effects of these chemicals maybe shown when human consumes thos...
Nanoparticles possess antimicrobial, antitumor, and antioxidant properties that are useful in the biomedical field due to their unique properties, which have a profound impact on human life. The biological synthesis of nanoparticles is safer, more eco-friendly, and more economically viable to produce nanoparticles organically than using chemical or...
Microbial biopesticides include several microorganisms like bacteria, fungi, baculoviruses, and nematode-associated bacteria acting against invertebrate pests in agro-ecosystems. The most commonly used microbial biopesticides are living organisms, which are pathogenic for the target pest. These include biofungicides namely, Trichoderma and penicill...
Benincasa hispida, commonly known as ash gourd, has been used as a vegetable in various countries. It has been known to have medicinal properties and has been used extensively in Indian traditional medicine, Ayurveda. This paper analyzes the properties of ash gourd that makes it a desirable medicinal plant. We compared the properties of three extra...
Silver nanoparticles (AgNP's) have recently piqued researchers' interest due to their unique features of being environmentally benign, safe to use, and cost-effective. In this study fresh fruit peel and fungal infected fruit peel of Citrus sinensis were collected. For molecular studies, Genomic DNA was isolated from the peel and the ITS gene was PC...
As fruits are highly nutritious, they become a habitat for a diverse range of bacteria that can cause deterioration and be pathogenic or beneficial. Cellulolytic bacteria are one type of beneficial bacteria proven to digest the cellulose components of fruits. The present study aims at isolating, identifying and characterization of cellulolytic bact...
Chillies are widely used throughout the world in the form of spice and are also used in making beverages and medicines. They are rich in vitamins, especially in vitamin A and C. Chillies contain lots of minerals like potassium, magnesium, and iron. They have been employed for pain relief as they are known to inhibit pain messengers and hence their...
The recent threat which has received worldwide attention is COVID-19, a rapidly spreading new strain of Coronavirus. It has affected more than 176 countries and due to the lack of efficacious drugs or vaccines against SARS-CoV-2, it has further worsened the situation everywhere. After infecting the host, the ssRNA genome of SARS-CoV-2 is translated...
In today’s scenario of agricultural production, usage of biocontrol agents is a must. These biocontrol agents should be naturally occurring from living organisms which act on pathogens of plants or animals. They have various advantages over chemical pesticides as they are environmentally friendly and have less side effects. The most common form of...
Following publication of this article, the authors realized there was an error in Figure 2b that needed correction. The TFEB panel of Figure 2b (total lysate) appears to be the same as the TFEB panel of Figure 2e (cytosolic fraction); the TFE3 panels of Figure 2b (total lysate) appear to be the same as the TFE3 panels of Figure 2e (cytosolic fracti...
Keratinocytes maintain epidermal integrity through cellular differentiation. This process enhances intraorganelle digestion in keratinocytes to sustain nutritional and calcium-ionic stresses observed in upper skin layers. However, the molecular mechanisms governing keratinocyte differentiation and concomitant increase in lysosomal function is poorl...
Keratinocytes maintain epidermis integrity and function including physical and antimicrobial barrier through cellular differentiation. This process is predicted to be controlled by calcium ion gradient and nutritional stress. Keratinocytes undergo proteome changes during differentiation, which enhances the intracellular organelle digestion to susta...
Antibiotics such as fluoroquinolones (FQLs) are commonly used to treat ocular infections but are also known to cause dermal melanocyte toxicity. The release of dispersed pigments from the iris into the aqueous humor has been considered a possible ocular side effect of the systemic administration of FQLs such as Moxifloxacin, and this condition is k...
Ten novel (E)-1-((2-phenoxyquinolin-3-yl) methylene) thiosemicarbazides were prepared by reacting 2-chloroquinoline-3-carbaldehydes with phenols followed by coupling the products with thiosemicarbazide. The ten thiosemicarbazides 1-10 were subjected to both in vitro and in silico studies for their pharmacological properties. They were found to exhi...
Background: Rubia cordifolia Linn.[ Rubiaceae], commonly known as Indian Maddar and Manjistha, is used as medicine for treatment of various ailments in Traditional System of Medicine of India. Purpose: To isolate rubiadin and evaluate in vitro antiproliferative activity and in silico method. Material and Methods: Rubiadin was isolated from the root...
Piper nigrum [Piperaceae], commonly known as black pepper is used as medicine fairly throughout the greater part of India and as a spice globally.
To isolate piperine and evaluate in vitro cytotoxic [antiproliferative] activity and in silico method.
Piperine was isolated from the fruits of P.nigrum. Piperine was characterized by UV,IR, 1 H-NMR, 13...
A new 2,2′-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS)-radical scavenging and antiproliferative agents of pyrrolo[1,2-a]quinoline derivatives have been synthesized. An efficient method for the synthesis of 14 novel diversified pyrrolo[1,2-a]quinoline derivatives has been described using 4-(1,3-dioxolan-2-yl)quinoline and different phen...
Glycyrriza glabra Linn.[ Fabaceae], commonly known as yashtimadhu, mulhatti, is used as medicine for treatment of various aliments in Traditional System of Medicine fairly throughout the greater part of India. In the present study, we have evaluated anticancer activity of Ammonium glycyrrhizinate by in vitro and in silico method. Ammonium glycyrrhi...
Objective: Heliotropium indicum (H. indicum) has been used widely for centuries on warts and to treat inflammations and tumors. H. indicum Linn (Family Boraginaceae) is a medicinal plant. It is known commonly as “Cock’s comb”. H. indicum Linn has various medicinal uses in the treatment of disease conditions such as Abdominal pains, Amenorrhoea, Dys...
The present study was to analyze the anticancer property of Monochoria Vaginalis, Ipomea Carnia, Nardostachys Jatamansion HeLa cells. The Indian medicinal plants used for cancer and noncancerous diseases were collected for the activity. The crude extracts were prepared by using standard protocols. The anti-proliferative effect of plant extracts was...
Hedychium spicatum Buch.-Ham. (Family-Zingiberaceae), commonly known as spiked ginger lily, is found in the entire Himalayan region. The rhizomes are reported to be used as tranquilizer, hypotensive, antispasmodic, CNS depressant, analgesic, anti-inflammatory, antimicrobial, antioxidant, antifungal, pediculicidal, cytotoxic and anthelmintics. The p...
Objective:
To investigate the in vitro antidiabetic effects of isolated 4-Oxo-4H-pyran-2,6-dicarboxylic acid bis-[6-methyl-heptyl] ester from the chloroform extract of root of Tragia cannabina (T. cannabina) and AMP kinase activation property of the isolated compound.
Methods:
The roots of T. cannabina were collected and extracted with ethanol [...
Kirganelia reticulata is a useful shrub having various medicinal properties. In vivo, in vitro and in silico antiarthritic activity of a phytoconstituent, ellagic acid (EA) isolated from the leaves of K. reticulata was screened. EA is a naturally occurring plant polyphenol found at high concentrations that act as potential protectors against variet...
In folk remedies, the whole plant of Phyllanthus rheedii is used to treat diabetes. This study aimed to investigate the in vitro and in silico antidiabetic effects of isolated Phthalic Acid 1-(8-Methyl-Non-2-Enyl) Ester2-Tetradecyl Ester from the chloroform extract of whole plant of Phyllanthus rheedii and AMP kinase activation property of the isol...
Kirganelia reticulata is a medicinal shrub which has been valued for centuries in ayurvedic medicine. In vitro, in vivo and in silico antiarthritic activity of a phytoconstituent, polyprenol isolated from the leaves of Kirganelia reticulata was screened. Various in vitro models such as inhibition of protein denaturation, effect of membrane stabiliz...
Plant based medicines are effective against many human infectious diseases either by paralysing or killing the pathogen. In the present study, petroleum ether, chloroform, ethanol and aqueous extracts of Alstorιia scholaris bark were screened for their bactericidal, fungicidal and anthelmintic properties. Antibacterial activity revealed that chloro...
Ethanobotany is a recent branch of natural science dealing with various aspects such as anthropology, archeology, botany, ecology, economics and medicine, religious, cultural and several other disciplines. Recently, great interest is given to studies of herbal drugs and traditional remedies are indicated worldwide and there has been an upsurge in t...
Psidium guajava is an important food crop and medicinal plant available in tropical and subtropical countries, widely used in food and folk medicines around the world. It contains important phytoconstituents such as tannins, triterpenes, flavonoid: quercetin, pentacyclic triterpenoid: guajanoic acid, saponins, carotenoids, lectins, leucocyanidin, e...
Microbial and helminthes infections are the most common health problems in India; in developing countries they pose a large treat to public. These infections can affect most population in endemic areas with major economic and social consequences. In vitro antibacterial activity of a phytoconstituent, polyprenol isolated from the leaves of Kirganeli...
Cheminformatics of polyprenol, quercetin, ellagic acid are done to find out druggability of compounds. The interaction studies of drug and target are done and compared with standard drug available in market. The in silico techniques employed in pharmaceutical companies for the process of drug discovery are used. The compounds structures are taken a...
Cheminformatics of polyprenol, quercetin, ellagic acid are done to find out druggability of compounds. The interaction studies of drug and target are done and compared with standard drug available in market. The in silico techniques employed in pharmaceutical companies for the process of drug discovery are used. The compounds structures are taken a...
Kirganelia reticulata is a medicinal shrub which has been valued for
centuries in ayurvedic medicine. In vitro, in vivo and in silico
antiarthritic activity of a phytoconstituent, polyprenol isolated from
the leaves of Kirganelia reticulata was screened. Various in vitro
models such as inhibition of protein denaturation, effect of
membrane stabiliz...
Medicinal plants are used in herbalism and thought to have some medicinal properties. They form the easily available source for healthcare purposes in rural and tribal areas. Ethanobotany is a distinct branch of natural science dealing with various aspects such as anthropology, archaeology, botany, ecology, economics and medicine, religious, cultur...
Natural antioxidants present in the plants scavenge harmful free radicals from our body. Antioxidants exert their mode of action by suppressing the formation
of reactive oxygen species either by inhibition of enzymes or by chelating trace elements. Free radicals are the chemical species that have an unpaired electron
and play very important role in...
The present study was aimed for wound healing potential of
The ethanobotanical properties of Basella alba have been reviewed in this article. Various parts of the plant are used for treatment of the diseases as well as for different healing activities of human beings as well as animals across the globe especially in India and China. Its use has been discovered as asperient, rubefacient and for catarrhl inf...
2,4-Dichlorophenoxyacetic acid (2,4-D) degrading bacteria were isolated from sewage samples collected from selected sites in Bangalore, which have no history of 2,4-D exposure. A herbicide 2,4-D was used in a minimal salt medium as a sole source of carbon to isolate and enumerate the 2,4-D degraders. Isolated bacteria found to be Bacilli, having ab...
In the present study we carried out a systematic record of the phytochemical and antioxidant properties of the medicinal plant Kirganelia reticulata. The different solvent extracts of Kirganelia reticulata leaves were screened for their in vitro phytochemical and antioxidant activity. Leaves were extracted with solvents of different polarities like...
Murraya koenigii, curry leaf is found almost throughout India up to an altitude of 1500 m. It is much cultivated for its aromaticity and is used in South India as a natural flavouring agent in various curries. The present study deals with the antimicrobial activities which confirmed that the methanol extracts of leaves are active against K. pneumon...
Studies on bacterial amylase, especially, in the developing countries have concentrated mainly on Bacillus species, probably, because of the simple nature and nutritional requirements of these organisms. At present, bacterial amylases are vastly produced and used under extreme conditions of pH and temperature. The effect of temperature and pH on th...
N-phenyl-5-substituted -aryl-3-p-(fluorophenyl) pyrazoles have been synthesized from cyclization of 4-fluoroacetophenone (1) with various benzaldehydes (2) to give 4-fluorophenylstyrylketone (3) followed by treatment with phenyl hydrazine. The title compounds and their derivatives have been characterized by their elemental and spectral analysis. Th...
The present study was conducted to evaluate the hepatoprotective activity of different extracts of Tinospora cordifolia against carbon tetrachloride (CCl4) induced liver damage in rats. The pet ether, ethanol and aqueous extracts of various parts of the plant such as leaf, stem and root were tested at the dose of 200mg/kg body weight orally using W...
The indole nucleus seems to be a promising basis for design and synthesis of new derivatives able to protect oxidative stress in a variety of acute and chronic pathologies. The paper presents an overview of indole derived compounds in which inhibitory action has been demonstrated against potent microbes and also tested for antioxidant activity. Cel...
Productive efficiency of the apicultural industry depends upon improvements in bee breed, bee management and bee forage. The behavioural traits such as pollen carrying capacity, pollen and honey stores and colony population were compared for black and yellow strains of Indian honey bee Apis. cerana indica F. Observations of honey bees showing maxim...
Medicinal plants are various plants which are used in herbalism having medicinal properties. Few plants or their phytochemical constituents have been proven to have medicinal effects by rigorous science or have been approved by regulatory agencies. Shade dried leaves of Murraya koenigii was extracted using successive solvent extraction method using...
Many toxic aromatic and aliphatic compounds occurs in waste water of number of industries. Among these phenol is the most common aromatic pollutant and is also found in contaminated drinking water. Phenol can be toxic when present at elevated level and is known to be carcinogenic. It has effect on health even at low concentration. Thus, removal of...
Questions
Questions (2)
I have taken 25 primer sets and obtained 25 dendrograms and corresponding binary matrix for 40 turmeric samples. How can i club all 25 data and get a single dendrogram? or how will i represent 25 primers data as one output?
1) I have used forward primer and reverse primer which is mouse specific .
forward primer-5'ATA CTCGAG ATGGCAACTGCACCGTACAACTAC 3'- having XHO1 restriction site
reverse primer- 5'ATA TTCGAA CTAGCAGCCACAGCCTTCTCTCTGGGG-having hindIII site
2) I have amplified(pcr) rab14 by c-DNA which was mouse specific.
3) mRab14 size- 648 bp
pEGFP-C3 vector size-4.7 kb
4) I have tried TA cloning and p-jet cloning (shuttle vector) kit. but I didn't get clone.
I am attaching here -pEGFP-C3 VECTOR information, insta cloning kit protocol and P-JET cloning kit protocol .
Your suggestions as well as constructive criticisms are welcome.