Concetta Giancola

Concetta Giancola
University of Naples Federico II | UNINA · Department of Pharmacy

Prof. Physical Chemistry, Ph.D

About

157
Publications
18,742
Reads
How we measure 'reads'
A 'read' is counted each time someone views a publication summary (such as the title, abstract, and list of authors), clicks on a figure, or views or downloads the full-text. Learn more
3,799
Citations
Citations since 2016
28 Research Items
1505 Citations
2016201720182019202020212022050100150200
2016201720182019202020212022050100150200
2016201720182019202020212022050100150200
2016201720182019202020212022050100150200
Additional affiliations
January 2013 - present
University of Naples Federico II
Position
  • Professor (Associate)

Publications

Publications (157)
Article
Full-text available
Two analogues of the MS3 aptamer, which was previously shown to have an exquisite capability to selectively bind and modulate the activity of mutant huntingtin (mHTT), have been here designed and evaluated in their physicochemical and biological properties. Featured by a distinctive propensity to form complex G-quadruplex structures, including larg...
Article
Share link: https://authors.elsevier.com/a/1fzzQ3IyxE1cxP Lipid nanocarriers are among the most employed systems for drug delivery purposes in several research and industrial sectors, since their favorable properties ensure broad applicability. The design and characterization of these nanosystems are of paramount importance to obtain controlled ou...
Article
Full-text available
Among oral delivery systems, oil in water nano-emulsions (O/W NEs) are of particular interest to improve pharmacokinetics of lipophilic compounds. Recently, we have implemented a successful strategy to improve O/W NEs stability, based on a polymeric coating on an oil core, namely secondary O/W NEs, through the use of pharma grade formulations. Howe...
Article
Full-text available
A set of guanine-rich aptamers able to preferentially recognize full-length huntingtin with an expanded polyglutamine tract has been recently identified, showing high efficacy in modulating the functions of the mutated protein in a variety of cell experiments. We here report a detailed biophysical characterization of the best aptamer in the series,...
Article
Full-text available
The promoter regions of important oncogenes such as BCL2 and KRAS contain GC-rich sequences that can form distinctive noncanonical DNA structures involved in the regulation of transcription: G-quadruplexes on the G-rich strand and i-motifs on the C-rich strand. Interestingly, BCL2 and KRAS promoter i-motifs are highly dynamic in nature and exist in...
Article
Full-text available
The aim of this research is to obtain new data about the complexation between β-cyclodextrin (β-CD) and benzoic acid (BA) as a model reaction of the complex formation of hydrophobic molecules with cyclodextrins (CDs) in various media. This research may help developing cyclodextrin-based pharmaceutical formulations through the choice of the appropri...
Article
Full-text available
For many years, cyclodextrins (CDs) have been the object of attention for their capability of improving the stability, solubility and bioavailability of numerous molecules of interest, including drugs and nutraceuticals. They have low toxicity and for this reason have been employed for different routes of administration, including oral, ocular, nas...
Article
Under slightly acidic conditions, cytosine-rich DNA sequences can form non-canonical secondary structures called i-motifs, which occur as four stretches of cytosine repeats form hemi-protonated C·C+ base pairs. The growing interest in the i-motif structures as important components in functional DNA-based nanotechnology or as potential targets of an...
Article
Full-text available
Chemotherapy represents the most applied approach to cancer treatment. Owing to the frequent onset of chemoresistance and tumor relapses, there is an urgent need to discover novel and more effective anticancer drugs. In the search for therapeutic alternatives to treat the cancer disease, a series of hybrid pyrazolo[3 ,4-d]pyrimidin-4(5H)-ones tethe...
Preprint
Full-text available
Chemotherapy represents the most applied approach to cancer treatment. Owing to the frequent onset of chemoresistance and tumor relapses, there is an urgent need to discover novel and more effective anticancer drugs. In search for therapeutic alternatives to treat the cancer disease, a se-ries of hybrid pyrazolo[3,4-d]pyrimidin-4(5H)-ones tethered...
Article
Full-text available
DNA G-quadruplexes (G4s) form in relevant genomic regions and intervene in several biological processes, including the modulation of oncogenes expression, and are potential anticancer drug targets. The human KRAS proto-oncogene promoter region contains guanine-rich sequences able to fold into G4 structures. Here, by using circular dichroism and dif...
Article
Curcumin (CURC) is endowed with many pharmacological properties, among these anti-inflammatory, antioxidant, antimicrobial, and anticancer activity. Unfortunately, CURC is basically water-insoluble and undergoes a rapid photodegradation, chemical degradation, and metabolism. CURC stability and solubility can be improved by the complexation with cyc...
Article
Nucleic acid aptamers are innovative and promising candidates to block the hallmark event in the prion diseases, that is the conversion of prion protein (PrP) into an abnormal form; however, they need chemical modifications for effective therapeutic activity. This communication reports on the development and biophysical characterization of a small...
Article
Full-text available
Background: The JAK2 V617F variant is diagnostic for myeloproliferative neoplasms, a group of clonal disorders of hematopoietic stem and progenitor cells. Although several approaches have been developed to detect the variant, a gold standard diagnostic method has not yet been defined. We describe a simple, fast, and cost-effective PCR-based approa...
Article
The oncogene KRAS is involved in the pathogenesis of many tumors such as pancreatic, lung and colorectal cancers, thereby representing a relevant target for the treatment of these diseases. The KRAS P1 promoter contains a nuclease hypersensitive, guanine-rich sequence able to fold into a G-quadruplex motif (G4). The stabilization of this G4 structu...
Article
G-quadruplexes (G4s) are noncanonical nucleic acid structures involved in the regulation of several biological processes of many organisms. The rational design of G4-targeting molecules developed as potential anticancer and antiviral therapeutics is a complex problem intrinsically due to the structural polymorphism of these peculiar DNA structures....
Article
Background: The G-quadruplex-forming sequence within the KRAS proto-oncogene P1 promoter is a promising target for anticancer therapy. Porphyrin derivatives are among the most rewarding G-quadruplex binders. They can also behave as photosensitizers. Methods: Three water-soluble, positively charged porphyrin-like compounds were synthesized and te...
Article
Full-text available
The G-quadruplex-forming telomeric sequence (TTAGGG)4TT was investigated by polarized Ultraviolet Resonance Raman Scattering (UVRR) at 266 nm. The presence of 40% poly(ethylene glycol) and the so-called “self-crowding” condition were used to induce the hybrid-to-parallel topology transition. Analysis of frequency shifts with temperature showed the...
Conference Paper
Full-text available
The non-canonical G-quadruplex (G4) DNA secondary structures characterize for stacking G-quartets stabilized by Hoogsteen hydrogen bonds and monovalent cations. G4s are alluring potential pharmacological targets found in key genome units, including oncogene promoters and telomeres [1- 3]. Indeed, G4s stabilization through interaction with small mol...
Article
DNA G-triplex structures are interesting intermediates in the folding process of G-quadruplexes. That means G-triplexes might represent convenient pharmacological targets for gene expression modulation. However, the literature comes with little knowledge concerning the effects of epigenetic or other chemical modifications on their physical–chemical...
Article
Full-text available
Harmine belongs to a group of β-carboline alkaloids endowed with antitumor properties. Harmine and its derivatives are thought to bind to DNA and interfere with topoisomerase activities. We investigated the base-dependent binding of harmine, and three of its synthetic anticancer-active derivatives to the genomic DNA from calf thymus and two synthet...
Article
Targeted therapies represent a challenge in modern medicine. In this contest, we propose a rapid and reliable methodology based on Isothermal Titration Calorimetry (ITC) coupled with confluent cell layers cultured around biocompatible templating microparticles to quantify the number of overexpressing receptors on cell membrane and study the energet...
Article
In the last decade, there has been a growing interest on chitosan-based nanomaterials. Chitosan is a polymer exceptionally versatile, biodegradable, biocompatible and with good capacity of mucoadhesivity and permeation-enhancing effect. These features make chitosan a perfect material for the fabrication of polymeric nanoparticles for a variety of a...
Article
Full-text available
In the last decade, DNA duplex and G-quadruplex motifs have been investigated for their potential applications in nanotechnology. Recently, G-quadruplex-duplex hybrids, generated from the juxtaposition of these two structural elements, have been considered as DNA nanostructures for nanotechnological applications to take advantage of both duplex and...
Article
Full-text available
As part of the genome, human telomeric regions can be damaged by chemically reactive molecules responsible for oxidative DNA damages. Considering that G-quadruplex structures have been proven to occur in human telomere regions, several researches have been devoted to investigate the effect of oxidation products on the properties of these structures...
Article
The stabilization of oil in water nano-emulsions by means of a polymer coating is extremely important; it prolongs the shelf life of the product and makes it suitable for a variety of applications ranging from nutraceutics to cosmetics and pharmaceutics. To date, an effective methodology to assess the best formulations in terms of thermodynamic sta...
Article
A simple, cheap and highly reproducible affinity chromatography-based method has been developed for the screening of G-quadruplex binders. The tested compounds were flowed through a polystyrene resin functionalized with an oligonucleotide able to form, in proper conditions, a G-quadruplex structure. Upon cation-induced control of the folding/unfold...
Article
Full-text available
Dominant diseases are single gene disorders occurring in the heterozygous state. The mutated allele exerts a dominant effect because it produces an abnormal polypeptide that interferes with the function of the normal allele product. Peptide Nucleic Acids (PNAs) offer a route for a potential therapy for dominant diseases by selectively silencing the...
Article
A novel fluorescent thrombin binding aptamer (TBA), conjugated with the environment-sensitive dansyl probe at the 3'-end and a beta-cyclodextrin residue at the 5'-end, has been efficiently synthesized exploiting Cu(I)-catalyzed azide-alkyne cycloaddition procedures. Its conformation and stability in solution have been studied by an integrated appro...
Article
Full-text available
G-quadruplex unfolding within a sequence of two quadruplex units was characterized by gel electrophoresis, calorimetry and spectroscopy. The obtained results suggest that the kinetics and thermodynamics of the individual quadruplex unfolding are affected by its interaction with other DNA secondary structural elements.
Article
Full-text available
G-quadruplex ligands are potential anticancer agents as telomerase inhibitors and potential transcriptional regulators of oncogenes. The search for best-in-class drugs is addressed to identify small molecules able to promote and stabilize G-quadruplex structures. What features should the G-quadruplex ligands possess? They should have selective anti...
Article
Background The abasic sites represent one of the most frequent lesions of DNA and most of the events able to generate such modifications involve guanine bases. G-rich sequences are able to form quadruplex structures that have been proved to be involved in several important biological processes.Methods In this paper, we report investigations, based...
Article
Full-text available
Prion protein (PrP) is involved in lethal neurodegenerative diseases, and many issues remain unclear about its physio-pathological role. Quadruplex-forming nucleic acids (NAs) have been found to specifically bind to both PrP cellular and pathological isoforms. To clarify the relevance of these interactions, thermodynamic, kinetic and structural stu...
Article
Targeting of DNA secondary structures, such as G-quadruplexes, is now considered an appealing opportunity for drug intervention in anticancer therapy. So far, efforts made in the discovery of chemotypes able to target G-quadruplexes mainly succeeded in the identification of a number of polyaromatic compounds featuring end-stacking binding propertie...
Article
Full-text available
Nowadays, the molecular basis of interaction between low molecular weight compounds and biological macromolecules is the subject of numerous investigations aimed at the rational design of molecules with specific therapeutic applications. In the last decades, it has been demonstrated that DNA quadruplexes play a critical role in several biological p...
Article
G-quadruplex structures are an attractive target for the development of anticancer drugs, as their formation in human telomere induces a DNA damage response followed by apoptosis in cancer cells. However, the development of new anticancer drugs by means of structural-based drug design is hampered by a lack of accurate information on the exact G-qua...
Article
Background: The abasic sites represent one of the most frequent lesions of DNA and most of the events able to generate such modifications involve guanine bases. G-rich sequences are able to form quadruplex structures that have been proved to be involved in several important biological processes. Methods: In this paper, we report investigations, bas...
Article
Molar enthalpies of solution in water, ΔsolHm, of thiourea, methylthiourea, ethylthiourea, dimethyl-1,3-thiourea, diethyl-1,3-thiourea, and tetramethyl-1,1,3,3-thiourea were measured at T = (296.84, 302.45, and 306.89) K by isothermal calorimetry. Experimental results were used to derive molar enthalpies of solvation at infinite dilution (i.d.), Δs...
Article
5168 Background Myeloproliferative neoplasms (MPNs) are a group of diseases characterized by clonal expansion of single or multiple lineages of myeloid subset (i.e. granulocytic, erythroid, megakaryocytic and mast cell). Since 2008, the WHO included the detection of JAK2 mutations (the common V617F and the less common exon 12 mutations), into the...
Article
G-quadruplex formation in the sequences 5'-(TTAGGG)(n) and 5'(TTAGGG)(n)TT (n = 4, 8, 12) was studied using circular dichroism, sedimentation velocity, differential scanning calorimetry, and molecular dynamics simulations. Sequences containing 8 and 12 repeats formed higher-order structures with two and three contiguous quadruplexes, respectively....
Article
A series of trisubstituted naphthalimides have been synthesized and evaluated as telomeric G-quadruplex ligands by biophysical methods. Affinity for telomeric G-quadruplex AGGG(TTAGGG)(3) binding was first screened by fluorescence titrations. Subsequently, the interaction of the telomeric G-quadruplex with compounds showing the best affinity has be...
Article
Full-text available
Aptamers are structured oligonucleotides that recognize molecular targets and can function as direct protein inhibitors. The best-known example is the thrombin-binding aptamer, TBA, a single-stranded 15-mer DNA that inhibits the activity of thrombin, the key enzyme of coagulation cascade. TBA folds as a G-quadruplex structure, as proved by its NMR...
Article
The present study has employed a combination of spectroscopic, calorimetric and computational methods to explore the binding of the three side-chained triazatruxene derivative, termed azatrux, to a human telomeric G-quadruplex sequence, under conditions of molecular crowding. The binding of azatrux to the tetramolecular parallel [d(TGGGGT)](4) quad...
Article
Full-text available
Human telomeric G-quadruplex structures are known to be promising targets for an anticancer therapy. In the past decade, several research groups have been focused on the design of new ligands trying to optimize the interactions between these small molecules and the G-quadruplex motif. In most of these studies, the target structures were the single...
Article
The cKit87up sequence d((5')AGGGAGGGCGCTGGGAGGAGGG(3')) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a...
Article
Bovine seminal ribonuclease (BS-RNase), a homodimeric protein displaying selective cytotoxicity towards tumor cells, is isolated as a mixture of two isoforms, a dimeric form in which the chains swap their N-termini, and an unswapped dimer. In the cytosolic reducing environment, the dimeric form in which the chains swap their N-termini is converted...
Article
Recently, extracellular RNases of the RNase A superfamily, with the characteristic CKxxNTF sequence signature, have been identified in fish. This has led to the recognition that these RNases are present in the whole vertebrate subphylum. In fact, they comprise the only enzyme family unique to vertebrates. Four RNases from zebrafish (Danio rerio) ha...
Article
Full-text available
Guanine-rich nucleic acid sequences can adopt G-quadruplex structures stabilized by layers of four Hoogsteen-paired guanine residues. Quadruplex-prone sequences are found in many regions of human genome and in the telomeres of all eukaryotic organisms. Since small molecules that target G-quadruplexes have been found to be effective telomerase inhib...
Article
The study of DNA G-quadruplex stabilizers has enjoyed a great momentum in the late years due to their application as anticancer agents. The recognition of the grooves of these structural motifs is expected to result in a higher degree of selectivity over other DNA structures. Therefore, to achieve an enhanced knowledge on the structural and conform...
Article
Full-text available
Abasic sites represent the most frequent lesion in DNA. Since several events generating abasic sites concern guanines, this damage is particularly important in quadruplex forming G-rich sequences, many of which are believed to be involved in several biological roles. However, the effects of abasic sites in sequences forming quadruplexes have been p...
Article
The nature of the binding mode and stoichiometry of the TMPyP4 cationic porphyrin to G-quadruplex structures continues to be controversial, with no consensus model to date, especially for intramolecular G-quadruplexes from human telomeric sequences. Those sequences possess intricate polymorphism in solution that appears to be reduced under molecula...
Article
The sensitive to lysis D (SlyD) protein from Escherichia coli is related to the FK506-binding protein family, and it harbours both peptidyl-prolyl cis-trans isomerase (PPIase) and chaperone-like activity, preventing aggregation and promoting the correct folding of other proteins. Whereas a functional role of SlyD as a protein-folding catalyst in vi...
Article
Full-text available
G-quadruplexes are higher-order nucleic acids structures formed by G-rich sequences that are stabilized by tetrads of hydrogen-bonded guanine bases. Recently, there has been growing interest in the study of G-quadruplexes because of their possible involvement in many biological processes. Isothermal titration calorimetry (ITC) has been proven to be...
Article
Molecular dynamics simulations have been used to study the differences between two DNA and RNA 14-mer quadruplexes of analogous sequences. Their structures present a completely different fold: DNA forms a bimolecular quadruplex containing antiparallel strands and diagonal loops; RNA forms an intrastrand parallel quadruplex containing a G-tetrad and...
Article
Overexpression of the ErbB2 receptor is associated with the progression of breast cancer, and is a sign of a poor prognosis. Herceptin, a humanized antibody directed to the ErbB2 receptor, has been proven to be effective in the immunotherapy of breast cancer. However, it can result in cardiotoxicity, and a large fraction of breast cancer patients a...
Article
The use of small molecules that bind and stabilize G-quadruplex structures is emerging as a promising way to inhibit telomerase activity in tumor cells. In this paper, isothermal titration calorimetry (ITC) and 1H NMR studies have been conducted to examine the binding of distamycin A and its two carbamoyl derivatives (compounds 1 and 2) to the targ...