Abdelaziz Tlili

• Ph. D.
• Professor (Associate) at University of Sharjah

Congenital sideroblastic anemia (CSA) is a rare genetic disorder caused by defects on heme biosynthesis and mitochondrial energy production. This disease is characterized by the presence of ring sideroblasts in the bone marrow caused by excessive iron accumulation in mitochondria of erythroblasts and by anemia of varying severity. In addition to it...

Background/Objectives: Hearing loss (HL) is a significant global health concern, affecting approximately 1 in every 1000 newborns, with over half of these cases attributed to genetic factors. This study focuses on identifying the genetic basis of autosomal recessive non-syndromic hearing loss (ARNSHL) in a consanguineous Emirati family. Methods: Cl...

Focal segmental glomerulosclerosis (FSGS) is a major cause of nephrotic syndrome and often leads to progressive kidney failure. Its varying clinical presentation suggests potential genetic diversity, requiring further molecular investigation. This study aims to elucidate some of the genetic and molecular mechanisms underlying FSGS. The study focuse...

Congenital Anomalies of the Kidney and Urinary Tract (CAKUT) refer to a range of conditions that affect the kidney and urinary tract. These anomalies can be severe, such as kidney agenesis, or milder, such as vesicoureteral reflux. CAKUT affects over 1% of live births and accounts for 40–50% of cases of chronic kidney failure in children. The patho...

Background Hereditary hearing loss is a rare hereditary condition that has a significant presence in consanguineous populations. Despite its prevalence, hearing loss is marked by substantial genetic diversity, which poses challenges for diagnosis and screening, particularly in cases with no clear family history or when the impact of the genetic var...

Hearing impairment, a rare inherited condition, is notably prevalent in populations with high rates of consanguinity. The most common form observed globally is autosomal recessive non-syndromic hearing loss. Despite its prevalence, this genetic disorder is characterized by a substantial genetic diversity, making diagnosis and screening challenging....

Surface-enhanced Raman scattering (SERS) is a promising emerging, highly sensitive technique for detecting biological samples. The current research aims to bring an effortless biosensor-based approach to detect and discriminate DNA mutations with their fingerprints for each deafness mutation within the GJB2 (gap junction beta 2) gene. Therefore, we...

Short-chain enoyl-CoA hydratase deficiency (ECHS1D) is a rare congenital metabolic disorder that follows an autosomal recessive inheritance pattern. It is caused by mutations in the ECHS1 gene, which encodes a mitochondrial enzyme involved in the second step of mitochondrial β-oxidation of fatty acids. The main characteristics of the disease are se...

Intellectual disabilities (ID) and autism spectrum disorders (ASD) are characterized by extreme genetic and phenotypic heterogeneity. However, understanding this heterogeneity is difficult due to the intricate interplay among multiple interconnected genes, epigenetic factors, oxidative stress, and environmental factors. Employing next-generation se...

Background Hearing loss is a rare hereditary deficit that is rather common among consanguineous populations. Autosomal recessive non-syndromic hearing loss is the predominant form of hearing loss worldwide. Although prevalent, hearing loss is extremely heterogeneous and poses a pitfall in terms of diagnosis and screening. Using next-generation sequ...

Pathogenic germline variants in the PIGT gene are associated with the “multiple congenital anomalies–hypotonia-seizures syndrome 3” (MCAHS3) phenotype. So far, fifty patients have been reported, most of whom suffer from intractable epilepsy. Recently, a comprehensive analysis of a cohort of 26 patients with PIGT variants has broadened the phenotypi...

Hearing loss (HL) is the most prevalent sensory disorder whose etiology comes from environmental and/or genetic factors. Approximately 60% of HL cases are due to mutations in genes responsible for maintaining a normal hearing function. Despite the monogenic inheritance of hereditary hearing loss (HHL), its diagnosis is challenging as both clinical...

Recently exploring bioanalytical instrumentation principles emphasized with combination of optics and EM fields in surface enhanced Raman spectroscopy (SERS). The principles favour the rapid detection of DNA with proper fabrication of SERS sensor. 1D semiconductor nanostructures (SiNWs) functionalization with plasmonic silver nanoparticles are fabr...

Progressive encephalopathy with brain edema and/or leukoencephalopathy, PEBEL1, is a severe neurometabolic disorder characterized by rapidly progressive neurologic deterioration associated with a febrile illness. PEBEL1 is a lethal encephalopathy caused by NAXE gene mutations. Here we report a 6-month-old boy with mitochondrial encephalomyopathy fr...

Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE; OMIM 603041) is a rare inherited metabolic disorder mostly caused by mutations in TYMP gene encoding thymidine phosphorylase (TP) protein that affects the mitochondrial nucleotide metabolism. TP, functionally active as a homodimer, is involved in the salvage pathway of pyrimidine nucleos...

The past 30 years have seen an exponential growth concerning the identification of genes and variants responsible for hereditary hearing loss (HL) worldwide. This has led to a huge gain in our understanding of molecular mechanisms of hearing and deafness, which improved diagnosis for populations with hereditary HL. Many communities around the world...

Background The brain endothelial barrier permeability is governed by tight and adherens junction protein complexes that restrict paracellular permeability at the blood-brain barrier (BBB). Dysfunction of the inter-endothelial junctions has been implicated in neurological disorders such as multiple sclerosis, stroke and Alzheimer’s disease. The mole...

Background Most breast cancer-related deaths result from metastasis. Understanding the molecular basis of metastasis is needed for the development of effective targeted and preventive strategies. Matrix metalloproteinase-1 (MMP1) plays an important role in brain metastasis (BM) of triple-negative breast cancer (TNBC) by promoting extravasation of c...

Intellectual disability (ID) often co-occurs with other neurologic phenotypes making molecular diagnosis more challenging particularly in consanguineous populations with the co-segregation of more than one ID-related gene in some cases. In this study, we investigated the phenotype of three patients from a large Tunisian family with significant ID p...

In this work, development of fast, selective and highly sensitive sensor for detecting severe acute respiratory syndrome coronavirus 2 (known as SARS CoV-2 or COVID19) spike protein has been reported. Surface enhanced Raman spectroscopy (SERS) based direct detection of spike protein was investigated by fabricating silver nanoparticles decorated Si...

Hereditary hearing impairment (HI) is a common disease with the highest incidence among sensory defects. Several genes have been identified to affect stereocilia structure causing HI, including the unconventional myosin3A. Interestingly, we noticed that variants in MYO3A gene have been previously found to cause variable HI onset and severity. Using...

PurposeExtravasation of triple-negative (TN) metastatic breast cancer (BC) cells through the brain endothelium (BE) is a critical step in brain metastasis (BM). During extravasation, metastatic cells induce alteration in the inter-endothelial junctions and transmigrate through the endothelial barrier. Transmigration of metastatic cells is mediated...

The development of next generation sequencing techniques has facilitated the detection of mutations at an unprecedented rate. These efficient tools have been particularly beneficial for extremely heterogeneous disorders such as autosomal recessive non-syndromic hearing loss, the most common form of genetic deafness. GJB2 mutations are the most comm...

In this work we present a fast and label-free technique for biomolecules detection. The approach has been proved to be powerful to investigate small DNA mutation. Surface enhanced Raman spectroscopy (SERS) is an out of standing technique for DNA analyses by providing a specific fingerprint of chemical structure with a high sensitivity in a very sho...

Introduction Hearing impairment (HI) is characterized by complex genetic heterogeneity. The evolution of next generation sequencing, including targeted enrichment panels, has revolutionized HI diagnosis. Objectives In this study, we investigated genetic causes in 22 individuals with non-GJB2 HI. Methods We customized a HaloplexHS kit to include 3...

Background The development of next generation sequencing-based techniques showed an important progress in the identification of pathogenic variants related to monogenetic diseases with genetic and phenotypic heterogeneities. Hereditary hearing loss is considered as one of these heterogeneous diseases, given the large number of deafness causing gene...

Introduction Hearing loss (HL) is a common sensory disorder over the world, and it has been estimated that genetic etiology is involved in more than 50% of the cases in developed countries. Both nuclear and mitochondrial genes were reported as responsible for hereditary HL. Mitochondrial mutations leading to HL have so far been reported in the MT-R...

Brain metastases represent one of the incurable end stages in breast cancer (BC). Developing effective or preventive treatments is hampered by a lack of knowledge on the molecular mechanisms driving brain metastasis. Transmigration of BC cells through the brain endothelium is a key event in the pathogenesis of brain metastasis. In this study, we id...

Non-syndromic hearing loss (NSHL) is a hereditary disorder that affects many populations. Many genes are involved in NSHL and the mutational load of these genes often differs among ethnic groups. Claudin-14 (CLDN14), a tight junction protein, is known to be associated with NSHL in many populations. In this study, we aimed to identify the responsibl...

Palmoplantar keratoderma (PPK) is a heterogenous group of skin disorders characterized by a persistent thickening of the palms of the hands and sometimes soles of the feet. PPK can be classified into many types, including diffuse, transgradient, and focal or striate, where the areas of palmoplantar skin are alternatively thickened. Mutations in fou...

Aims: Autosomal recessive nonsyndromic hearing loss (ARNSHL) is the most common form of hereditary deafness. Despite its frequency, the diagnosis of this disorder continues to be a challenging task given its extreme genetic heterogeneity. The purpose of this study was to identify the causative mutation in a consanguineous United Arab Emirates (UAE...

The Cell Division-Cycle-14 gene encodes a dual-specificity phosphatase necessary in yeast for exit from mitosis. Numerous disparate roles of vertebrate CDC14A have been proposed largely based on studies of cultured cancer cells in vitro. The in vivo functions of vertebrate CDC14A are largely unknown. We generated and analyzed mutations of zebrafish...

The Cell Division-Cycle-14 gene (cdc14) encodes a dual-specificity phosphatase that is necessary in yeast for exit from mitosis. But the roles of mammalian CDC14A gene remain unresolved. We used genetic and mechanistic studies of human CDC14A and its mouse and zebrafish orthologues to clarify its functions in the auditory and reproductive systems i...

Aim: Mutations in the gap junction protein beta 2 (GJB2) gene are responsible for more cases of nonsyndromic recessive hearing loss than any other gene. The purpose of our study was to evaluate the prevalence of GJB2 mutations among affected individuals from United Arab Emirates (UAE). Methods: There were 50 individuals diagnosed with hereditary...

Autosomal recessive non-syndromic hearing loss is one of the most common monogenic diseases. It is characterized by high allelic and locus heterogeneities that make a precise diagnosis difficult. In this study, whole-exome sequencing was performed for an affected patient allowing us to identify a new frameshift mutation (c.804delG) in the Immunoglo...

Clinical assessment of affected individuals. (DOCX)

Sequencing library construction, exome capture, sequencing, and standard data analyses for the affected children in this family was performed bySengenics. Exome capturing and enrichment was carried out using SureSelect All ExonV5kit (Agilent Technologies, Santa Clara, CA, USA) following the manufacturers' protocols. Whole exome sequencing was carri...

In order to determine the consequence of ILDR1 reported mutations on splicing and translation initiation, we used Human Splicing Finder (version 3.0) (http://www.umd.be/HSF3/) and ORF finder (http://www.geneinfinity.org/sms/sms_orffinder.html) respectively.

The novel c.804delG mutation, occurring in the seventh exon of the ILDR1 gene, abolishes a FauI restriction site. The FauI restriction pattern of the exon7 fragment (1003 bp) was used to screen 50 deaf individuals and 120 unrelated healthy UAE individuals. Digestion of PCR products was performed according to manufacturer’s instructions (New England...

Sanger sequencing was performed on available samples from all affected family members to determine whether the potential mutation in the causative gene co-segregated with the disease phenotype. In order to amplify exon 7 of the ILDR1 gene, we designed the following primers: ILDR1-7F: TTGATGTCCTGATTCTGAGG and ILDR1-7R: CTCTGTGGTGGAATGAGAGG. The ampl...

Mitochondrial disease refers to a heterogeneous group of disorders resulting in defective cellular energy production due to dysfunction of the mitochondrial respiratory chain, which is responsible for the generation of most cellular energy. Because cardiac muscles are one of the high energy demanding tissues, mitochondrial cardiomyopathies is one o...

Mitochondrial diseases are a clinically heterogeneous group of disorders that arise as a result of dysfunction of the mitochondrial respiratory chain. They can be caused by mutations in both nuclear and mitochondrial DNA. In fact, mitochondrial DNA (mtDNA) defects are known to be associated with a large spectrum of human diseases and patients might...

Cellular functions related to the maintenance of homoeostasis are regulated by shear forces sensed by endothelial cells. The endothelial cells sense local changes in shear stress. The resulting signals are either transduced into chemical responses or transmitted to the surroundings to regulate the cellular activity [1-5]. In the current literature,...

Pathogenic mitochondrial DNA (mtDNA) mutations leading to mitochondrial dysfunction can cause cardiomyopathy and heart failure. These mutations were described in the mt-tRNA genes and in the mitochondrial protein-coding genes. The aim of this study was to identify the genetic defect in two patients belonging to two families with cardiac dysfunction...

Background and aims Pyridoxine -dependent epilepsy (PDE) is a rare autosomal recessive disease that manifests at birth by subintrant seizures and requires lifelong treatment with vitamin B6. Mutations in the gene encoding ALDH7A1 have been reported in most patients. Our goal was to seek a possible mutation in infants suspected of PDE monitored in t...

L-2-hydroxyglutaric aciduria (L2HGA) is an autosomal recessive neurometabolic disorder characterized essentially by the presence of elevated levels of L-2-hydroxyglutaric acid (LGA) in plasma, cerebrospinal fluid and urine. L2HGA is caused by a deficiency in the L2-Hydroxyglutaric dehydrogenase (L2HGDH) enzyme involved in the oxidation of LGA to th...

Pelizaeus Merzbacher disease and Pelizaeus Merzbacher like disease (PMLD) are hypomyelinating leucodystrophies of Central Nervous System (CNS) with a very similar phenotype. PMD is an X-linked recessive condition caused by mutations, deletions duplication or triplication of the proteolipid protein 1 gene (PLP1). However, PMLD is a recessive autosom...

Pyridoxine-dependent Epilepsy (PDE) is a rare autosomal recessive disorder causing intractable seizures in neonates and infants. It is characterized by seizures that are resistant to common anticonvulsants, but patients respond well to the administration of pyridoxine. PDE is caused by ALDH7A1 genetic defect. Here, we report the disease-causative v...

We previously mapped the DFNB66 locus to an interval overlapping the DFNB67 region. Mutations in the LHFPL5 gene were identified as a cause of DFNB67 hearing loss (HL). However, screening of the coding exons of LHFPL5 did not reveal any mutation in the DFNB66 family. The objective of this study was to check whether DFNB66 and DFNB67 are distinctive...

Sensorineural hearing loss has been described in association with different mitochondrial multisystemic syndromes, often characterized by an important neuromuscular involvement. Until now, mutations in mitochondrial DNA, especially in the 12S rRNA, the tRNASer(UCN) and the tRNALeu(UUR) genes, were implicated in syndromic or non-syndromic hearing lo...

Founder mutations, particularly 35delG in the GJB2 gene, have to a large extent contributed to the high frequency of autosomal recessive nonsyndromic hearing loss (ARNSHL). Mutations in transmembrane channel-like gene 1 (TMC1) cause ARNSHL. The p.R34X mutation is the most frequent known mutation in the TMC1 gene. To study the origin of this mutatio...

In this study, we detected new sequence variations in LAMA2 and SGCG genes in 5 ethnic populations, and analysed their effect on enhancer composition and mRNA structure. PCR amplification and DNA sequencing were performed and followed by bioinformatics analyses using ESEfinder as well as MFOLD software. We found 3 novel sequence variations in the L...

Biallelic mutations in the GJB2, GJB3, GJB6 and CLDN14 genes have been implicated in autosomal recessive non-syndromic hearing impairment (ARNSHI). Moreover, a large number of GJB2 heterozygous patients was reported. The phenotype was in partly justified by the occurrence of two deletions including GJB6. We analysed GJB2, GJB6, GJB3 and CLDN14 in 1...

Many proteins necessary for sound transduction have been identified through positional cloning of genes that cause deafness. We report here that mutations of LRTOMT are associated with profound nonsyndromic hearing loss at the DFNB63 locus on human chromosome 11q13.3-q13.4. LRTOMT has two alternative reading frames and encodes two different protein...

The 12S rRNA gene was shown to be a hot spot for aminoglycoside-induced and non-syndromic hearing loss since several deafness-associated mtDNA mutations were identified in this gene. Among them, we distinguished the A1555G, the C1494T and the T1095C mutations and C-insertion or deletion at position 961. One hundred Tunisian patients with non-syndro...

Hereditary nonsyndromic hearing impairment (HI) is extremely heterogeneous. Mutations of the transmembrane channel-like gene 1 (TMC1) have been shown to cause autosomal dominant and recessive forms of nonsyndromic HI linked to the loci DFNA36 and DFNB7/B11, respectively. TMC1 is 1 member of a family of 8 genes encoding transmembrane proteins. In th...

Mutations in the connexin 26 gene (GJB2), which encodes a gap-junction protein expressed in the inner ear, have been shown to be responsible for a major part of autosomal recessive non-syndromic hearing loss in Caucasians. The aim of our study was to determine the prevalence and spectrum of GJB2 mutations, including the (GJB6-D13S1830) deletion, in...

The mitochondrial tRNA(Leu(UUR)) gene (MTTL) is a hot spot for pathogenic mutations that are associated with mitochondrial diseases with various clinical features. Among these mutations, the A3243G mutation was associated with various types of mitochondrial multisystem disorders, such as MIDD, MELAS, MERRF, PEO, hypertrophic cardiomyopathy, and a s...

Hereditary hearing impairment is the most genetically heterogeneous trait known in humans. So far, 50 published autosomal recessive non-syndromic hearing impairment (ARNSHI) loci have been mapped, and 23 ARNSHI genes have been identified. Here, we report the mapping of a novel ARNSHI locus, DFNB63, to chromosome 11q13.3-q13.4 in a large consanguine...

We explored the mitochondrial 12S rRNA and the tRNASer(UCN) genes in 100 Tunisian families affected with NSHL and in 100 control individuals. We identified the mitochondrial A1555G mutation in one out of these 100 families and not in the 100 control individuals. Members of this family harbouring the A1555G mutation showed phenotypic heterogeneity w...

Approximately 80% of hereditary hearing loss is non-syndromic. Non-syndromic deafness is the most genetically heterogeneous trait. The most common and severe form of hereditary hearing impairment is autosomal recessive non-syndromic hearing loss (ARNSHL), accounting for approximately 80% of cases of genetic deafness. To date, 22 genes implicated in...

Hereditary non-syndromic deafness is extremely heterogeneous. Autosomal recessive forms account for approximately 80% of genetic cases. Autosomal recessive non-syndromic sensorineural deafness segregating in a large consanguineous Tunisian family was mapped to chromosome 6p21.2-22.3. A maximum lod score of 5.36 at theta=0 was obtained for the polym...

The locus for a type of an autosomal recessive non-syndromic deafness (ARND), DFNB13, was previously mapped to a 17-cm interval of chromosome 7q34-36. We identified two consanguineous Tunisian families with severe to profound ARND. Linkage analyses with microsatellites surrounding the previously identified loci detected linkage with markers corresp...

Approximately 80% of the hereditary hearing loss is nonsyndromic. Isolated deafness is the most genetically heterogeneous trait. We have ascertained 10 individuals from a large consanguineous Tunisian family with congenital profound autosomal recessive deafness. All affected individuals are otherwise healthy. Genotype analysis excluded linkage to k...