Discussion
Started 10th Apr, 2020
  • Former PostDoc at Baylor College of Medicine & New York Medical College

Third Sequence: COVID-19: AATGGTACTAAGAGG = HIV-1 isolate 19663.24H9 from Netherlands envelope glycoprotein (env) gene, sequence ID: GU455503.1

Update with the Engineered sequence by the Chinese Wuhan Lab (the strongest Ha). within Spike: In positions 21,840 to 21,855 (for the Spike protein, producing the amino acids in frame: NGTKR) of the COVID-19 sequence MN908947, we find this 15-bases match to the env of the HIV-1, however, when you put it straight into the BLAST comparison, this match does not appear but other five are present, even "predicted" ones, here the rest is illustrated, one is a bacteria, three are fish (two predicted), and the last predicted one belongs to an aquatic mammal, respectively: Acidianus sulfidivorans JP7 chromosome: CP029288.2; Coregonus sp. 'balchen' genome assembly, chromosome 25: LR778277.1; PREDICTED: Phocoena sinus vestigial like family member 3 (VGLL3), transcript variant X7, mRNA: XM_032629715.1; PREDICTED: Etheostoma spectabile septin-2-like (LOC116689752), mRNA: XM_032516370.1; PREDICTED: Petromyzon marinus homeobox protein SIX4-like (LOC116939530), mRNA: XM_032948043.1. The HIV, env gene was found with extra less matching nucleotides by Jean-Claude Perez (in his paper "Wuhan COVID-19 Synthetic Origins and Evolution"), together with other five Immunodeficiency portions with less full matches than this one and with less matching nucleotides in the same and nearby region of 275 bases.
Here, with all the significant Engineered sequences (according to Luc Montagnier, nobel price of discovering the HIV virus, and Jean-Claude Perez) within Spike, by the Wuhan Lab.:
ACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATAATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTTGAAATCCTTCACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATTGTTAGATTTCCTAATATTACAAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGA
Next, in a continuum from the previous "paragraph", is the short sequence of the Pangolin sites: L – F – QS – N – Y (from: Virome of dead pangolin individuals Metagenome), underlined by its groups of three manufacturing nucleotides, within Spike:
TTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTAC
And the sequence continues here until reaching the point of the 12-bases insert to camouflage the COVID-19 virus:
CAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAATTTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCAGGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGCTGAACATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTCCTCGGCGGGCACGT
Here, what we see is the portion in black at the end of the inserted GC 80% rich
segment for the PRRAR furin cleavage and O-glycosylation, at the beginning the Immunodeficiency fragments found by Jean-Claude Perez, at the center, the RBD inserts that match the virus from Pangolin that are strong to be attached to the human and to the cat ACE2, and as super-scripts the segments that provided the 3-D modeled structures also from the HIV that were discovered by the indian team that was forced to retract their paper. But what is significant is that it all falls within this continuous region of the most important segments of the Spike protein, crucial for the penetration into the cells of the human lungs.
References:
https://web.archive.org/web/20200323091807/https://jvi.asm.org/content/82/4/1899
Additional observations related to COVID-19 can be found at:

Most recent answer

10th Jun, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
While desiring to have a more narrow set of cutting enzymes only for the 12-base sequence CCTCGGCGGGCA responsible for the Furin/Plasmin Cleavage Site PRRA, I found the next FOUR ones: http://nc2.neb.com/NEBcutter2/cutshow.php?name=9a3a52e2-Games-Over-Billy; now: How can we indict the felons?, as my friend who did the amazing documentary "Trace Amounts" declares... I have been telling that to Bill Gates from the very beginning of the "Pandemic" through Instagram and he NEVER responded, so I deleted him from my list of friends. I also wrote earlier to my former PI and to my former Advisor at the BCM, TMC...
Then, I also added the Non-Commercially available enzymes to see a total of 14 very rare ones that cut that essential short 12-bases stretch!!!, adding to the previous four ones above, we have the next ones too: R1aI (cutting in two different sites), PsuGI, Rba2021V, PsuGI, Awo1030IV, Fco169iv, Cco14983VI, PsuGI, CjeFV, AbaUMB2I: http://nc2.neb.com/NEBcutter2/cutshow.php?name=9a3a52e2-Game_Over_Billy_v.2
1 Recommendation

All replies (146)

10th Apr, 2020
Rasha Shakir Nima
University Of Kufa
1 Recommendation
10th Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Interesting global similitudes with that of cat that has been linked above this message. COVID-19 uses felines as hosts. This other one emphasizes the significance of any related sequence to other harmful viruses: Here I link the significant portion of that article here related, prompting the most comparisons as it is humanely possible to tackle its defeat: "2019-nCoV acquired a cleavage site for furin enzyme in its S protein, which is not present in the S
proteins of most other Betacoronavirus (e.g. SARS coronavirus). This cleavage site may increase the efficiency of virus infection into cells, making 2019-nCoV has significantly stronger transmissibility than SARS coronavirus. The infection mechanism of 2019-nCoV may be changed to being more similar to those of MHV, HIV, Ebola virus (EBoV) and some avian influenza virus". Currently, doing the comparison side by side with that of Pangolin: Query: MN908947, Subject: MT084071, preliminary similarity of the full comparison of both as full sequences: "Query Cover": 79.73%, and within that, "Per. Ident": 91.64%.
13th Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Update of the 13th of April, 2020, at my 9:15 AM: A further interesting aspect of this 15-bases similar sequence of HIV-1 into COVID-19 is that when checking the matches of that sequence in BLAST, the 100% of the first 100 is a no-match for any other virus, except, of course, one for the HIV-1 itself:
HIV-1 isolate 100711m.4.4 from USA envelope glycoprotein (env) gene, complete cds; and vpu protein (vpu), rev protein (rev), and tat protein (tat) genes, partial cds,
MH012801.1, but also for other organisms that are NOT viruses, but mostly plants, such as legumes and arabidopsis, but also a Bos, an Eagle and a Trout, and lots of "Predicted" sequences that I tried to remove in order to clean-up as possible only the real sequences, but I was not allowed under the current software of BLAST:
14th Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Then, when I do a BLAST containing the sequences proper of Immunodeficiency viruses (HIV and SIV), 161 bases within a stretch of 276-bases discovered by Jean-Claude Perez, the only match is ONE, other than the thousands of COVID-19s, that one of the: " Bat coronavirus RaTG13, complete genome": MN996532:
ACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATT, then the lower stretch of 27 bases matches, apart of that BaT, the virus of Pangolin, and multiple sequences that are not viral, while the first stretch of 20 bases matches Norovirus and Sapovirus as the viral ones, no coronaviruses but rather calciviridae, but only the short penultimate sequence of 26 bases matches another SARS-like coronavirus and other Bat SARS-like coronaviruses, as if those were composite inserts into the virus of a bat. Does anyone smells here like "a RaT"????
20th Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Still expanding it as I read...: "...ADE, to enter human cells: This is when the virus is able to hijack white blood cells to more easily enter into the rest of our body's cells, allowing it to seep deep into its hosts' nervous systems, creating permanent neurological damage in the hosts it doesn't kill outright. ADE could also explain why between 5% and 10% of once "recovered" patients in Wuhan have been showing up with fresh infections, since that phenomenon allows a virus to hijack the antibodies created by a previous infection to re-attack an old host: (from: http://www.softpanorama.org/Skeptics/Political_skeptic/Propaganda/Fear_as_propaganda_tool/Covid19/bioweapon_angle.shtml, my other excerpts from it at my first link). And curiously Zhengli Shi, of UNC and Wuhan fame, co-authored a 2019 paper which used inert viral shells to figure out exactly how SARS, with its affinity to the ACE2 receptor just like COVID-19, was able to harness ADE to hijack white blood cells for enhanced cell entry. A gain-of-function extension of this research would be exactly the kind of experiment that could've given birth to COVID-19, especially considering that 2019 paper managed to fine-tune the exact concentration of antibodies that would best facilitate ADE." https://jvi.asm.org/content/94/5/e02015-19 : "...or pseudovirus packaging, HEK293T cells were cotransfected with a plasmid carrying an Env-defective, luciferase-expressing HIV type 1 genome (pNL4–3.luc.R-E-) and a plasmid encoding MERS-CoV or SARS-CoV spike" [Such as those traces, are of Env HIV-1, here reported]. "...the antibodies first bind to the virus and then bind to the IgG Fc receptors on immune cells and mediate viral entry into these cells. A similar mechanism has been observed for HIV and Ebola viruses..." From "softpanorama": " Both HIV and Dengue Fever use antibody-dependent enhancement to boost their virulence, however its generally a phenomenon that takes a long time to occur when it happens in nature. However, COVID-19 looks like it may have had its ADE jacked into HYPER-DRIVE as it was passed between a series of animal hosts, since it has the aforementioned much stronger ability to bind to host cells and creates viral loads orders of magnitude higher, and also appears to immediately to be able to enter its hosts nervous systems, killing many of its victims by attacking the region of the brain that controls breathing , drastically lowering white blood cell counts early on in infections, and apparently re-infecting individuals who had already appeared to clear their infection." Only a Laboratory "gain-of-function" research can explain what COVID-19 is doing: "The neuroinvasive potential of SARS‐CoV2 may play a role in the respiratory failure of COVID‐19 patients": , and pursues: "Nothing about COVID-19's clinical presentation is typical, including the fact that in many patients the first sign of infection seems to be losing your senses of smell and taste without any other symptoms, something no other virus on earth is known to do to otherwise asymptomatic patients – but which could possibly be due to artificially enhanced ADE immediately gaining entry into those nerve cells and frying them. Further increasing the possibility that COVID-19's unique clinical presentation may be due to its ADE being juiced by laboratory engineering...": https://www.usatoday.com/story/news/health/2020/03/24/coronavirus-symptoms-loss-smell-taste/2897385001, (indicative of another possible complication:) "... tricking your nervous system into miscommunicating the concentration of oxygen in the environment, and scrambling the same system that's used when your body is subjected to the lowered oxygen levels that occur at high altitude to possibly trick your body into producing fewer red blood cells": https://www.medscape.com/viewarticle/928156, where symptoms were as if: "This is more like a high-altitude sickness" (it might destroy hemoglobin in blood cells like malaria parasite!!! I remember an article about the Orf8 talking about that)... "... an unnaturally juiced-up ability to use ADE would also explain what other front-line medical workers are observing in their patients... (a) sudden precipitous decline is exactly what would be expected if COVID-19's ability to use ADE had been accentuated in the lab.": https://www.propublica.org/article/a-medical-worker-describes--terrifying-lung-failure-from-covid19-even-in-his-young-patients, from there: "...this is not the flu. Watching this relatively young guy, gasping for air, pink frothy secretions coming out of his tube and out of his mouth. The ventilator should have been doing the work of breathing but he was still gasping for air, moving his mouth, moving his body, struggling. We had to restrain him. With all the coronavirus patients, we've had to restrain them. They really hyperventilate, really struggle to breathe. When you're in that mindstate of struggling to breathe and delirious with fever, you don't know when someone is trying to help you, so you'll try to rip the breathing tube out because you feel it is choking you, but you are drowning", "...all of a sudden, they go into complete respiratory arrest, shut down and can't breathe at all... typical of someone who has a near drowning experience -- they have a bunch of dirty water in their lungs -- or people who inhale caustic gas..." "I've never seen a microorganism or an infectious process cause such acute damage to the lungs so rapidly. That was what really shocked me"!!! (Then, at this point, I started crying, sorry...)
20th Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
From the same article as before: "... some 21 million cell phone users have somehow fallen of the map in China (https://www.ibtimes.sg/china-hiding-covid-19-death-toll-21-million-cell-phones-disappeared-why-41580), as well as the long lines witnessed to collect loved ones' ashes in Wuhan, which alone is reported to have had some 45,000 cremations (until that point of the report: http://www.asianews.it/news-en/Wuhan,-endless-queues-for-ashes-of-coronavirus-dead-cast-doubts-on-numbers-49673.html). So this high lethality may be due in part to the multiple variants that had time to circulate in Wuhan, a hallmark of ADE since each subsequent variant is able to escape detection by our immune systems while still hijacking our white blood cells to increase its virulence (the way ADE works: )".
21st Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
And there the considerations continue in a keen and deep tone: "... neither ADE nor the possibility that COVID-19 could be a product of dual-use gain-of-function serial animal passage has been mentioned on television...", "...by a virus that's not behaving like anything natural, like anything they've ever seen". Why it is anti-natural the COVID-19, do we need more evidence? Well, there is!: "Even more indicative of an unnatural origin is the fact that the process of a virus transferring from one species to another, called a "zoonotic jump", follows a well-established pattern in the literature: For a virus to fully jump into a new species , several MONTHS if not YEARS are required for the process to complete (https://harvardtothebighouse.com/2020/01/31/logistical-and-technical-analysis-of-the-origins-of-the-wuhan-coronavirus-2019-ncov): 1) First, a variant of the virus infects one new host, an infection that will fizzle out the first time it happens since there's no way for a virus to be immediately adapted to a novel host species. 2) But with continued exposure, more individual infections occur, some of which produce slightly mutated VARIANTS more adapted to the biology of the new host species, 3) until eventually a variant wins the selective virulent lottery and is able to spread easily among its new host population, killing and reproducing as it goes. And yet research published in 2018: , found that only two-point-seven percent (2.7%) of villagers living about a kilometer (1 Km) from local bat-caves carried any evidence of past bat coronavirus infections. That study happened to examine people living in WUHAN as well, and found absolutely zero (0.0%) evidence of previous bat coronavirus infection at all there, making it all-but-IMPOSSIBLE that zoonotic jumping occurred since earlier less-lethal variants of the virus would have left a wide SIGNATURE in its new host population (humans!!!). Instead, COVID-19 emerged "OUT OF NOWHERE", or more likely just out of a LOCAL LAB., and was IMMEDIATELY extraordinarily WELL-ADAPTED to humans – spreading through the air with ease, killing as it went. Plus there's the fact that ALL the initial victims were infected with the SAME VARIANT, if a natural zoonotic jump had occurred, MULTIPLE different variants would inevitably have been found at the START of an outbreak... EVERYTHING about the way COVID-19 interacts with its human hosts and spreads among them indicates that it's been artificially trained to be familiar with human biology – bizarrely blocking our senses of smell and taste before doing anything else, spreading readily among asymptomatic patients and then infecting and killing us with far more EFFICIENTLY than any natural emergent virus at the start of its outbreak, and first EMERGING without taking any of the steps necessary to naturally perform a zoonotic jump into humans"!!! (My emphasis, praying to open the eyes of the blinded).
21st Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Furthermore, it says: "Given that this outbreak was said to begin in late December when most bat species in the region are hibernating (https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)30251-8/fulltext) and the Chinese horseshoe bat’s habitat covers an enormous swath of the region containing scores of cities and hundreds of millions people (https://en.wikipedia.org/wiki/Big-eared_horseshoe_bat#/media/File:Big-eared_Horseshoe_Bat_area.png, the long red area), the fact that this Wuhan Strain of coronavirus, denoted as COVID-19, emerged in close proximity to the only BSL-4 virology lab in China, which in turn was staffed with at least two Chinese scientists – Zhengli Shi and Xing-Yi Ge – both virologists who had previously worked at an American lab (Univ. of North Carolina, with Baric, see their 2015 Nature Medicine article and their supplemental information, where the death of the elderly mice was of a 100%: https://www.nature.com/articles/nm.3985, and the two from Wuhan were the ones that provided a lethal, modified to kill Spike gene, already in their arsenal since at least 2015) which had already bio-engineered an incredibly virulent strain of bat coronavirus – the accidental release of a bio-engineered virus from Wuhan’s virology lab cannot be automatically discounted, especially when the Wuhan Strain’s unnatural genomic signals are considered (1) the Furin cleavage site still unaccounted for, its 12-bases rich in GC, 80%, making them an outlier for the rest of that genome, bases that are principally a match with bacteria, and that another great and bold researcher here, Tom Wenseleers found out that if you "restrict the taxa to viruses only then aside from SARS-CoV2", you only get three other viruses: Mycobacterium phage Settecandela, Parapoxvirus of cows and sheep and the Atypical porcine pestivirus and 2) The RBD that is a match for the six key codons of a virus from pangolin, and the least similar (44.44%), together with the previous one (20%), region of the whole COVID-19 virus when compared with the RaTG13, already modified genome of a virus from a bat, held since 2013 and not released by Wuhan until this year of 2020: https://www.researchgate.net/post/COVID-19_CCTCGGCGGGCACGT_PRRAR_AA_Furin_cleavage_site_at_23603-23617_of_the_MN908947_Genbank_Genome_Matches_Mostly_Bacteria_COVID-19_in_BLAST, my other posting of eight on significant segments of the COVID-19 engineered criminal genome)."
21st Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
When I went to the conference by Luc Montagnier (he may remember), the saloon of the hotel was full to the maximum capacity with people standing, and my only concern, my only question was: "How to identify the minimum functional epitopes of the HIV...?" His answer at that point was that nobody knew yet (but we all know now (well, the ones willing to see, not those willingly and deliberately (many times due to their pockets) blinded by the "Darwinian" fairytale with which any biological crime can be disguised under the clothes of a non existent "random" evolution), but now we know, I was saying that Shi Zheng-Li knew that answer after tons of trials and errors, answer that she will use and disguise in her molecularly engineered constructs; the organizer of the event: https://www.linkedin.com/in/alan-barrell-0a54805; the hidden hands behind the release of COVID-19: https://web.archive.org/web/20200213221007/https://www.jewishpress.com/news/us-news/harvard-yale-investigated-for-taking-unreported-billions-from-chinese-saudis-iranians/2020/02/13).
22nd Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Further evidence that even the sequence, as we suspected, called RaTG13 (MN996532), the only closest match to the COVID-19 (MN908947), even that RaT infiltrated in the Genbank, it seems that has already been modified in the Wuhan laboratory (and that is the importance of doing an independent capture of organism, isolation of nucleic acids, and sequencing to validate the RaT that Shi submitted), as a close modified ancestor of COVID-19, including; 1) Those ten Immunodeficiency fragments and constructs at the beginning of it, but not yet: 2) the RBD (that are closest to a virus from pangolins), and not yet: 3) the Furin cleavage site (with no match but with bacteria, and thanks to a researcher, Tom Wenseleers, also to other three viruses: A Phage, a porcine Pestivirus, and a cow Parapoxvirus, see my first sequence: https://www.researchgate.net/post/COVID-19_CCTCGGCGGGCACGT_PRRAR_AA_Furin_cleavage_site_at_23603-23617_of_the_MN908947_Genbank_Genome_Matches_Mostly_Bacteria_COVID-19_in_BLAST ); so, we have this portion, the most evidently Engineered by humans portion of COVID-19 (Sars-CoV-2, submitted on 05-JAN-2020 by hero Zhang, Y.-Z, but not by criminal Shi, she sent and smelled such as the RaT sequence, below):
ACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATAATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTTGAAATCCTTCACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATTGTTAGATTTCCTAATATTACAAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAATTTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCAGGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGCTGAACATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTCCTCGGCGGGCACGT
And, when we compare the next analogous section below of that stinky RaT with the full current database of BLAST: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Nucleotides (I show here that the only vaguely matching sequences are with other kinds of bats (the matches that are here below in italics); while the first portion of RaT has no match in the Genbank, other than with COVID-19 itself, and is the section with the additions of diverse functional epitopes of immunodeficiency viruses, as predicted by Montagnier and as found under his advice by Jean-Claude Perez, so those HIV insertions had already been done in the RaT genome, as it has no match with other viruses from other bats, then the section in bold that has no match either with the viruses of other bats, is the place of the RBD, and of course, the ending section, has no match between COVID-19 and the RaT (so, how great the idiocy of Andersen and all of his collaborators, and of all of those that praised that bogus paper of "The Proximal Origin of Sars-CoV-2", including Francis Collins, for taking as the final truth this only one RaT genome, that thus far, "in the midst" of the killings that COVID-19 is doing worldwide (April the 21st of 2020), is all that criminal Shi Zhengli from Wuhan 2020 worst fame, and from Baric 2015 very bad fame, has been able "to produce", and she just sent it under the pressure of COVID-19 having already been sent; God, take care please of the family of the bold researcher disappeared by the CCP, the one that published the sequence above!!!), as it seems to be one of the most recent laboratory inserts into the Sars-CoV-2 that causes COVID-19):
A RaT from the Wuhan Lab (sequence hidden since 2013 and not released until recently 2020: 27-JAN-2020, submitted by the "Bat Woman" killer Shi Zheng Li, and presumably as we say, already modified in the portion of immunodeficiency):
ATTTGTTTTTACCTTTCTTCTCCAATGTGACCTGGTTCCATGCTATACATGTTTCAGGGACCAATGGTATTAAAAGGTTTGATAACCCAGTTCTGCCATTCAACGATGGCGTCTATTTTGCTTCCACTGAGAAGTCTAATATAATAAGAGGATGGATTTTTGGTACTACCTTAGATTCGAAGACCCAGTCTCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTACTCTAGTGCGAATAATTGCACTTTTGAGTATGTCTCTCAGCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTCGTGTTTAAGAATATTGATGGTTATTTCAAAATATATTCTAAACATACGCCTATTAATTTAGTGCGTGATCTTCCCCCTGGTTTTTCAGCTTTAGAACCATTGGTAGATCTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGCTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCAAGGACTTTTCTACTAAAATATAATGAGAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTTTCAGAAACAAAGTGTACGTTAAAATCCTTCACTGTTGAAAAAGGAATTTATCAAACCTCTAACTTTAGAGTCCAACCAACAGATTCTATTGTTAGATTCCCAAATATTACAAACTTATGTCCTTTTGGTGAAGTTTTTAACGCCACCACATTCGCATCAGTTTATGCTTGGAACAGAAAGAGAATTAGCAACTGTGTTGCTGATTACTCTGTCCTATATAATTCCACTTCATTTTCTACCTTTAAATGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTTTATGCAGACTCATTTGTGATTACAGGTGATGAAGTCAGACAAATTGCGCCAGGACAAACTGGAAAGATTGCTGACTACAATTATAAACTACCAGATGATTTTACTGGTTGTGTTATAGCTTGGAATTCTAAGCATATTGATGCAAAAGAGGGCGGTAATTTTAACTATCTTTACCGTCTCTTTAGAAAAGCTAATCTTAAACCCTTTGAGAGGGATATCTCAACTGAAATTTACCAAGCAGGCAGCAAACCTTGTAATGGTCAAACTGGTCTAAATTGCTACTACCCACTTTATAGATATGGATTTTACCCTACTGATGGTGTTGGTCACCAACCTTATAGGGTAGTAGTACTTTCTTTTGAACTTCTAAATGCACCAGCAACTGTTTGTGGACCTAAGAAGTCTACTAACTTGGTTAAAAATAAATGTGTCAATTTCAACTTTAATGGTTTAACTGGCACAGGTGTCCTCACAGAGTCTAATAAAAAGTTTCTACCTTTCCAACAATTTGGTAGAGACATTGCAGACACTACTGATGCCGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCTGGAACAAATGCCTCTAACCAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATCCATGCAGACCAACTTACTCCCACTTGGCGTGTTTACTCCACAGGTTCTAATGTTTTTCAAACACGTGCAGGTTGTTTAATAGGGGCTGAACATGTCAATAACTCGTATGAGTGTGACATACCTATTGGTGCAGGAATATGCGCCAGTTATCAGACTCAAACTAATTCACGTAGTGTGGCCA.
The set of matching results when both of the sequences are compared in BLAST, attached in TXT format for you to repeat the exercise, here we can discover more details about the criminality of Shi and the extensive cover-up of the CCP: https://www.youtube.com/watch?v=KhYpt69XTWE; the image shows that the comparison of most of the virus from bats starts in the second half of the sequence).
Then, when I do a comparison of only the first portion, the one that did not provide matches in the previous comparison, the most closest matches of that portion, even if loosely, are again with viruses from the pangolin!, while some shorter sequences, also loosely show up from bats (indicated in pale italics in the sequence immediately above, but again, most of the most significant HIV epitopes are left intact, with still no match in the current Genbank sequences; the first viral pangolin match is also uploaded as an image below; the one with no name earlier and big, is the one with the virus from bat).
22nd Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
When somebody just gives you the amino acids and not the nucleotides form which those amino acids are coming, that is a sloopy and incomplete research and that is not right, not especially when dealing with COVID-19; so, we dig as with a microscope, because our telescopic view of the previous study is missing in detail into those nuances of when we have identical amino acids but with a trinucleotide difference in the original sequences!!!, focused first in bats (maybe later in pangolins), what we obtain is this: So we have our first: AATGGTACTAAGAGG: NGTKR (MN908947, as featured at the top), but it is not the only one, and that is the troubling situation that we are facing right now, as we are finding a lot of polymorphic COVID-19s depending on the different nations, expressing basically every imaginable variant (but it may be a Genbank mistake, as seen in one case before that I ask you to verify)... The closest one, as we already said, is the BaTG13: AATGGTATTAAAAGG: NGIKR (MN996532, a change very disturbing is that Genbank again seems to be giving you false positives in relation to the human COVID-19 viruses such as those found in the US: WA, i.e. QIQ49922 giving NGIKR, but when you seek in its nucleotides, all seem to give NGTKR), so, here we have two changes, one in a third base that did not affect the outcome, as in both cases it results in a "K": AAG in Sars-CoV-2 from the human COVID-19 vs AAA in the virus of that supposed "bat"; then, we have a change in a second base!!! From ACT in Sars-CoV-2 from COVID-19 giving us a "T", to an ATT in the virus of that RaT to give an "I", the difference is obvious, in the attempt at changing the RaT there was a mistake because being "I" hydrophobic, it will tend to hide inside the protein that portion instead of having it exposed in the outside, what is achieved by "T", which being phosphorilatable to increase is functional activity, is exposed on the outer surface!!! And remember, this is the supposed, thus far, closest ancestor to COVID-19 according to its manufacturer Shi Zhengli. And what are the odds of a natural change in the second position in a short term? Knowing that it is the central, the core of the codon: "The second-codon position is the most functionally constrained", the hardest to change naturally, way far more than the third position, which is the easiest, or than the first position, which is the next easiest. Then we have the very similar bat sequences MG772933 and MG772934 providing an AATKR from the sequence of the nucleotides: GCTGCCACAAAGAGG, here the change on the first and second position to the two first codons, giving in both cases a, "A" (and again, those have the two changes at the center of the codon, the hardest position to change), and on the third position for the third codon that does not make a change in the result of the amino acid "T", those two sequences from 2018 have already the TKR but with two AA before, that are both too small and hydrophobic, tend to bend inside that "T", bringing it out the "N" from the final versions. People in a lab in China studying the fusion to the human lung cells containing the ACE2 of all of these coronaviruses and more, will realize that the best cell fusing sequence is the one including NGTKR (not quite present in RaT or in its companions), but present in COVID-19 and just as in the HIV-1!!! As I say, when the attempt is to disguise a synthetic virus to make it look as "natural", the detective eye is the only eye able to distinguish what is genuine from what is a falsified version of "nature", and I want you all to have the detective eye and not the superficial one in cases as serious as this one!!!
23rd Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Found the images of a preliminary research that is still standing even if "withdrawn", I have written the next to its authors, any other extra comment that you wish to do for them, you can send them also a message (as soon as I have a response by them, I will post it here):
"Dear B. Kundu and V. Perumal,
I was impressed to read your candid research ("Uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1 gp120 and Gag": https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1) where you found those four sequences similar to HIV-1 within the Sars-CoV-2 virus of COVID-19.
All the criticism raised against your work really seems to be completely theoretical, sloppy and weak, I think that the way to proof your concept, I think it will be to compare the same Sars-CoV-2 with and without those segments in human cell cultures such as the ones that Baric used before of his fateful and pervert "Nature" experiment of 2015 in the company of Shi Zhengli.
I have been also, even lost my work, but my moral deed was to demonstrate experimentally what I had found. And what I found were artificial constructs by the thousands in the Genbank, and when I denounced, from all the countries, a Chinese team that had been promoting this kind of lies. In my final version I realized that the were getting NIH grants during ten years to promote a blatant lie, this is the discrete, and I hope elegant way I demonstrated their misdoings: Escaping the Cut by Restriction Enzymes Through Single-Strand Self-Annealing of Host-Edited 12-bp and Longer Synthetic Palindromes:
Please, let us know that you are pursuing your work, certainly people like the Nobel Prize Luc Montagnier, and his acquaintance Jean-Claude Perez, will be deeply thankful with you as well as the rest of humanity. Thank you very much for having the didactic decency and education to share the nucleotides as well as the resulting amino acids, the comparative image between the Sars and this atypic kind of "Sars", and the 3-D image, very illustrative. Your "critics" lack on that.
With my best regards,
Fernando Castro-Chavez, PhD.
Molecular Biology in Medicine.
Formerly at BCM and NYMC."
And as a general recommendation, I suggest you to use your own saliva rubbed inside your nostrils when you are with patients in your medical routines, as it is proven that its powerful enzymes can trap and destroy "big" mortal enemies of men, and will also do with this COVID-19: https://pubmed.ncbi.nlm.nih.gov/9989543 (As I say, take it or leave it, but I am doing it and I am great!!! Ah, and of course keep your mouth shut while walking around patients as much as possible (to prevent the entry of any virus). Whatever free or cheap means to counter this engineered COVID-19 will be deeply appreciated by your own organism, even rubbing a little Vick inside your nostrils as well to increase the probability to trap any kind of airborne virus (anything preventative, and anything alternative not to release the big bucks to tbe big pharma, you all know that vaccines against RNA viruses are futile, as the viruses are changing at a high rate, the vaccine made today will be totally useless for the virus of tomorrow). Thank you!!!).
Tomorrow, God willing, I will tackle the published article written to discredit the withdrawn paper under consideration in this opportunity. I just want to advance that it is a deceptive work, sloppy as they do not provide the corresponding nucleotides of the other comparative sequences that they present, as Kundu and Perumal have rightfully done, and it just shows a bad blood to stonewall a paper that has not even been peer-reviewed in a proper way (but that just shows a political innuendo on the attempt of trying to silence any dissenting voice of the "official", but by all means false, narrative that this COVID-19 virus is "natural"). Oh well, that will be, as I say, in another day.
24th Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Basically, the COVID-19 in its previous version, before of the insertion, also done in the lab of Zhengli of the Furin Cleavage site: CCTCGGCGGGCACGT = PRRAR, according to one article by Zhengli that was a 2015 reference explaining the contents of the plasmids with the modified genes of the Spike protein, reference removed by Baric in the final version of their pervert 2015 Nature Medicine article, the preprint of Baric:
Removed reference (in the PDF but not in HTM) that links HIV to COVID-19
24. Ren W, et al. Difference in receptor usage between severe acute respiratory syndrome (SARS) coronavirus and SARS-like coronavirus of bat origin. Journal of virology. 2008; 82:1899–1907.10.1128/JVI.01085-07 [PubMed: 18077725]: https://jvi.asm.org/content/82/4/1899
(And, remember that this article of 2008 is before the 2018 submission of two sequences by Chinese virologists already containing supposed traces of HIV-like smaill epitopes presented above: MG772933 and MG772934, and before the 2020 submission of the RaTG13: MN996532).
1) Backbone of a Bat: Rp3-S.
2) Modified codons for the RBD (Receptor Binding Domain) of Spike: BJ01-S.
3) HIV pseudovirus with the modified gene for Spike: CS14-608.
4) Human Cells with ACE2 Receptor: HeLa, and 293T.
The twisted "SHOWS POTENTIAL" final version lacks of this crucial article by Shi Zhengli, manufacturer of the COVID-19 at the Wuhan lab, but the article as appeared at "Nature" ("Antinature" in this case of COVID-19 I may say), lacks of this reference, even when it still credits at the end the Spike protein and the plasmids to the Wuhan of Zhengli: https://www.nature.com/articles/nm.3985
You can further explore, for the impending indictment of Shi Zhengli, the link of her words HIV and SARS within her publications: https://scholar.google.com/scholar?hl=en&as_sdt=0%2C5&q=Zhengli+HIV+SARS&btnG=
24th Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Here, the amazing description of the six important articles deliberately removed by Zhengli and by Baric from their final 2015 Nature Medicine criminal version (and that because of the design of a deadly Sars Coronavirus to kill the elderly mice, exactly as COVID-19 is doing now: https://www.nature.com/articles/nm.3985, as per their supplement Figure 3B: https://static-content.springer.com/esm/art%3A10.1038%2Fnm.3985/MediaObjects/41591_2015_BFnm3985_MOESM18_ESM.pdf): https://www.youtube.com/watch?v=IP7A6M3vPAg , references that where indeed in the original manuscript version: https://web.archive.org/web/20200221233549/https://www.med.unc.edu/orfeome/files/2018/03/a-sars-like-cluster-of-circulating-bat-coronaviruses-shows-potential-for-human-emergence.pdf
25th Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Another image of the same article by Shi Zhengli of 2008: demonstrates that the virion of HIV with the inserted Spike gene with the amino acids modified in the RBD is almost as effective to bind to the human (hu) and to the civet (pc) ACE2 as it did the resulting product of the plasmid of spike with the same amino acid modifications. In such way, they were getting closer to their final design of COVID-19. In their own words: "the pseudovirus packaged with a CS (chimeric Spike) protein, HIV/CS14-608, displayed a level of luciferase activity similar to that of HIV/BJ01-S (Being BJ01-S. also written in the paper as BJ-01-S, and here every detail matters: "a codon-optimized spike (S) protein gene of SARS-CoV BJ01 in pcDNA3.1")."
25th Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Update: Showing that the real deal here is what is not said or emphasized in the paper itself (here in the red rectangle), and this is that the beginning of the real infectivity, which means the proper fusion of the virion to the human cells, is located precisely at the left side of the RBD of the Spike protein (also modified by hand by Shi Zhengli: https://www.researchgate.net/post/Fourth_Sequence_COVID-19_TTG_90_TTT_18_CAATCA_18_AAT_9_TAC_L_F_QS_N_Y_Viral_Pangolin_Insert_with_Receptor_Binding_Domain_RBD_in_a_Virus_of_Bat, and that will take away the "paradox" of the viral pangolin, that at this height of this globalistic "game", seems to be just a distraction), exactly in the position that we have found the HIV-1 (call it if you feel more comfortable: HIV-1-Like, Hehee) epitope traces of the HIV Env protein: NGTKR, and some researchers say that those motifs are even longer, such as Jean-Claude Perez, acquaintance of Luc Montagnier, who told us (Luc) in 1996 that the smallest functional epitopes of the HIV-1 were at that time not yet know, but this article is from the 2008!, and at the right side (in blue, is where the Furin cleavage site, an outlier 80% GC rich of "unknown" procedance in the COVID-19, other than it being really synthetic, which will end with the "fabricated mystery", of which nobody wants to talk about, is located as such: CCTCGGCGGGCACGT = PRRAR: https://www.researchgate.net/post/COVID-19_CCTCGGCGGGCACGT_PRRAR_AA_Furin_cleavage_site_at_23603-23617_of_the_MN908947_Genbank_Genome_Matches_Mostly_Bacteria_COVID-19_in_BLAST). Another image that sows clearly that since 2008 ( https://jvi.asm.org/content/82/4/1899) there was the knowledge to insert a RBD (receptor Binding Domain) including its RBM (receptor Binding Motif) to allow the Spike protein of COVID-19 to tightly bind to the human ACE2, as a matter of fact, as we see in the Spike of COVID-19, in that year Shi Zhengli had already replaced with an optimal RBD from a human Sars virus, in their own words: "Both the BJ01-S and Rp3-S genes were efficiently expressed in transfected 293T cells, and the expressed S proteins were incorporated into the respective pseudoviruses as expected... the pseudovirus packaged with a CS (chimeric S ) protein, HIV/CS14-608, displayed a level of luciferase activity similar to that of HIV/BJ01-S... the coding region from aa 424 to 494 of BJ01-S was used to replace the corresponding regions of Rp3-S, resulting in a chimeric S (CS) gene... BJ01-S: a codon-optimized spike (S) protein gene of SARS-CoV BJ01 in pcDNA3.1... A 193-residue fragment (amino acids [aa] 318 to 510) in the SARS-CoV S protein was demonstrated to be the minimal receptor-binding domain (RBD) which alone was able to efficiently bind to ACE2 (references 1, 42a, 45). Furthermore, it was shown that minor changes in amino acid residues of the receptor-binding motif (RBM) of SARS-CoV S (my note: obviously those changes can improve or made worse the binding ability, not only the last, which was the written option of Shi, just because, as to deceive...)... when the RBD of SL-CoV S was replaced with that from the SARS-CoV... S, the hybrid S protein was able to use the huACE2 for cell entry". So, since 2008 and earlier at Wuhan, Shi Zhengli was tweaking the nucleotides of the key amino acids of the RBD within Spike, and then the best tweaked sequence of the moment, the BJ01-S (also written as BJ-01-S), was the one that was inserted (in every possible length to see which one was the one working the best) INTO the backbone of a bat virus, exactly as we see it in COVID-19. Now the habitual "damage control" deceivers say that "we did not have the knowledge to have done the COVID-19 in a lab" is full and sheer bullshit, an oxen dung courtesy of Osterholm, Daszak, Baric, Zhengli herself, and even, sadly for me, Francis Collins, among many others that do not even care to track the origin because of their particular interests such as the WHO and Bill Gates, who keeps on buying actions within the pharmaceutical companies; so, it seems that his foundation gives some for free, with the tail to expect profit even more than what he gives for free, with his personal, and the personal interests of his handlers... The figure is Figure 7 of the linked article, for you to dig deeper into it and keep on searching to bring the masterminds, or at least their scapegoats, down, so as to stop once and for all this planetary madness under the control of a set of a few perverts from humanity... Ah!, their "monster" includes: TPA, signal peptide from tissue plasminogen activator; TM, transmembrane domain derived from the fusion protein of Sendai virus; bat SL-CoV S (Rp3-S) and (RBD already modified) human SARS-CoV S protein (BJ01-S). The open box indicates the location of the RBM (also already modified by the human hands in the lab, Receptor Binding Motif; remembering that such RBM is not the one that infects but the one that properly attaches the virus to the human receptor ACE2, reason why the infectivity starts only with longer sequences, the ones that allow the fusion of the virus with the cells of the human lungs). And, just to spice this up a little bit: https://www.youtube.com/watch?v=LlplnH3VYyc
26th Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Another image of the same aforementioned article, from 2008, showing that the Green Fluorescent Protein indicated that the Spike protein through their lab modified RBD, had been able to properly attach to the ACE2 receptors engineered into the human HeLa cells. Working tirelessly... during at least all those last between ten and twenty years in every single aspect of it, to produce what we have now: COVID-19, why is it that the ones that released it (even if it was by mistake), and the ones that profit from it the most -are not interested at all in the pursuit of its origin??? That will be the foremost inquire and search to stop the madness of a crazy world completely controlled in which I really do not want to live (I attach here the world after COVID-19 according to a person that is not even a doctor and is already tracing what the future will be after this, a totally controlled planet, do you know that he even brags that he has a Microsoft company in China, and of his 201 event in October of 2019...? What does it says about the full logistics of this "problem", all of that to me smells like a deliberately and manufactured crisis for the control of the populations literally and genocidally, please read critically that document and provide any useful input, as many that I love still think that such guy is still a good guy, he is not a doctor, epidemiologist or a politician that I know of, and he is taking all of the possible roles and more, as a master megalomaniac one).
27th Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
So, Baric removed six key articles about the methodologies (in the print and in the PDF version but not in the online HTM page) used to design his killer virus from his maligned 2015 article of Nature Medicine with the "bat woman", killer of worldwide populations, Shi Zhengli, and inserted two new articles related with vaccination, one of them being a chapter of a textbook (possible at the suggestion of somebody influential at the WHO, as now it is precisely the WHO who presents for free this full chapter, remember that Bill Gates said, after donating like ten million dollars to the WHO that he wanted that to be the decade of vaccination, then the same year that Gates "predicts" a future pandemic is the year when this article of 2015 appears, then Gates sponsors the "Event 201" and the Netflix boring documentary of "Pandemia", just before the onset of "COVID-19", remembering that he has a Microsoft factory in China with more than 6,000 employees, so it will not be strange that "victim zero" is well and kicking under the protective shelter of Bill Gates), so the changed articles of that 2015 disgrace for humanity are as follows:
ADDED:
16. Siegrist, C.-A. in Vaccines 6th edn. (eds. Plotkin, S.A., Orenstein, W.A. & Offit, P.A.) 14–32 (W.B. Saunders, 2013) [It belongs to Chapter 2: Vaccine immunology, written by Claire-Anne Siegrist]: https://www.who.int/immunization/documents/Elsevier_Vaccine_immunology.pdf
17. Deming, D. et al. Vaccine efficacy in senescent mice challenged with recombinant SARS-CoV bearing epidemic and zoonotic spike variants. PLoS Med. 3, e525 (2006): https://pubmed.ncbi.nlm.nih.gov/17194199/
While the next six ones have been removed from the final version:
REMOVED (in PDF all of these, in HTM online, only refs. 22 y 23):
22. Sheahan T, Rockx B, Donaldson E, Corti D, Baric R. Pathways of cross-species transmission of synthetically reconstructed zoonotic severe acute respiratory syndrome coronavirus. Journal of virology. 2008; 82:8721–8732.10.1128/JVI.00818-08 [PubMed: 18579604]: https://jvi.asm.org/content/82/17/8721
23. Qu XX, et al. Identification of two critical amino acid residues of the severe acute respiratory syndrome coronavirus spike protein for its variation in zoonotic tropism transition via a double substitution strategy. The Journal of biological chemistry. 2005; 280:29588–29595.10.1074/jbc.M500662200 [PubMed: 15980414]: https://www.jbc.org/content/280/33/29588.full.pdf
24. Ren W, et al. Difference in receptor usage between severe acute respiratory syndrome (SARS) coronavirus and SARS-like coronavirus of bat origin. Journal of virology. 2008; 82:1899–1907.10.1128/JVI.01085-07 [PubMed: 18077725]: https://jvi.asm.org/content/82/4/1899
25. Sims AC, et al. Release of severe acute respiratory syndrome coronavirus nuclear import block enhances host transcription in human lung cells. Journal of virology. 2013; 87:3885–3902.10.1128/JVI.02520-12 [PubMed: 23365422]: https://jvi.asm.org/content/87/7/3885
26. Fulcher ML, Gabriel S, Burns KA, Yankaskas JR, Randell SH. Well-differentiated human airway epithelial cell cultures. Methods in molecular medicine. 2005; 107:183–206. [PubMed: 15492373]: https://www.med.unc.edu/marsicolunginstitute/files/2017/12/Book-Chapter.pdf
27. Roberts A, et al. A mouse-adapted SARS-coronavirus causes disease and mortality in BALB/c mice. PLoS pathogens. 2007; 3:e5.10.1371/journal.ppat.0030005 [PubMed: 17222058]: https://journals.plos.org/plospathogens/article?id=10.1371/journal.ppat.0030005
The Pathetic Patent of Baric on how to tweak the gene for the Spike protein of Coronavirus: https://patents.google.com/patent/WO2002086068A2
In the image we see that Baric lied to the media in 2020 saying that he had "FOUND" a deadly Coronavirus in 2015, and you can still see as for today that video of the interview of Baric, when he also deceptively hinted, because of all interviewed, he was the one that knew better, saying faking himself some "idiocy", that a flu was worst than the current COVID-19. So, he told the media that he had "FOUND" a deadly Coronavirus in 2015, when we all clearly know that he not did that, but he "DESIGNED" such deadly virus with similar effects than the COVID-19 of today, to the point that the headlines of the scientific journals of those times, were raising very serious ethical concerns, as can be seen in the other attached image, so that S.O.B. of Baric did not "FOUND" but "DESIGNED" a lethal virus in the company of the Wuhan Lab with Shi Zhengli-Li (Zhengli), as they put her there, dobling by mistake the "Li", and some other fella from China as well. I also attach here the clip of Bill Gates, ever present sponsor of this 2020 Pandemic, who, as per the three accounts that establish his guilt also presented here, he holds the Anti-Christic patent 060606 to insert a chip under the skin of humans (I do not care what "snopes" says, as it is just a counterfeit "debunker"): https://patentscope.wipo.int/search/en/detail.jsf?docId=WO2020060606, then as Robert Kennedy Jr., nephew of JFK, demonstrates in his Instagram account, the Bill and Melinda Gates Foundation sponsored a research published in "Science", precisely regarding the implant of a chip inside the skin: https://stm.sciencemag.org/content/11/523/eaay7162?rss=1&fbclid=IwAR2CJ1hlWlM61ZsnXe3glwJynOvqJD9fgf-EX6Q8LDybCoxZ0Czs2L5PVYI, in pursuit of his so loved "Digital Certificate" of vaccination, which video proof I am also annexing here, so as for Science to have the three minimal proofs to demonstrate the criminality of Bill Gates, who is faking that he is an MD, not being himself an MD, pushing down the throats of humanity a completely useless RNA vaccine, as I demonstrate in my postings here, from the fifth to the eight: https://www.researchgate.net/post/Fifth_Sequence_COVID-19_2_variants_ATG-246-TT_CA-111-TAA_TTA_L_L-Type_70_TCA_S_S-Type_30_in_position_28144_of_MN908947_for_ORF8_NifB
27th Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
One of the references removed by Baric (and this one does not appear not in the downloadable PDF, neither in the HTM online, completely gone!) clearly indicates that there was the technology to move by hand nucleotides to replace amino acids since the 2005, without any need of a spurious "Pangolin", so Andersen was playing the "idiot" when he ignored also that the technology to tweak particular nucleotides and amino acids in a laboratory was already there for a long time ago, so the "coverupers" of this COVID-19 having been designed in a Wuhan Laboratory are being very disingenuous about the whole Pandemic of 2020 because basically, they prefer to put some money in their tables to eat the green dollars like calf, in disregard of the millions of humans dying, if we are going to give any credit to the other subordinates of Bill Gates, that are the Johns Hopkins hospitals, also participant with the same software to count the worldwide victims, at "Event 201" of October 2019; so, their inflating the numbers of today, will be their indictment rigour of tomorrow. Here the two images that are crucial from the removed article by Baric:
23. Qu XX, et al. Identification of two critical amino acid residues of the severe acute respiratory syndrome coronavirus spike protein for its variation in zoonotic tropism transition via a double substitution strategy. The Journal of biological chemistry. 2005; 280:29588–29595.10.1074/jbc.M500662200 [PubMed: 15980414]: https://www.jbc.org/content/280/33/29588.full.pdf
These images show the tireless efforts to tweak the amino acids of the RBD (Receptor Binding Domain) of the Spike protein undertaken since 2005 in the laboratories: The positions of the paper 472, 479, 480, 487, correspond to the actual key places in the COVID-19 virus, as per the Andersen charade: 486, 493, 494 and 501, giving the final working version after 15 years of a daily tweaking of nucleotides to reach the best combination (and remember that Chinese work seven days a week): F-QS-N, for that particular region... you read the rest of the nuances and let me now, but this is good enough to give us the idea of the state-of-the-art of the molecular research since 2005 to be able by hand to modify specific amino acids in a discontinuous or discrete way without of the need of inserting codons from the viruses of Pangolins, as Andersen disingenuously wanted us to believe... making harder the puzzle of the engineering of the COVID-19 virus in a Laboratory at Wuhan, harder of what it really was to make it and to release it... but sooner or later these pieces of evidence will be presented in an international court of law to indict at the responsibles behind this deliberate pandemic caused by the release, accidental or on purpose, and one day soon this also will be known, of an artificial virus "DESIGNED" rather than "FOUND" in a Laboratory at Wuhan (with the NIH money of some of the ones that will also need be held accountable at that good day of indicting them all!!!).
27th Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Then, other of the removed articles (removed both in the PDF and in the HTM online) by Baric and Zhengli-Li (as it appears there), from their criminal article in Nature Medicine of 2015, showing a lethal virus killing elderly mice, just as the new COVID-19 designed by them, is doing against humans, but their removal is the next one:
22. Sheahan T, Rockx B, Donaldson E, Corti D, Baric R. Pathways of cross-species transmission of synthetically reconstructed zoonotic severe acute respiratory syndrome coronavirus. Journal of virology. 2008; 82:8721–8732.10.1128/JVI.00818-08 [PubMed: 18579604]: https://jvi.asm.org/content/82/17/8721
That removal is also key, because it shows a little progress from their previous five tweaks that had been done in 2005, in which by tweaking in the laboratory the nucleotides, they finally discovered that F was a better bond than the previous L for one of the key positions of the six amino acids that integrate the final version of COVID-19, an example key figure of this is posted here with the explanation that they wrote for it: "(F) In addition to the N479 mutation, the F442 and F472 mutations further remodel the SZ16 K479N D22 RBD, further enhancing the binding efficiency to hACE2" (That ended up being, as per the reference of Andersen et al, the amino acid F486 for the COVID-19 virus. I just left also (D) for you to realize that before the deliberate tweak in the lab of this amino acid it was an L472 in that position, so obviously, by putting there a longer hydrophobic amino acid as F instead of the other shorter one, L, the binding improved. (At the center is a Spike RBD from the civet, showing its high similarity to the human).
So, little by little, by trial and error, independent of what where the best theoretical models, in the practice they were proofing and trying other amino acids for the rest of the five crucial regions, until they ended up with their final version in COVID-19: L+F+QS+N+Y, corresponding to the relational numerical positions as per the Andersen "Proximal Origin..." reference of: 455+486+493+494+501+505, showing over and over and one more time that all the needed technologies were already there, and the needed time to "work" to tweak manually the six key positions of the Receptor Binding Domain (RBD) to produce in the laboratory of Shi Zhengli-Li at Wuhan (with no need of any virus from Pangolin, but with who little hands of a small woman altering nucleotides to produce different amino acids until the best combination was obtained for the final version for COVID/19): https://www.researchgate.net/post/Fourth_Sequence_COVID-19_TTG_90_TTT_18_CAATCA_18_AAT_9_TAC_L_F_QS_N_Y_Viral_Pangolin_Insert_with_Receptor_Binding_Domain_RBD_in_a_Virus_of_Bat
27th Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Another of the removed articles by Zhengli and Baric (for their print and PDF version but not from the online HTM version page), from their 2015 assasin of elderly mice article appeared ad Nature Medicine under the roar of the research community for the dangers it posed:
25. Sims AC, et al. Release of severe acute respiratory syndrome coronavirus nuclear import block enhances host transcription in human lung cells. Journal of virology. 2013; 87:3885–3902.10.1128/JVI.02520-12 [PubMed: 23365422]: https://jvi.asm.org/content/87/7/3885
This article clearly indicates that they were not only able to modify individual nucleotides at will, to obtain the desired amino acids (as the previous two postings show), but also that they were able to remove genes from complete proteins!
This indicates the modular and antinatural difference in the relative variability of the proteins of COVID-19 when compared with the same proteins of the RaTG13 (an also mildly altered) genome, as it will be briefly seen next.
This indicates that they were able to, just by comparing the behavior of the virus with and without each protein, to determine which were the most aggressive proteins to do their composite construct for COVID-19, going those identities, from 99% for proteins such as: E, Orf10, Nsp9, and the uncoding end; then to 98% for Nsp 7, Nsp8, Nsp10, Nsp12, Nsp13, and the uncoding start, ORF6 (which is the one considered in this space); 97% for N, Orf 7, Orf 8, Nsp14; 96% Nsp1, Nsp3, Nsp4, Nsp5, Nsp6, Nsp15, Nsp16, Orf3, M; 95% Nsp2; 93% Spike (combined, but we need to separate its portions to get a better idea of its inner variability); so the fact of a jump between 99% identity in some proteins, to a drastic reduction of identity to 96%, 95% and even to 93% to the most modified by hand of the proteins, is another telling point that this COVID-19 is a completely synthetic protein made in the Wuhan lab of Zhengli. So, this shows a manipulation of individual proteins as demonstrated in the removed article by Baric.
And, because Spike for COVID-19 is a special case, if we subdivide its different portions we get the different uneven identities within the portion, showing that this gene has been the most manipulated by those little female hands that are killing humans by the millions: 92% for the portion that contains the six HIV/SIV-like portions found by Jean-Claude Perez, 93% for the longer and final part that is after the Furin Cleavage site; but the surprising ones are: 44.44% for the portion of the RBD!!! and only 20% for the portion of the Furin cleavage site!!! Indicating that these two portions have been the most modified by hand within the lab.
But, back to the point that the article under consideration is making, that of the behavior of the virus with or without the Orf6 (a "Signal Blocker", to prevent the infected cell to send out her urgent request of help (her S.O.S.) to the immune system. It also blocks some of the cell’s own virus-fighting proteins, the same ones targeted by other viruses such as polio and influenza!!!").
In the chosen image, the removal of this protein, in this case, the "bitches" doing this pervert and crooked research chose as their "human victims" the Calu3 2B4 cells, who expressed this (using microarrays for a span of 72 hs, red means upregulation while green means downregulation): Upregulation of Gene Expression, of Nucleosome Assembly, of Chromosome Organization, of the GTPase Mediated Signal Transduction, the Regulation of Cell Size and the Negative Regulation of Cell Differentiation, which means that if the human cells lacked the calamity of Orf6, they behaved more normally, Da!!! [But also the sinister meaning of that is that all of those pathways are, sorry: "fucked-up" in the presence of the criminal Orf6].
But basically, Baric removed it because it showed how deeply were these individuals mad at their heads tweaking full proteins in and out of the virus that eventually they constructed as COVID-19, this also shows the complete uselessness of all of this diabolical viral research, because if it were useful at all, the solution will be found right at the start of this COVID-19 pandemia, but the originators of it, and the "sponsors" for their gain of a full control over humanity like Bill Gates, the ones who benefit the most of it, sooner or later will be paying for what they have done!!! Here on earth, or there..., all this viral research, basically has been used for evil and not for good, as the results of the 2020 pandemic planned by Gates demonstrates. Put Bill Gates in jail and do not let him to touch you or your loved ones with his pervert ""Mark of the Beast"" G5 compliant syringe of his supposed "vaccines"!!! Your future and that of your own is on the balance right now!!!
Ah, I just need to add that this particular paper was performed by the greasy hands of Baric and 21 other researchers that right now are very quiet, and with their tails under their hind-legs instead of being themselves doing what I am doing, and demonstrating to the universe that all the tools were already there to manufacture artificially COVID-19, their collective behavior is the same as the one of the full Wuhan lab, they are playing demency and idiocy while their fellow men are dying at their sides. Can any one of those co-authors please stand up and denounce this crime to humanity that escaped from a lab???
Criminals and accomplices with their silence of Baric and Zhengli:
Amy C. Sims, Susan C. Tilton, Vineet D. Menachery, Lisa E. Gralinski, Alexandra Schäfer, Melissa M. Matzke, Bobbie-Jo M. Webb-Robertson, Jean Chang, Maria L. Luna, Casey E. Long, Anil K. Shukla, Armand R. Bankhead III, Susan E. Burkett, Gregory Zornetzer, Chien-Te Kent Tseng, Thomas O. Metz, Raymond Pickles, Shannon McWeeney, Richard D. Smith, Michael G. Katze, Katrina M. Waters, Ralph S. Baric.
And this same exercise of denouncing as accomplices any one that participated in the research conductive to the release of COVID-19 from a lab can be done for each one and for any of the related articles. Especially all that were deliberately removed by the sinister and deceiving hand of Baric (even if the removal was to comply with regulations, as kindly one researcher suggested me, in the end, the most damning papers were the ones removed by Baric).
28th Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
My most recent posting, exposing an ignorant "debunker" (one that poses as MD, epidemiologist, infectologist and "president" in mainstream media, one that developed software and that now wants to stick it into the brains of humans): "The fact is that immunodeficiency-like segments are present exactly in the portion that Zhengli says that are vital for the infectivity, as the IBM retired emeritus Jean-Claude Perez has found, and nobody denies that those segments are there, just at the left side of the RBD of Spike: https://zenodo.org/record/3724003#.Xqg20GhKjIU, and here is the article of 2008 by Zhengli indicative that such portion is well known and necessary for the entrance of the RNA into the cells through the human ACE2: https://jvi.asm.org/content/82/4/1899, Figure 7A, check in the left side. That is well known, such HIV-1 and Sars similarity from time ago: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC222911: "Cloaked similarity between HIV-1 and SARS-CoV suggests an anti-SARS strategy", which means that the naive way in which the debunkers and their magnifiers are behaving, exposes them as ignorant dupes paid by somebody that is neither an epidemiologist but is behaving like one buying mainstream space and "prescribing" a digital certificate for an universal vaccination, to cover-up something that has been published proficiently since the past." So, basically this topic is "a trap" for the paid trolls and LIGHT for the blind. Hehee! Now, something that I did not put there is that a damning evidence of the one behind the Pandemic is his intense interest to vaccinate the whole planet by any means, and that he sponsored an article with his intentions of the injected chip supposedly as a "Digital Certificate of Vaccination", article that appeared in December of 2019, even BEFORE the explosion of the COVID-19 pandemics: "
Biocompatible Near-Infrared Quantum Dots Delivered to the Skin by Microneedle Patches Record Vaccination", and WHEN you check who is financing that research, posing as "Global Good, Intellectual Ventures Laboratory, 14360 SE Eastgate Way, Bellevue, WA 98007, USA.", you find precisely the one that "Engineered" such COVID-19 pandemic: https://www.intellectualventures.com/what-we-do/global-good-fund/our-work, now, the fact that one of the advisors is involved in "facial recognition": Independent consultant, 119 Kendall Rd, Lexington, MA 02421, USA (https://people.csail.mit.edu/drdaniel/), indicates that such "chip" implanted in the skin of humans will have other hidden "functions" as to be G5 compliant. And this, together to the Microsoft patent 060606 aimed at the same microchip implant to use cryptocurrency instead of credit cards: https://patentscope.wipo.int/search/en/detail.jsf?docId=WO2020060606, speaks of a very sinister mind within BIll Gates. Dear humanity, dear Body of Christ on earth, do not let him to get away with this, please. Here attached one of the multiple "pushes" of Gates to impose an universal vaccination on the basis of this Engineered by him pandemics.
28th Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
My last response from outside discussions: "I was thinking (as corrupt, deceivers and told to cover-up the case) about the ones that, holding a high position, get paid with our taxpayers money to do the lying, such as this guy: http://virological.org/t/tackling-rumors-of-a-suspicious-origin-of-ncov2019/384, that without giving a real explanation of the outlier origin 80% GC rich of the unknown segment CCUCGGCGGGCACGU = PRRAR, calculates a possible zoonotic event with a history of up to 80 years, but with zero evidence of this in the province of Wuhan or anywhere else in China: "Serological Evidence of Bat SARS-Related Coronavirus Infection in Humans, China": https://link.springer.com/article/10.1007%2Fs12250-018-0012-7, hence the only way that an already mature killer virus appear on the scene with no track of its record, is by somehow releasing it ready to attack for a laboratory such as that at Wuhan! "
30th Apr, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Luc Montagnier (Nobel Prize of Medicine, 2008 for his discovery of the HIV), has co-authored a related paper as the senior author, with Jean-Claude Perez as the main author: "COVID-19, SARS and Bats Coronaviruses Genomes Unexpected Exogeneous RNA Sequences":
From their main conclusions are:
"...we predict that this 225 bases region will only mutate in order to increase its level of global integration vis-à-vis its genome."
And then, the damning point for the mostly ever lying mainstream CCP, NIH, CDC cover-up of COVID-19 having originated and engineered in a Wuhan laboratory:
"The hyper-selective and discriminating region at the start of the 225 bases region corresponding to the Kenya HIV-1 fingerprint could and should constitute a privileged target for possible tests or even therapies or vaccines."
"A small region of 225 bases distinguishes radically COVID-19 from all SARS genomes, it contains in particular among its 4 EIEs, a fragment coming from a nonfunctional 2008 KENYA HIV-1 genome which we know was used in a vaccine strategy HIV."
And their warning, to those that naïvely thing that the virus is still only "natural":
"We cannot apply the current and proven tools and methods of fighting against viruses, hitherto NATURAL, because we do not know today how a new virus whose part of the genome is SYNTHETIC in nature will evolve and evolve. This was already true for SARS, and even more so for COVID-19."
"Many Exogenous Informative Elements "EIE" HIV / SIV (about 20 EIE) are present in the genome of COVID_19 but also partly in SARS", etc...
Two key images, the first one:
Wuhan: "Figure 6 – High level of HETEROGENEITY within the 225 bases region in Wuhan market ID: LR757998.1 reference genome."
And the second one:
RaTG13: "Figure 7 – High level of COHESION in 225 bases bat RaTG13 region including the fingerprint of Kenya HIV-1 but not the 3 others HIV SIV signatures."
1 Recommendation
1st May, 2020
John Apsley
SaJune Institute of Restorative and Regenerative Medicine
Hello Fernando.
We have studied AgNPs for nearly 20 years now and below 10nm, when the Ag+ levels are sufficient (+10ppm) have yet to see a virus withstand the ROS and denaturation, in the clinical setting. Please feel free to contact me thru www.icrmlearn.org . Keep up your great forensic analysis, you've nailed it.
1 Recommendation
1st May, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
An excellent article, also from Wuhan, indicates a set of 46 substances able to potentially tacke the Furin and other proteases, so as to be able to prevent the viral multiplication (my favorites of that list are shown graphically), put here in the order in which they appear in the article, but it is not the order of efficacy (I think); I add an empty line to differentiate the tables in which those names appear: http://chinaxiv.org/user/download.htm?id=30223
Wu, et al. Furin, a potential therapeutic target for COVID-19.2020.
Aminopterin
Folic acid
Sulfoxone
Silybin
Diminazene
Fludarabine phosphate
L-Arginine
Hydroxystilbamidine
Methotrexate
L-dopa
Irinotecan
Cefoperazone
Folinic acid
Glycerol 3-phosphate
Valganciclovir
Fosaprepitant
Lomefloxacin
Glutathione
Famotidine
Imatinib
Chenodeoxycholic acid
(-)-Epigallocatechin gallate
Theaflavin 3,3'-di-O-gallate
Biorobin
14-deoxy-11,12-didehydroandrographiside
"(1S,2R,4aS,5R,8aS)-1-formamido-1,4a-dimethyl-6-methylene-5-((E)-2-(2-oxo-2,5-dihydrofuran- 3-yl)ethenyl) decahydronaphthalen-2-yl5-((R)-1,2-dithiolan-3-yl) pentanoate"
2β,30β-dihydroxy-3,4-seco-friedelolactone-27-lactone
Phyllaemblicin G7
Andrographolide
14-deoxy-11,12-didehydroandrographolide
"(1S,2R,4aS,5R,8aS)-1-formamido-1,4a-dimethyl-6-methylene-5-((E)-2-(2-oxo-2,5-
dihydrofuran-3-yl)ethenyl) decahydronaphthalen-2-yl2-aminoacetate"
"2-[[2-O-(6-deoxy-α-L-mannopyranosyl)-β-D-xylopyranosyl]oxy]-1,8-dihydroxy-6-methoxy-9H-xanthen-9-one"
Kouitchenside J
Stigmast-5-en-3-ol
Kouitchenside F
Suramin
Indinavir
Boceprevir
Tenofoviralafenamide
TenofovirDisoproxil
Acycloguanosine triphosphate
Telaprevir
Dolutegravir
Maraviroc
Cobicistat
Stavudine triphosphate
Just to be alternate to the absurd and obtuse recommendations of the WHO and of Bill Gates and his evil vaccination project, try it all of it that could be handy (And remember to use your own saliva to rub your inner nostrils as its powerful enzymes are destructive, not only of the HIV, but, I believe also of this COVID-19 virus made into a laboratory, a good nebulized or sprayed to be aspired by your lungs of your own saliva may be able also to take away this pest, I think, at least in its early stages... think about those treatments and alternatives). Comment on the efficacy of these ones or of other easy treatments that you have found to fix this manufactured Pandemic by the "Gates Foundation".
2nd May, 2020
jean-claude Perez
VERY interesting... Fernando!
1 Recommendation
2nd May, 2020
John Apsley
SaJune Institute of Restorative and Regenerative Medicine
Rai M, Kon K, Ingle A, Duran N, Galdiero S, Galdiero M. Broad-spectrum bioactivities of silver nanoparticles: the emerging trends and future prospects. Appl Microbiol Biotechnol. 2014;98(5):1951–1961. doi:10.1007/s00253-013-5473-x
Han J, et al. Efficient and Quick Inactivation of SARS coronavirus and Other Microbes Exposed to the Surface of Slime Metal Catalysts. Biomed Environ Sci. 2005 Jun;18(3):176-80.
Du T, et al. Glutathione-Capped Ag2S Nanoclusters Inhibit Coronavirus Proliferation Through Blockage of Viral RNA Synthesis and Budding. ACS Appl Mater Interfaces. 2018 Feb 7;10(5):4369-4378. doi: 10.1021/acsami.7b13811.
2nd May, 2020
John Apsley
SaJune Institute of Restorative and Regenerative Medicine
In 7 presumptive cases, we have used nebulized Ag+ hydrosol nanoparticles (no capping agents, just H2O and Ag+ <1.0nm at ~25ppm), at very low dose, over 4 days, very effective. Keeping dose under all known toxicity levels published to date.
2nd May, 2020
John Apsley
SaJune Institute of Restorative and Regenerative Medicine
This is an illustrative slide adapted from Rai M, et al.
2nd May, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Then, a very interesting, and ongoing work, such as all that we that want the truth to emerge are doing, is done by a researcher in Austria: , from that excellent compilation of evidence that it all suggests a hand behind the virus of COVID-19 is the next one:
"The RdRp of RaTG13 has 100 % nucleotide identity with the sequence BtCoV/4991 (KP876546) identified by Ge and colleagues (Virol Sin. 2016; 31: 31–40) in a Rhinolophus affinis bat in the Yunnan province in 2013, as RaTG13. Based on the phylogenetic analysis carried out by Ge and colleagues, BtCoV/4991 is a novel beta-CoV, clearly separated from all known alpha- and beta-CoVs at that time. Spike genes were amplified as well, and made available upon request to Ge and colleagues. BtCoV/4991 clearly differentiates from other bat CoVs also in the phylogenetic analysis carried out by Wang and colleagues in 2019 (Viruses 2019; 11: 379). Chen and colleagues (Emerg Microbes Infect. 2020; 9: 313–9) identified BtCoV/4991 as the closest sequence to SARSCoV-2 because RaTG13 had not yet been published at that time. How BtCoV/4991 and RaTG13 relate to each other remains unclear."
Hopefully, somebody that could be reading this did request that Spike gene of BtCoV/4991, before the supposed "sequencing" of that extremely suspicious RaTG13 because of the irregular way in which it was handled, just as everything coming out from that Zhengli lab at Whuan, the feeble safety, the hiding of information during all of those years, from 2013 until 2020, and that just AFTER a sequence of a COVID-19 virus was first published by another Chinese.
So, her compilation of findings is pure gold, both by her comments in here: https://www.nature.com/articles/s41586-020-2012-7, and also here: https://www.virology.ws/2020/02/20/pangolins-and-the-origin-of-sars-cov-2-coronavirus/
Hence, this statement of Shi Zhengli is very disturbing: "“We then found a short RdRp region from a bat coronavirus termed BatCoV RaTG13".
Because, they did not termed it with that name at that time but as "BtCoV/4991", this is a CLEAR evidence that they are HIDING the true origin of this COVID-19, and the fact that "the article of Ge et al. is not part of the bibliography"!!!:
Ge, X., Wang, N., Zhang, W. et al. Coexistence of multiple coronaviruses in several bat colonies in an abandoned mineshaft. Virol. Sin. 31, 31–40 (2016). https://doi.org/10.1007/s12250-016-3713-9
"It is stated that the 370 bp sequence was prolonged of 816 bp and the spike protein was sequenced but this information for this sample has been not made public."
Now they are saying that it is the same as RaTG13 and that such portion is already in it (inside the very odd and NOT YET corroborated independently as real "RaTG13", as I ask over and over: Do you smell a RaT inside the clothing of Zhengli?), as they say:
"We did full-length sequencing to this RNA sample".
So, hopefully somebody could be able to track the Spike that was at that time (like some comparative study on Sipke or something) to see if it matches the submitted as RaTG13 (maybe even in their publications in chinese saved at the archive...).
I am very thankful for the work that Jean-Claude Perez and Luc Montagnier are doing to unravel this deception for the whole of humanity, as well as the medical alternatives that are being suggested, such as that of silver nanoparticles (AgNPs / AgNP+, posted here above by the manufacturers themselves), or the other one that I have found in the Yuri Deigin article above linked, and re-posted in here, that of the MESYLATE: https://www.researchgate.net/post/Fifth_Sequence_COVID-19_2_variants_ATG-246-TT_CA-111-TAA_TTA_L_L-Type_70_TCA_S_S-Type_30_in_position_28144_of_MN908947_for_ORF8_NifB, I mean, every alternative substance other than the ones that are being pushed by the Mainstream Media, as those are only poised to benefit the same ones that Engineered this artificial "Pandemia", and least of them all, do not let yourself to be duped and vaccinated as they have an ulterior motive on doing that as it is very well understood by now from all of you that have your eyes open, that the one behind the current COVID-19 is the same one wanting to implant you with an 060606 patented "Digital Certificate" of "vaccination" (a microchip), Mr. Despicable Him, Bill Gates himself and his handlers...
To illustrate this one, I have the image of how the good ol' silver treatment intercepts viruses: , , and my favorite, due to the high similarity of both viruses...: , as per the responsible submission by John Apsley.
1 Recommendation
3rd May, 2020
John Apsley
SaJune Institute of Restorative and Regenerative Medicine
Here's the mechanisms better illustrated in general.
3rd May, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
DRINK WATER IN SILVER & EAT SHIITAKE, CHAGA AND MAITAKE!!!
The BEST and CHEAPEST, almost FREE strategies to defeat COVID-19 are at your hand!!! (Do NOT believe in the lies of the vaccination and of the Very Co$tly For your health and sinister "Big Pharma"):
Which water to drink is better while the COVID-19 is being released to the environment by Bill Gates???
CLEAN WATER IN CONTACT WITH SILVER!!! (Either the container, the spoon, the clean coin inside the glass or bowl for the drinking water, is made of SILVER).
Thanks to John Apsley for reminding us of a childhood remedy that our grandmothers used to use!!!
1.Speshock JL, Murdock RC, Braydich-Stolle LK, Schrand AM, Hussain SM. Interaction of silver nanoparticles with tacaribe virus. J Nanobiotechnol. 2010;8:19: https://pubmed.ncbi.nlm.nih.gov/20718972
2.Bekele AZ, Gokulan K, Williams KM, Khare S. Dose and Size-Dependent Antiviral Effects of Silver Nanoparticles on Feline Calicivirus, a Human Norovirus Surrogate. Foodborne Pathog Dis. 2016 May; 13(5):239-44:
3.Cascella M, Rajnik M, Cuomo A, et al. Features, Evaluation and Treatment Coronavirus (COVID-19) [Updated 2020 Mar 20]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2020 Jan.: https://www.statpearls.com/kb/viewarticle/52171
4.COVID-19 Symposium: Coronavirus History, Replication, and Immune Evasion. Dr. Susan Weiss. Co-Director, Center for Research on Coronavirus and Other Emerging Pathogens, Penn Medicine, April 3, 2020: https://pubmed.ncbi.nlm.nih.gov/?term=weiss+sr+and+coronavirus
5.Andrade F, et al. Nanotechnology and Pulmonary Delivery to Overcome Resistance in Infectious Diseases. Adv Drug Deliv Rev. 2013 Nov;65(13-14):1816-27. doi:10.1016/j.addr.2013.07.020:
6.Banerjee V, Das KP. Interaction of silver nanoparticles with proteins: a characteristic protein concentration dependent profile of SPR signal. Colloids Surf B Biointerfaces. 2013;111:71–79. https://doi.org/10.1016/j.colsurfb.2013.04.052:
Which supplements to eat, especially while the fearmonger "Gates Foundation" keeps on saying that the worst is still yet to arrive???
EAT ANTIVIRAL STRENGTHENERS OF IMMUNITY MUSHROOMS!!! SHIITAKE, CHAGA, MAITAKE!!!
SHIITAKE:
Antiviral Activity of Virus-Like Particles From Lentinus Edodes (Shiitake).
Consuming Lentinula Edodes (Shiitake) Mushrooms Daily Improves Human Immunity: A Randomized Dietary Intervention in Healthy Young Adults
CHAGA:
Antiviral Activity of Inonotus Obliquus Fungus Extract Towards Infection Caused by Hepatitis C Virus in Cell Cultures
A Study of the Antiherpetic Activity of the Chaga Mushroom (Inonotus Obliquus) Extracts in the Vero Cells Infected With the Herpes Simplex Virus
MAITAKE:
Immune-enhancing effects of Maitake (Grifola frondosa) and Shiitake (Lentinula edodes) extracts
The Pharmacological Potential of Mushrooms
Thanks to Dr. Hiromi Shinya for giving the advice on mushrooms in the last two pages of his classic book (this version in Spanish: "La Enzima Prodigiosa"): https://docs.google.com/viewer?a=v&pid=sites&srcid=ZGVmYXVsdGRvbWFpbnx2aWdpbGFudGVzMjAxMGh1ZWx2YXxneDoyNGQwMTZmMjM3MzBlMjAy
It says:
"HONGOS SHITAKE contienen
aminoácidos específicos que
ayudan a acelerar el procesamiento
del colesterol en el hígado. El
shitake también es un arma
formidable contra el cáncer. Un
compuesto polisacárido del shitake
parece estimular las células del
sistema inmunológico para limpiar
el cuerpo de células cancerígenas y
puede ser efectivo contra el virus
de la inmunodeficiencia humana
(VIH) y la hepatitis B. Los hongos
shitake han demostrado detener el
daño celular del herpes simple I y
II."
"CHAGA es un hongo que es un
antioxidante natural y una de las
plantas medicinales más antiguas.
Se cree que la chaga combate los
virus, estimula el sistema nervioso
central, suprime el crecimiento de
los tumores y las células
cancerígenas, baja el conteo de
glóbulos blancos, baja la presión
arterial y venosa, disminuye los
niveles de azúcar, mejora el color y
la elasticidad de la piel, restaura la
apariencia juvenil y desintoxica el
hígado, los riñones y el bazo."
"MAITAKE es el nombre japonés de
los hongos comestibles. El maitake
se conoce tradicionalmente por sus
propiedades alimenticias y
medicinales. Los extractos de los
h o n g o s maitake favorecen el
sistema inmunológico y se cree que
tienen efectos antitumores."
DOING EVERYTHING AND ANYTHING TO PREVENT AND BE HEALED BY NATURAL MEANS, IN ORDER NOT TO BE VACCINATED BY THE EVIL SINISTER PLANS OF THE GATES FOUNDATION AND THE WHO (ITS SERVANT) AND NOT OT INGEST ANY OF THE PRODUCTS BEING PUSHED BY THE MEDIA AND THE BIG PHARMA!!!
Extra Note: And maybe vaporizations of all of this silver water so as to reach the lungs...
3rd May, 2020
John Apsley
SaJune Institute of Restorative and Regenerative Medicine
Again my thanks to Fernando. His knack for forensic analysis woke me up to encourage us to publish our clinical findings to date using AgNP+ hydrosol, since it looks to us that immunodeficiency may be part of the long term implications of COVID-19.
3rd May, 2020
John Apsley
SaJune Institute of Restorative and Regenerative Medicine
An incomplete list of viruses including SARS-2 effectively treatable with AgNP+ Hydrosol and/or oligodynamic Ag+ nanoparticles according to historical authoritative literature plus current peer-reviewed publications.
4th May, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Thanks to your keen observations, the pieces of the puzzle are being put together, not only by one but by many bold researchers that are not afraid to present the truth, at this point I remember Luc Montagnier, Jean-Claude Perez, Karl Sirotkin, Rossana Segreto, Yuri Deigin, Jay Couey (J. C. on a Bike), and many more.
But also the ones that are with dedication striving to bring light into this darkness, such as Alberto Rubio-Casillas who reminded us of the Laboratory use of:
"...a HIV pseudovirus: " In this study, we successfully constructed a recombinant adenovirus containing the full length codon-optimized S gene of the bat SL-CoV. The recombinant virus, rAd-Rp3-S, elicited strong antibody response in mice against SLCoV S protein, but a low cross reaction with SARS-CoV (BJ01 isolate) S protein and failed to neutralize the HIV/BJ01-S protein": https://link.springer.com/content/pdf/10.1007/s12250-010-3096-2.pdf
And another submitted by him, a clear acceptation that new viruses can be produced in the laboratory: "We produced a pseudovirus bearing the full-length spike (S) protein of MERS-CoV in the Env-defective, luciferase-expressing HIV-1 backbone": https://virologyj.biomedcentral.com/articles/10.1186/1743-422X-10-266,
Also his notation that the funding for the 2015 Gain-of-function assassin virus produced by Zhengli and Baric and published i Nature Medicine, emerged from the place precisely where Anthony Faucy was and still is, directing: "Research in this manuscript was supported by grants from the National Institute of Allergy & Infectious Disease and the National Institute of Aging of the US National Institutes of Health (NIH) under awards U19AI109761 (R.S.B.), U19AI107810 (R.S.B.), AI085524 (W.A.M.), F32AI102561 (V.D.M.) and K99AG049092 (V.D.M.), and by the National Natural Science Foundation of China awards 81290341 (Z.-L.S.) and 31470260 (X.-Y.G.), and by USAID-EPT-PREDICT funding from EcoHealth Alliance (Z.-L.S.)." And reminding him that a year later another secret financier was included for the same project:
"In the version of this article initially published online, the authors omitted to acknowledge a funding source, USAID-EPT-PREDICT funding from EcoHealth Alliance, to Z.-L.S. The error has been corrected for the print, PDF and HTML versions of this article."
Update May 07, 2020: Then, when the owner of EcoHealth Alliance, which is no other else than Peter Daszak says that COVID-19 was a natural outbreak and not an artificial artifact from a Laboratory, and engages another almost thirty of his employees to sign a form saying that the virus for COVID-19 was "natural", that is a big conflict of interest because he is right here sponsoring this research, and he even appears as co-author with Zhangli, it is the same with the NIH says that it was "natural", or when Fauci says the same, they all were also sponsors of this kind of detrimental for humanity research!!!, it is as if Zhangli signs with all her employees a document saying that he virus is "natural", would you believe to any of them???
Somebody requested a FOIA to see why under the times of the moratorium to pursue the GOF research, Baric continued unscathed, during 2015 and 2016, and this was the response (posted by the keen investigative reporter Christine Brim), but posted by Science Magazine itself (pages 64-65 for the Baric case): https://www.sciencemag.org/sites/default/files/documents/43088final.pdf, the linked document within is: http://www.phe.gov/s3/dualuse/Documents/gain-of-function.pdf (Here the letter in full, for you to ponder, and take the corrective measures as to really stop the GOF hell, and to put in jail Anthony Fauci that due to his twisted ambitions the GOF research continued at the lab of Baric and in China, with the money of the US taxpayers!!! due to Fauci. Remember that Fauci is pushing hard in support of the vaccination doctrine (a useless RNA vaccine with an implant chip inside: https://www.youtube.com/watch?v=1LekHJc9Hsc, do not let yourself and your little ones to be vaccinated with that concoction, God designed your body to develop its own antibodies!!!) of Bill Gates and of the slaves of Gates, the WHO, even if he questioned the Hydroxycholorquine, go figure, the way of thinking of a crooked and of a perverted mind!!!)
So, in the russian research about it: https://medium.com/@yurideigin/lab-made-cov2-genealogy-through-the-lens-of-gain-of-function-research-f96dd7413748, we found this about the cynical pursuit of Baric of this criminal and thus far not profitable at all but just the opposite, very harmful:
"Baric-2016
The Baric group does seem to have its share of similar papers. For example, in 2016, they essentially repeated their collaboration with Shi Zhengli from 2015 to create a chimeric virus, only this time they inserted a spike protein segment into their mouse-adapted SARS not from RsSCH014, but from another strain Shi Zhengli found in Yunnan — its close relative Rs3367. Or, to be exact, from WIV1 — the laboratory clone of Rs3367 isolated at the Wuhan Institute of Virology in 2013:
Using the SARS-CoV infectious clone as a template (7), we designed and synthesized a full-length infectious clone of WIV1-CoV consisting of six plasmids that could be enzymatically cut, ligated together, and electroporated into cells to rescue replication competent progeny virions (Fig. S1A). In addition to the full-length clone, we also produced WIV1-CoV chimeric virus that replaced the SARS spike with the WIV1 spike within the mouse-adapted backbone (WIV1-MA15, Fig. S1B). … To confirm growth kinetics and replication, Vero cells were infected with SARS-CoV Urbani, WIV1-MA15, and WIV1-CoV.
To me, the 2016 paper looks a lot like the 2015 one. Moreover, its rationale is not very clear to me: after all, WIV1/Rs3367 already shared 96% of their genome with SARS-CoV. So I am not sure why one would want to insert a spike protein from its closest relative back into SARS-CoV. Maybe just because they could. In this light, the title of the article acquires a certain duality: SARS-like WIV1-CoV poised for human emergence.
Oh, and I am not sure how in 2015 Baric was granted a patent for the creation of “chimeric coronavirus spike proteins”, given all that he and Shi Zhengli previously disclosed in their papers long before 2015": ,
Illustrations from the review by Deigin, and from the original article are presented here. And again, as in the Supplement of 2015, where it is shown that the artificial virus produced by Zhengli and by Baric killed all the elderly mice, here also, more cynically, not in the appendix, but in the main text, they illustrate the complete killing of them all as well!
Finally, also noticed by Alberto, the cynical demeanor of Baric is once more found in the note that he puts here, at the end of his 2015 article:
" Experiments with the full-length and chimeric SHC014 recombinant viruses were initiated and performed before the GOF research funding pause and have since been reviewed and approved for continued study by the NIH".
4th May, 2020
John Apsley
SaJune Institute of Restorative and Regenerative Medicine
The above Baric jpgs are what I was hoping for. And now the Aussies' confess! Plus Pompeo spilled the beans yesterday. Abraham Lincoln idiom - You can fool some of the people some of the time, but....
Healthcare Professionals webinar this Saturday for clinical therapeutics: https://event.webinarjam.com/register/29/lxqnvhyn
4th May, 2020
John Apsley
SaJune Institute of Restorative and Regenerative Medicine
It may become essential to counter immunodeficiency as part of our daily lifestyles.
4th May, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Somebody that seems to be sponsored by the ones that released COVID-19 is asking for censorship on the origins of Sars-CoV-2, this is my response:
"Abigail,
I have reviewed it and as a volunteer peer-reviewer, I said it must stay:
Furthermore, I am using it as my reference for my own work and it needs to stay visible as for the reader to be able to track its conclusions, otherwise: How it will be reached if it is censored by you? But, who are you to censor anything at all?
I recommend this article to stay, and to be taken seriously.
It is not irresponsible at all, in what way could it be?, other than to taint the unfounded narrative of a "natural" origin?
This is the opportune time to make this information to be known, as Yuri Deigin is teaching as well: https://medium.com/@yurideigin/lab-made-cov2-genealogy-through-the-lens-of-gain-of-function-research-f96dd7413748, as the article asks, I ask you:
What is your reason to censor the evident information that COVID-19 is an artificial strain?, because, it has:
1) A backbone of a virus from a bat,
2) An optimized RBM that looks like from a virus of a pangolin,
3) A portion of Orf1b that is closer to a different virus from a different pangolin,
4) An optimized 12-bases protease cleavage of unknown procedance, that looks more to a portion of a virus from a pig, but also to an artificial sequence to make proteins patented by "Moderna Inc", funded by Bill Gates,
5) An HIV-like optimized region at the left side of the RBM (and we all need to know that even Sars has a cloaked identity to HIV), known by Zhengli since 2008 as the determining and necessary portion for the infectivity.
6) Furthermore, Zhengli did in 2018 a study on people from Wuhan and did not found any zoonotic event at that time.
7) For a virus such as Sars-CoV-2 to have appeared out of a sudden already mature and with no history of previous traces of it in humans indicates that it was released from a Laboratory after being optimized for those three sites that I mention above in points 2, 4 and 5. And that is just the beginning of the comparisons, as many other of its proteins also seem to be optimized in a laboratory.
With all due respect and education for the freedom of the research and the tearing down of censorship,
Fernando Castro-Chavez, PhD.
P.S.
Who is advising you to censor the evidence for the obvious lab origins of COVID-19?"
5th May, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
But, back to the articles showing the similarities between the HIV-1 and the Sars-CoV-1 and Sars-CoV-1, I found this comparison compelling as to destroy them all through a common strategy:
Old Sars1: YEQYIKWPWYVWLGF
COVID-19: YEQYIKWPWYIWLGF
HIV1 AIDS: WASLWNWFNITNWLWY
"Sequence comparison of the aromatic residue-rich regions of HIV-1 gp41 and SARS-CoV (Old Sars) and the virus of COVID-19, S2 proteins. The aromatic residues are in blue. Remarkably, the relatively rare aromatic residues comprise about half of the residues in these region"!!!
References:
Kliger, Y. & Levanon, E. Y. Cloaked similarity between HIV-1 and SARS-CoV suggests an anti-SARS strategy. BMC Microbiol. 2003, 3:20: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC222911
Zhang, X. W. & Yap, Y. L. Structural similarity between HIV-1 gp41 and SARS-CoV S2 proteins suggests an analogous membrane fusion mechanism. Theochem. 2004, 677(1):73–76: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7141560
From the three images, we read:
Upper Left: Wheel projection of the N-HR (a) and C-HR (b) of SARS-CoV S2 protein (gi|30023954). The amino acid sequence is displayed end-to-end down the axis of a schematic helix. The angle between every two consecutive amino acids is 102.9°. The helical wheel consists of seven corners, corresponding to the fit of seven amino acid residues into every two helical turns.
Upper Right: Wheel projection of the N-HR (a) and C-HR (b) of HIV-1 gp41 (gi|9629363). The amino acid sequence is displayed end-to-end down the axis of a schematic helix. The angle between every two consecutive amino acids is 102.9°. The helical wheel consists of seven corners, corresponding to the fit of seven amino acid residues into every two helical turns.
Then: Similarity between the fusion proteins of HIV-1 and SARS-CoV. The HIV-1 gp41 (a) and the equivalent S2 protein from the SARS-CoV (b) are shown. A Leucine/Isoleucine heptad repeat adjacent to the N-terminus of both proteins appears in red. The C-terminal heptad repeat is in green. Cysteine residues (purple) confining a loop structure are located between the two heptad repeats. An aromatic residues-rich motif is marked blue, and the transmembrane segment is in orange. A peptide corresponding to the C-terminal heptad repeat, which acts as potent inhibitor of HIV-1 entry into the cell, appears in yellow.
Then, searching further, I found a great book: https://web.archive.org/web/20200430042150/http://virological.org/uploads/short-url/6rBA2kTkfxLXjda60Yw2rfJASAS.pdf, whose substance for this topic is in pages 53-56, as per the image of the amino acids, that says:
"Tryptophan is normally a very rare amino acid. Many large proteins contain none at all. So this peptide region is highly unusual. We found that it combined basic amino acids with aromatic amino acids in such a way as to create a potent toxin that in the virus serves as a membrane-permeabilization region known as a viroporin.
Examination of the HIV-1 aromatic region, and the helical region of influenza PBf2 known to be toxic, again show that they also combine basic amino acids with aromatic amino acids, as also does the entry peptide for papillomaviruses.
The peptide region around the aromatic region of SARS and nCoV2019 follow this same pattern of combining basic amino acids, K or R with aromatic amino acids, especially tryptophan (W).
We suggest here that a pattern is emerging among very disparate viral agents of using this known membrane-destabilizing motif – K or R with multiple aromatic residues, especially W, to disrupt cell membranes yielding cell fusion, cell permeabilization or cell destruction.
While not directly alignable, the common character of these peptides in visually striking. We suggest that they constitute a superfamily of membrane destabilizing peptides across many families of both naked and enveloped viruses, wherever membrane perturbation is an essential mechanism to viral replication or pathogenesis."
The figure says: "Family of Basic/Aromatic Membrane Destabilizing Peptides. Six peptides known to destabilize membranes or are involved in membrane fusion are shown that share the property of combining basic amino acids K and/or R with aromatic amino acids W, F or Y. Shown are peptides from Wuhan S2, Ebola Delta, Enterovirus D68 ORF3, HIV-1 gp41, Flu H3N2 PB1f2, and Human Papillomavirus type 6 L2, as described in the text. Projections are from the PepDraw utility of the Wimley lab, Tulane School of Medicine."
WOW!!!
1 Recommendation
6th May, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Another good article within the alternative cures other than the ones that the sponsors of this current COVID-.19 Pandemia are advertising:
Ho, T. Y., Wu, S. L., Chen, J. C., Li, C. C., & Hsiang, C. Y. (2007). Emodin blocks the SARS coronavirus spike protein and angiotensin‐converting enzyme 2 interaction. Antiviral Research, 74(2), 92–101. https://doi.org/10.1016/j.antiviral.2006.04.014
Emodin is "an anthraquinone compound derived from genus Rheum (Rheum officinale) and Polygonum (Polygonum multiflorum)", and "significantly blocked the S protein and ACE2 interaction in a dose-dependent manner", and inhibited even with 10 μg/ml!!! the interaction of SARS‐CoV S protein and ACE2!!!!
Do anything and do everything to block the artificial monopoly of artificially made substances aimed at the supposed "control" of an artificial pandemia designed by the likes of Fauci, Gates, WHO, UN!!!, this artificial COVID-19 keeps on falling apart thanks to your help!!!
Further evidence for the unaware still that Fauci and Gates and the WHO are in it for a dishonest gain (especially, do NOT let yourself to be vaccinated by them with their "microchip" also well documented elsewhere):
Please DO your OWN research, your next generation will thank you!!!
7th May, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Update: They have censored everywhere the video with the veritable interview of bold researcher Judy Mikovits (I attach it here right now in the 7th of May, 2020, for the record of history, on how low humanity, a portion of it, can fall, and for us all with the eyes wide open NOT to let them get away with it, the naked truth being censored!!! It is happening "folks", and in your hands it is to let them get away with this or not!!!) Thanks to all the honest researchers that have contacted me in personal messages, and in all of these eight evidences for me that COVD-19 is an Engineered virus. Today, I was getting ready to do as daily, a cold analysis of facts, results and evidences, but I was struck by the human aspect..., and fell on my knees on prayer for God to keep on helping us in this steep upwards battle. I found this video and the book that I recommend you to read, especially the foreword by one of the surviving heroes of that famous Kennedy dynasty: https://play.google.com/books/reader?id=-8KZDwAAQBAJ; the rest will be posted here: https://plandemicmovie.com, for you to freely view and distribute, and the first delivery of a great project: https://www.youtube.com/watch?v=MbrLQpn1bj8, from that video. The enduring quotation by Robert F. Kennedy Jr. was the next one: "We are so focused on our search for the truth, we fail to consider how few actually want us to find it", by Valery A. Legasov.
Here, I attach a statement from the book, and a clip from the movie that made me cry, as well as some screenshots...
7th May, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
As simple as to keep moist or humidified your nostrils is enough as a PREVENTIVE strategy against COVID-19, but only when you are in a crowded environment (something nowadays almost impossible) my advice continues to moisturize your nose orifices with your own saliva, as the enzymes within it are powerful even to destroy the HIV!!! (Basically DO NOT keep a dry nose when on crowded places nowadays during this artificially designed Pandemia by the likes of the WHO, Fauci, Gates, CCP, Big Pharma, almost all the "Health" agencies of the US, US Democrats (the leaders, not the sheeple), etc.; and of course, also keeping your mouse shut to nullify the entrance of anything through there):
Arch Intern Med
. 1999 Feb 8;159(3):303-10. doi: 10.1001/archinte.159.3.303.
Why Is HIV Rarely Transmitted by Oral Secretions? Saliva Can Disrupt Orally Shed, Infected Leukocytes
S Baron, J Poast, M W Cloyd
Affiliation:
Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston 77555-1019, USA.
PMID: 9989543
DOI: 10.1001/archinte.159.3.303
This, we know that Big Pharma is going to ignore and deny because it is NOT convenient for them such a free and easy preventative!!!
And now, we received a very related observation sent by our dear Jean.Claude Perez indicating that a moist and humidified environment, such that of the beach, and moisturizers of the rooms, of the environment, get away with the possibility of any kind of airborne viruses to be around without being caught by vapor droplets and precipitated!!! Dryness is the vector of the virus, humidity is its demise!!!:
Fighting COVID-19 with water
Gordan Lauc 1, Alemka Markotic 2, Ivan Gornik 3, Dragan Primorac 4-9
1 University of Zagreb Faculty of Pharmacy and Biochemistry & Genos Glycoscience Research Laboratory, Zagreb, Croatia
2 Clinics for Infective Diseases, Dr. Fran Mihaljević, Zagreb, Croatia
3 Department of Emergency Medicine, Clinical Hospital Zagreb, Zagreb, Croatia
4 St Catharine Hospital, Zagreb, Croatia
5 Eberly College of Science, Penn State University, USA
6 University of Split School of Medicine, Split, Croatia
7 University of Osijek School of Medicine, Osijek, Croatia
8 University of Osijek Faculty of Dental Medicine and Health, Croatia
9 Medical School REGIOMED, Coburg, Germany
"Mucosal barrier covering our epithelia functions as a protective shield against pathogen invasion in a way that is very similar to walls and a moat that were protecting medieval cities like Dubrovnik. Dehydration of this thick glycan layer inactivates this first line of defence and promotes both initial infection and subsequent expansion of the virus through airways." Croatian Doctor Dragan Primorac.
Conclusion: So, let this simple concept to sink into your head: GOD will permanently guide you, giving you wisdom, if you ask, on how to get rid of this Pandemia, at least for you and for your own (but this common-sense advice of keeping moist with your own saliva INSIDE your nostrils; so, for now, you need to endure its smell, sorry!, sorry also that at this time is better to let your inner nose hair to grow, God knows why he put those barriers there!!! That also may keep you humble!!! So simple!!! Hehee). But you need to be strong NOT to trust the mass media and the big pharma that are coming as the only truths!!! they will ignore or deny, as they keep on doing it usually, so as for them to wipe-out the most simple methods that are the most effective in reality!!! They have their own hidden and sinister agenda. But YOU have your transparent and open agenda: To keep yourself safe, and your own!!! God is with you! But, are you with Him?
And the good Citizens of this dear planet keep on fighting for the truth to be seen for everybody else: https://www.youtube.com/watch?v=WxczJ1I4qnc (this is still standing a of today 7th of May, 2020, let us see how long it lasts before the censorship of the criminal and evil WHO, UN, CCP, Gates, Fauci, Pharma, etc...), https://www.youtube.com/watch?v=D4x0IsdOkU4 (they already removed the sound of this one).
8th May, 2020
Andras Szilagyi
Research Centre for Natural Sciences
8th May, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Andras Szilagyi, please, also read critically this one, and put your comments on both to be constructive for the swift solution of this engineered Pandemia of COVID-19: , or to that effect, any other reader that wants to make a difference in the current events, please. Meanwhile, I will say that my criticism for this second one is very similar to the one I make to the one linked by Szilagyi, the authors of both peer-reviewed papers that went like crazy against a non-peer-reviewed and against a withdrawn article (beating a fallen horse, so to speak), bullying with all they got, while forgetting to be thorough in their biased computational theoretical comparisons (and below I will explain why), not only omitting the results of each other but also omitting the nucleotide sequences (while the Indians where kind enough to add them), while at the same time ignored, not only comparisons done by their reciprocal analyses, but the fact that Zhengi in 2008 pointed out that such was a vital region for the infectivity of the Sars-CoV, the one where the sequences found by Jean-Claude Perez (who had published by himself an earlier work on that) and by Luc Montagnier, another set of documents (the Zhengli 2008 seen above and the earlier Perez work) ignored by the "debunkers", which also deliberately ignored that within the Spike protein there is a cloaked homology with the HIV-1, found at least by two independent groups (also linked above). I have written to the indian guys that withdrew their paper, to no avail, as I have received no response, and I am telling them all that until an experiment is done again to verify the finding of Zhengli in 2008, done in the laboratory, with and without that vital region with high homology to sequences of the HIV and of the SIV; so, the importance for the COVID-19 of that region is still awaiting to be corroborated experimentally in the lab, but the previous work of Zhengli on that region is telling us that it is important. Please, I request you Andras Szilagyi to have your say on these articles, as we all want a soon as possible solution to the cause, to the origins of the COVID-19. With the best, Fernando Castro-Chavez.
8th May, 2020
Andras Szilagyi
Research Centre for Natural Sciences
Please see Fig 2 in the article I linked, where the authors show on a structural model of the spike-ACE2 complex that the 4 alleged HIV insertions are distant from the receptor binding region. Also see Table 1 which shows that HIV only appears in the top 5 BLAST hits for one of the 4 regions, and the BLAST E-values are very high, thus the hits to HIV are just by chance.
8th May, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Andras, the sequence that I emphasize here in this sharing of evidences is the one that I independently found: "Third Sequence: COVID-19: AATGGTACTAAGAGG = HIV-1 isolate 19663.24H9 from Netherlands envelope glycoprotein (env) gene, sequence ID: GU455503.1". Jean-Claude Perez and Luc Montagnier also found independently that site, (they found it longer though, with three pyrimidine nucleotide mismatches (here in not-bold and not in italics): AATGGTACTAAGAGGTTTGATAACCCTG, then, as the third cohort of researchers finding also something special here, the Indians that have not responded to me, they also found by 3-D modeling, not by an only flat 2-D blast comparison, that the 3-D shape of the structure was a match for the HIV-1, so not only the 2-D but the 3-D are speaking about it, so their nucleotide sequence equivalent to that 3-D HIV-1 match was: "TCTGGGACCAATGGTACTAAGAGG", so your eyes can see now that the tree significant findings are slightly different but they are hoovering over the same region.
Now, the image that you are saying (that I attach here as per your request and for the awareness of the kind readers) is in its explanation saying the next: "During different stages of coronavirus infection, the spike proteins may be post-processed (i.e. cleaved) to produce different isoforms. Therefore, the eventual spike complex might not include all residues of a full-length spike protein. Nevertheless, we construct the complex model using full-length spike sequence to illustrate the locations of the four insertions." So it is saying that basically it is just a theoretical model that can be completely useless in the practical world until a real experiment, as I have prompted the Indian guys to do so, but they may be so poor that they do not have the proper means to do it in the experimental realm.
Then I also attach their table one as per your request, corroborating my finding for this site (only 1/8 of them all).
The other three sequences that the Indians found that match in 3-D the HIV-1 are the next ones translated into the 2-D conformation of the nucleotides: This is the second: CACAAAAACAACAAAAGT, this is the third: GGTGATTCTTCTTCAGGT, and this is the fourth: CAGACTAATTCTCCTCGGCGGGCA, which is the most remarkable because it exactly contains within itself the mystery sequence of 12-bases necessary for the rupture of the PRRAR sequence by the protease, which then indicates that it was added on purpose inside a Laboratory to mimic the HIV-1 and to have the ferocity to penetrate that the HIV-1 has, not only to the ACE2 cells, but to others as well, hence the importance to demonstrate that this is an artificial sequence with an aberrant and unexpected pattern of behavior more dangerous than the ordinary Sars-CoV, due to its intervention in the lab.
If this were not enough, now I have found that at least three groups have also found several and similar sequences to the HIV-1, you can call them HIV-1-like, if you like, further to the right of this cleavage site (and new findings keep on coming, I have been told about other three new ones that are not visible in the 2-D nucleotides, but until you reconstruct a detailed 3-D model). I have already posted the references before of all of them, one of them if I remember correctly belongs to the Gallagher team, the other to an Israeli group and the third to Asians.
Here I want to attach for the history, the statement of Anthony S. Fauci, on promoting the deceiving, lying, biased and flawed paper by Andersen et al., 2020, that I wish you, if you will, that you will be able to keenly dethrone, as many others have also done it. And there is a very BIG conflict of interest here, as the head co-writer receives three grants from the NIH and has his own biotech company at the same time, this is the same as when Peter Daszak, financier and co-author of the works of Zhengli says that the virus is only "natural" and not artificial, and then pays another 26 of his subordinates to sign a paper with such a statement, or when Zhengli says that she looked at her notebooks and did not found the COVID-19 within them, or when Baric says cynically on TV that a flu is worst than this COVID-19, and that he "FOUND" a Coronavirus in 2015, when in reality he "DESIGNED" a killer of elderly mice on that year in the company of Zhengli, etc., etc.
Anthony S. Fauci said (18th of April, 2020): “There was a study, ah, recently that we can make available to you were, a, group of highly qualified evolutionary virologist look at the sequences there and the sequences in, ah, bats, as they evolve, and the mutations that it took to get to the point where it is now is totally consistent with a jump of a species from an animal to a human, so, I mean, there, the paper will be available, I don't have to quote this right now but we can make that available to you.” So, once more the Darwinian theory of evolution is being used on purpose by the ones most deeply involved in the design and release of COVID-19, to cover-up a man-made virus.
Morale: If somebody released on purpose this COVID-19 virus that person or persons will NOT stop until keep on fulfilling their purposes of fear mongering, of vaccination to insert to the human population their mark ("Digital Certificate of Immunity", as per Gates on record), and until they reach their goal of more control over the human beings. So, stay alert, as I have been already warned, that in South America they have seen unmarked small planes RELEASING "powder" in the nights into some of the main cities... figure that out!
8th May, 2020
Andras Szilagyi
Research Centre for Natural Sciences
Fernando, where are the BLAST E-values for your findings?
8th May, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
You can find the full comparison, saved since the day I posted this one, also here, attached in TXT:
Description: HIV-1 isolate 100711m.4.4 from USA envelope glycoprotein (env)...
Max Score: 30.2
Total Score: 30.2
Query cover: 100%
E Value: 432
Per Ident: 100.00
Accession: MH012801.1
Be Ware of Gates (Here, I attach for the record, from the thousands of rants available with himself pushing vaccination, the one that makes him look like the real psychopath that he is, the real and Batmanian "Joker" in flesh and blood, Hehee).
8th May, 2020
Andras Szilagyi
Research Centre for Natural Sciences
Fernando, do you understand the meaning of the E value, and what an E value of 432 means?
1 Recommendation
8th May, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Adras, thank you very much for your cooperation with this research in general, as I said, it is worth for you to dissect the full paper that you have brought to our attention, so I give you the honor to explain such humble rudiments of the human knowledge for our dear readers, shall you please proceed to explain here how come the "Number of expected hits of similar quality (score) that could be found just by chance is of 432 for the HIV-1 match to the virus of the COVID-19, and how the key sequence in S for the protease cleavage of the Sars-CoV-2 has an E-value of 429: https://www.researchgate.net/post/COVID-19_CCTCGGCGGGCACGT_PRRAR_AA_Furin_cleavage_site_at_23603-23617_of_the_MN908947_Genbank_Genome_Matches_Mostly_Bacteria_COVID-19_in_BLAST, even when that sequence of unexplained origin is the key for the penetration into the cells? Is as the authors say, paraphrasing them: This theoretical E-number means absolutely NOTHING until we are able to see how experimentally the portion under consideration behaves. As some programmer may have dismissed either the 429 or the 432, even when we know that the first one is VITAL for the attack of the virus. Somebody who is a Nobel prize with more humility than others that you may know, admits that we still do not know the full effects of even the small peptides with similarity to other viruses, especially when they flock for the decens in a small region, until experimentally explored, such as that one that Zhengli (in the 2008) says that is vital for infectivity, matching the exact region of the HIV/SIV matches (that I attach once more for the curious reader). The speculative models done by a computer, are fully inaccurate, and even the bad blooded research of Andersen et al., 2020 demonstrated that the IDEAL programmatically is NOT the OPTIMAL in the practice. So as you can not dismiss the 429, you can not dismiss the 432, because you will be losing the key that COVID-19 uses to enter the cell. Fernando.
P.S.
In the image the red region is the match to the flock of immunodeficiency sequences found by Montagnier and Perez.
I did a research that costed me my job, a work that kicked all the vainglorious smartasses rears, and that had an E value of more than that, and to have that 12-bases sequence was the difference between a fake and bad experiment and a good and trustworthy one, just by having that little sequence; so, I am not ashamed to be humble as to say: Those models in the screen are 100% fallible until the real experiment is done, and I did publish it, no matter what, I DO NOT care about money but about truth: How about you?; so, do you want to demonstrate that COVID-19 is an engineered deed, or just the opposite???:
This is an article, not by the poor discredited indians, but by a Chinese team that independently found what others that are willing to see are also finding: https://freewestmedia.com/2020/02/27/chinese-scientists-discover-hiv-like-feature-in-cornovirus-mutation
So, the article there in Chinese is this one: http://www.whiov.cas.cn/105341/201911/t20191118_5438006.html (Oh, WOW, they already removed the actual article that was linked there in Chinese, such the censure works, my dear friends, but I saved it somewhere in some of the work computers, let me look for it and I will post it here later once I found it...)
9th May, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
So, I humbly present the results of my research in Spanish, if a research journal gets interested for me to also publish it in English, I will, I already got one offer to do so, I will post here whatever happens with this: https://fdocc.yolasite.com/resources/fdocc-antiCOVIDiana1.pdf , bye for now!!!
1 Recommendation
9th May, 2020
jean-claude Perez
Bravo !
9th May, 2020
jean-claude Perez
Fernando, i think a good Idea posting your results on a preprints site? I posted on OSF...
1 Recommendation
9th May, 2020
Andras Szilagyi
Research Centre for Natural Sciences
Fernando, the E-value of 432 means that you can expect 432 hits like that purely by chance. So that means that finding that sequence in HIV is purely by chance. And as you see, you got lots of identical hits from a number of completely unrelated organisms. So, I'm sorry to say but your finding is completely meaningless. Any reputable journal will immediately reject it. There are no insertions in SARS-CoV-2 from HIV.
1 Recommendation
11th May, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Structural similarity between HIV-1 gp41 and SARS-CoV S2 proteins suggests an analogous membrane fusion mechanism
Xue Wu Zhang and Yee Leng Yap
"...these discoveries suggest a similar membrane fusion mechanism for the two viruses. Naturally, a question arises: could the inhibitors for anti-HIV-1 therapy be used to fight against SARS-CoV? For example, GGL, a HIV-1 specific cell entry inhibitor that can bind to the coiled-coil core of gp41 and efficiently inhibit HIV-1 envelope-mediated cell-cell fusion, and another D-peptide inhibitor, which targets the gp41 coiled-coil pocket and inhibits HIV-1 entry..."
So, the evidence is clear that Sars-CoV-2 has a hidden similarity to the HIV-1, and I will not repeat myself into that, the E-Value is subject to the Experimental results and it is not the final word, I told the same in previous messages, both personal and here several times, if it were the final word, so then sequences that are 12-bases long such as the one of the protease cleavage and the one of the E. coli Restriction enzyme contaminating thousands of sequences by singe-strand self-annealing that I published on 2012 will be dismissed, when experimentally they show to be determinants, one for the entry of the retroviral RNA into the cells and the other to thoroughly contaminate the Genbank. If that similarity also in the sequence itself and in the 3-D models of the Spike protein helps to destroy COVID-19 before it causes more damage, we are all for it to pursue the research following the lead of the origin of the COVID-19 to its source, as to prevent things as such from happening again.
So, focused on finding the swiftest remedy to this malady, as to prevent from the originators to take over everything still, apart of turning off your TV, is of the priority here, we need to remember the vanity of Robert Gallo and of Anthony S. Fauci in the past regarding the HIV-1 issue that was of no use at all. Please, let us not repeat that kind of idiocies in this case, that is my humble remark. Anyone can verify that the HIV-1-like structural features of Sars-CoV are also present in full in Sars-CoV-2, as the Gallagher father and son have discovered in their self-published book. If we want to save lives, we do not need to care so much really in the peer-reviewed process that may be retaining some vital information while people is suffering. So, the advice of Jean-Claude Perez of sending things to places such as the OSF, I think is a good advice. Here is when the strife between vanity and service show their real colors.
But I think that right now we can also focus in more important aspects that encompass the whole of humanity, such as this one that I have also been stressing within these discussions that I am humbled to still be able to do:
Bill Gates Laying Foundation for Mark of the Beast
Bill Gates is Setting the Stage for the Mark of the Beast
Scott Keisler - April 20, 2020
In 2016 a powerful confab of globalists converged at the UN headquarters in New York, New York to launch a global initiative called ID2020. The vision of ID2020 is ostensibly to advocate "for ethical, privacy-protecting approaches to digital ID"(1) and to provide IDs for "over 1 billion people worldwide (who) do not have access to any form of identification."(2)
The Rockefeller Foundation provided the seed money for the ambitious ID project and continues to be an ongoing supporter of ID2020’s work.(3) The project's other founding members include Gavi The Vaccine Alliance, Microsoft, Accenture and IDEO.org.(4) The Bill and Melinda Gates Foundation gave $750 million to set up the aforementioned Gavi in 1999 and "the (Gates) Foundation is a key Gavi partner in vaccine market shaping."(5) Thus between Microsoft and The Gates Foundation ID2020 has been operating under the guiding hand of Bill Gates from the onset.
ID2020 seeks "to leverage immunization as an opportunity to establish digital identity"(6) and to "provide a unique digital identity to everyone on the planet."(7) Of course all this will be done, we are told, with the utmost respect for personal privacy, security and choice.(8) After all, "Participation in the modern economy, the ability to buy and sell, attain employment, healthcare, social services and more are virtually impossible without a digital identity."(9)(emphasis added)
So basically Bill Gates has adopted as his personal mission the task of enrolling every single person on the planet in a global ID database. And vaccines are the vehicle through which this will be accomplished.
Last week Robert F. Kenned, Jr. penned a scathing article exposing Bill Gates for what he really is,
"Vaccines, for Bill Gates, are a strategic philanthropy that feed his many vaccine-related businesses (including Microsoft’s ambition to control a global vaccination ID enterprise) and give him dictatorial control of global health policy."(10)
Kennedy continues,
"In 2010, when Gates committed $10 billion to the WHO, he said 'We must make this the decade of vaccines.'"(11)
And,
"In addition to using his philanthropy to control WHO, UNICEF, GAVI, and PATH, Gates funds a private pharmaceutical company that manufactures vaccines and is donating $50 million to 12 pharmaceutical companies to speed up development of a coronavirus vaccine."(12)
If you aren't familiar with the atrocities that have been committed around the globe by Bill Gates in the name of vaccination and population control Kennedy gives a concise overview here.
Some readers may not know that Bill Gates' father was on the Board of Planned Parenthood(13), the abortion provider that was founded on racist principles and eugenics. For the Gateses culling the earth of useless eaters is a generational enterprise. (See Gates endorsing Death Panels here.)
On March 19, 2020 Bill Gates took to Reddit to propose a digital certificate to identify those who have received the Covid19 vaccination.(14) Vaccination recipients, according to Gates, can be given a "quantum dot tattoo"(15), which is "a bit of dye that is invisible to the naked eye" but that can be seen with infrared light.(16) The tattoo would store a digital file that could be read with a scanner or a smartphone.(17) This quantum dot tattoo was developed at MIT and funded by...guess who?(18)
It doesn't take too much imagination to see the convergence of a mandatory vaccination and a mandatory global digital ID here(19) - a present from the Globalists that would eventually be required to buy and sell in the Brave New post Covid19 World.(19)
On March 26, 2020 Microsoft filed Patent WO/2020/060606 (note that last number) which uses 'body activity' to authorize and verify cryptocurrency transactions.(20) Examples of body activity include "brain wave, pulse rate or body heat radiation".(21)
Cryptocurrency is block-chain oriented and could very well serve as the currency in the coming global cashless society.
It's interesting that the name of the initiative in view is ID2020. Not ID2019, ID2021 or ID2025. It is also curious that Dr. Anthony Fauci of The White House's Coronavirus Task Force said in 2017, almost prophetically, "There is no question that there will be a challenge to the coming administration in the arena of infectious diseases."(22)
It's almost as if this was all planned some time ago.
Fauci "serves as a member of the Leadership Council for the Global Vaccine Action Plan developed by the Bill & Melinda Gates Foundation, the World Health Organization, UNICEP and Fauci’s own NIAID — the plan that calls for a 'Decade of Vaccines' to spread far and wide, all around the globe."(23) Bill Gates "has a multi-million dollar relationship with Dr. Fauci."(24) Suffice it to say the connections between Gates and Fauci are extensive (see here). And here is Dr. Fauci very clearly giving the Masonic Hidden Hand gesture at a recent White House press conference for the whole world to see.
Was Fauci making an announcement to 'enlightened' initiates around the world?
📷
Bill Gates with Dr. Anthony Fauci
Also it causes all, both small and great, both rich and poor, both free and slave, to be marked on the right hand or the forehead,
so that no one can buy or sell unless he has the mark, that is, the name of the beast or the number of its name.
This calls for wisdom: let the one who has understanding calculate the number of the beast, for it is the number of a man, and his number is 666. Revelation 13:16-18
I'm not saying this is the Mark of the Beast but the groundwork and infrastructure are definitely being laid.
  1. https://id2020.org/faq
  2. Ibid.
  3. https://id2020.org/alliance
  4. Ibid.
  5. https://www.gavi.org/operating-model/gavis-partnership-model/bill-melinda-gates-foundation
  6. https://www.biometricupdate.com/201909/id2020-and-partners-launch-program-to-provide-digital-id-with-vaccines
  7. https://www.windowscentral.com/microsoft-universal-digital-identification-and-you?amp
  8. https://id2020.org/faq
  9. https://www.windowscentral.com/microsoft-universal-digital-identification-and-you?amp
  10. https://childrenshealthdefense.org/news/government-corruption/gates-globalist-vaccine-agenda-a-win-win-for-pharma-and-mandatory-vaccination/
  11. Ibid.
  12. Ibid.
  13. https://magazine.washington.edu/feature/the-immense-impact-of-bill-gates-sr/
  14. https://amp.reddit.com/r/China_Flu/comments/flja0e/bill_gates_purposes_digital_certificate_of_whos/
  15. https://jamesfetzer.org/2020/03/bill-gates-quantum-dot-digital-tattoo-implant-to-track-covid-19-vaccine-compliance/
  16. https://www.scientificamerican.com/article/invisible-ink-could-reveal-whether-kids-have-been-vaccinated/
  17. Ibid.
  18. https://jamesfetzer.org/2020/03/bill-gates-quantum-dot-digital-tattoo-implant-to-track-covid-19-vaccine-compliance/
  19. https://banned.video/watch?id=5da4c433392c2e0019afaae6
  20. https://patentscope.wipo.int/search/en/detail.jsf?docId=WO2020060606&tab=PCTBIBLIO
  21. https://patentscope.wipo.int/search/en/detail.jsf?docId=WO2020060606&tab=PCTCLAIMS
  22. https://huffpost.com/us/entry/us_5e8a0548c5b6e7d76c65c8a4
  23. https://amp.washingtontimes.com/news/2020/apr/11/bill-gates-anthony-fauci-unelected-destroyers-free/
  24. https://nationalfile.com/president-trump-vs-bill-gates-on-treatment-fauci-has-a-100-million-conflict-of-interest/ Extra Notes: Letters for the images are as follows: Comparison between gp41 from HIV-1 and SARS-CoV S2. N and C chains of gp41 are colored blue and yellow, respectively. S2 is colored white.(A) Binding interaction between S2 and inhibitor GGL (represented by spacefill). (B) Chemical structure of GGL, its formula is: C5H9NO4. (A) Binding interaction between S2 and D-peptide inhibitor of HIV-1 gp41 (represented by spacefill. (B) Chemical structure for two molecules of D-peptide DAL (5(C3H7NO2)) and DAR (2(C6H15N4O2)). Then I say: It is depressing to me to see that Francis S. Collins is sitting in the center of two very repugnant and repudiable individuals such as Gates and Fauci are. A great set of observations by Judy Mikovits: https://plandemicmovie.com/, and her 51 publications at the PubMed: https://pubmed.ncbi.nlm.nih.gov/?term=%22Mikovits%20J%22, I quote her in one of my articles as per one of her remedies for this human engineered COVID-19, as per her natural product recommended also against HIV-1.
1 Recommendation
11th May, 2020
Andras Szilagyi
Research Centre for Natural Sciences
Fernando, unfortunately you come off as a tinfoil-hat conspiracy theorist rather than a scientist. That doesn't help your case.
11th May, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
Analysis of therapeutic targets for SARS-CoV-2 and discovery of potential drugs by computational methods
On searching for a solution, for alternatives to solve with no need of a useless universal vaccination, here is another interesting article tracking the HIV-1 similarity to Sars-CoV-2, and others:
"Chloroquine phosphate has shown better anti-SARS-CoV-2
effects in recent studies.
In our docking results, chloroquine phosphate is predicted to
possibly combine with Nsp3b and E-channel.
Chloroquine phosphate has been used in the treatment of
malaria since the 1940s and later in rheumatoid arthritis. Chloroquine
has been reported in some earlier studies to have direct
anti-viral effects, such as inhibiting flavivirus, retrovirus (such as
HIV), and many coronaviruses. Recent study showed that with
EC50 of 1.13 mmol/L and SI greater than 88, chloroquine can
effectively inhibit SARS-CoV-2 in the cell level.
Chloroquine phosphate was turned into chloroquine
in the body to play therapeutic effect. Our docking results
showed that the possible target of chloroquine is Nsp3b or Echannel
with the docking mfScores of 130.355 and 107.889,
respectively.
Based on structure modeling of helicase protein, anti-bacterial
drugs (lymecycline, cefsulodine and rolitetracycline), anti-fungal
drug itraconazole, anti-human immunodeficiency virus-1 (HIV-1)
drug saquinavir, anti-coagulant drug dabigatran, and diuretic drug
canrenoic acid were predicted to be helicase inhibitors with high
mfScores through virtual ligand screening. The natural products,
such as many flavanoids from different sources (a-glucosyl hesperidin,
hesperidin, rutin, quercetagetin 6-O-b-D-glucopyranoside
and homovitexin), xanthones such as 3,5-dimethoxy-1-[(6-O-b-Dxylopyranosyl-
b-D-glucopyranosyl)oxy]-9H-xanthen-9-one, kouitchenside
H, kouitchenside A, 8,2-dihydroxy-3,4,5-trimethoxy-1-
[(6-O-b-D-xylopyranosyl-b-D-glucopyranosyl)oxy]-9H-xanthen-9-
one, kouitchenside D, 1-hydroxy-2,6-dimethoxy-8-[(6-O-b-Dxylopyranosyl-
b-D-glucopyranosyl)oxy]-9H-xanthen-9-one and
triptexanthoside D from Swertia genus, phyllaemblicin B and
phyllaemblinol from Phyllanthus emblica showed high binding
affinity to this target.
Lopinavir and ritonavir have been marketed in China and are
mainly used to treat HIV-1 infection in adults and children over 2
years of age. In vitro studies have shown that lopinavir and ritonavir
can inhibit the replication of MERS-CoV and SARS-CoV to
exert anti-viral effects. The drug is listed as a recommended drug
in the Anti-viral Drugs section of the New Coronavirus Infected
Pneumonia Diagnosis and Treatment Program.
Darunavir is an HIV-1 protease inhibitor that selectively inhibits
the cleavage of HIV-encoded Gag-Pol polyprotein in virally
infected cells, thereby preventing the formation of mature infectious
virus particles. At a concentration of 300 mmol/L, darunavir
can significantly inhibit virus replication, and the inhibition efficiency
is 280 times compared with the untreated group.
High-throughput screening makes this strategy possible, and new
functions of many drug molecules can be found through this
strategy, for example, the discovery of anti-HIV infection drug
lopinavir/ritonavir."
This is an open case that many others are searching independently, thank God. I am nobody at all in this discussion, if anything at all, I am just an insignificant droplet in the current sea of truth. And as I repeatedly have said to everybody, I do not care at all about my reputation or at all about money, and as I have repeatedly mentioned, it is an honor in these times to be an independently thinking person not bound by any paradigm or by any philosophical system. Do not fall for those hollow straw men that use character assassination with no reason, and to no avail at all. I am a Creation in God believer, and a Christian; so, I recommend to all my readers to be a seeing eye to discern independently on their own everything, to validate it or to discard it by themselves; that is very easy in such a way to discern who is in it for truth and to find the remedy as soon as possible, and who are the bullies and the ones that do want this to continue unscathed; so, my dear ones from all over the world that have read me by the thousands, do your own discerning of things, even from everything that is presented here, and here is one more significant excerpt from a video interview to consider (before the ruthless censorship falls upon it in any way or sort, by the straight removal of the originals, or by falling "en masse" against it even if the original has already disappeared, and you know what I mean).
The HIV-1-like aromatic plus basic sequence described by Gallagher (HIV-1-gp41-like, even in the previous Sars-CoV version, enhanced artificially in the lab in this new version of Sars-CoV-2 to be a better "invader" of our cells; search in my postings above if you want to find about it, please).
12th May, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
To release a "Peptide P", including or made of the sequence PRRAR as a mock peptide to prevent the entry of COVID-19 into the ACE2 cellas and other kinds of cells will be an alternative; or even "Peptide R", a similar mock peptide with the sequence of the RBD of that COVID-19 virus: L+F+QS+N+Y in their respective positions, spanning 153 bases..., or even a combination of these two peptides... Homologous to what happened with "Peptide T". Another option is an enzymatic one to destroy the 12-bases of the "Furin cleavage site", such as some ZAP kind enzyme, even before it is transcribed, or even a combination of the two peptides and the enzyme, whatever to destroy ASAP the COVID-19 "continuous menace" that TV and Gates want to keep on alive during a couple of years until fulfilling his sinister plans... Alternatives to the products that the "Big Pharma" wants to push. Judy Mikovits recommend us to see the movies "Dallas Buyers Club" to see how the real cures are not in the official or authorized pharmaceutical products, and also "And the Band Played On", just to see the sheer ambition out of money by the owners of the "blood banks". I wrote to Gates through Instagram about my alternatives even before I knew of his engagement to vaccinate for the "Digitalization" of humanity (his big deal even before in the "preventive" strategy, and now, in an "eradicate" pretextual stage against COVID-19). He never responded to me, as it was not in his best sinister interests against humanity. Once I realized of his "Digitization" purpose, I eliminated him from my list. Here are the pertinent articles with no comments as for each one open the eyes by himself, he just said yesterday the 11th of May, 2020, on the WSJ, in what I call a "damage control" article, as he is: " digging into the details of vaccine production. “Every day, it’s, OK, are we going to run out of glass vials?” he said. “You may think that’s a simple part of it, but nobody’s ever made 7 billion vaccines”, can you believe his craziness to vaccinate the whole of humanity???", here are his real intentions, from the "mouth of the horse", nothing of this is included in that article, and of course, he is not interested at all in the real origin of the virus because that will just unearth more details as what this was a preplanned Pandemic to advance his "Digitize" agenda, he even brags in that WSJ article of yesterday that the two first places that showed COVID-19 in the US were related to him: Seattle where he launched previously a flu vaccination program, and the second place, 11 miles from his house, can you believe his sheer cynicism????, the other links related with his life-long obsession, that implanting humanity with his specialty, an ID software are here for you to open your eyes (let me save it before I put the links, as many times I have lost my postings by a sudden, causal...., closing of the page; I attach a very important historical fragment by Judy Mikovits, then once I saved, I pursue linking things here): https://www.scientificamerican.com/article/invisible-ink-could-reveal-whether-kids-have-been-vaccinated, https://id2020.org/faq, https://www.gavi.org/operating-model/gavis-partnership-model/bill-melinda-gates-foundation, https://www.windowscentral.com/microsoft-universal-digital-identification-and-you, https://www.biometricupdate.com/201909/id2020-and-partners-launch-program-to-provide-digital-id-with-vaccines, https://patentscope.wipo.int/search/en/detail.jsf?docId=WO2020060606; and three criticisms of his pervert plans to vaccinate humanity to tag it: https://amp.washingtontimes.com/news/2020/apr/11/bill-gates-anthony-fauci-unelected-destroyers-free, https://nationalfile.com/president-trump-vs-bill-gates-on-treatment-fauci-has-a-100-million-conflict-of-interest, https://childrenshealthdefense.org/news/government-corruption/gates-globalist-vaccine-agenda-a-win-win-for-pharma-and-mandatory-vaccination...
1 Recommendation
13th May, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
RaTG13 – the undeniable evidence that the Wuhan coronavirus is man-made
This is an extraordinary article for your consideration: https://nerdhaspower.weebly.com/ratg13-is-fake.html, also in Chinese, and saved at the Archive dot org, just in case the pervert WHO in concoction with the Chinese Communist Party and Gates removes it (Did you know that the WHO does not recognize Taiwan as an independent country in order to cow tow and to cater to China? For those that like history that should be enough to open their eyes and to start really watching to what is gong on, and to put a big stop on that!!!, before it is too late..., for us Christians, is before we are gone from this earth through the Rapture, but we want to take with us to eternity as much as we can...!):
"RaTG13 virus isn’t real. The evidence of its existence, its sequence, was fabricated" (by the intellectual author of the COVID-19 virus: Shi Zhengli).
"It is noteworthy that ZC45 and ZXC21 share ~97% sequence identity, just like that between the Wuhan coronavirus and RaTG13. So, the above comparison is very proper and reliable."
"Who dares to carry out such a deceitful action?"
"...Shi has admitted to several individuals in the field that she does not have a physical copy of this RaTG13 virus. Her lab allegedly collected some bat feces in 2013 and analyzed these samples for possible presence of coronaviruses based on genetic evidence. To put it into plainer words, she has no physical proof for the existence of this RaTG13 virus. She only has its sequence information..."
"Can the sequence of such a virus be fabricated?"
"...Contrary to general conception, such database does not really have a way to validate the authenticity or correctness of the uploaded sequence. It relies completely upon the scientists themselves – upon their honesty and consciences..."
"It is Shi, not anybody else, who is the biggest suspect of this possible crime that is grander than anything else in human history. Given the circumstances, wouldn’t she have a strong enough motive to be deceitful?"
"RaTG13, if truly exists, should never be neglected by Shi for a period of seven years"
"...RaTG13 is highly alarming – it clearly shows a potential of the virus to infect humans..."
"In 2013, Shi made her fame in the coronavirus field by publishing in Nature two bat coronaviruses (Rs3367 and SHC014), which share considerable sequence similarity with SARS in the RBD region (Ge et al. Nature. 2013;503(7477):535-8). This work, for the first time, proved a bat origin of SARS... This group of viruses, with these dazzling features, were perceived by the field as breakthroughs."
"...a very recent publication confirmed that the RBD from RaTG13, like SARS RBD, can indeed bind the human ACE2 receptor (https://www.nature.com/articles/s41586-020-2179-y)."
"As an expert as Shi is, she only needed to take one peek at the sequence of RaTG13’s RBD and immediately realize: this virus closely resembles SARS in its RBD and has a clear potential of infecting humans. If Shi’s public statement is true and she indeed intends to discover bat coronaviruses with a potential to cross-over to humans, how could she possibly overlook this extremely interesting finding of RaTG13? If this RaTG13 was discovered SEVEN years ago in 2013, why did Shi not publish this astonishing finding earlier and yet let the “less-attractive” viruses take the stage? Why did she decide to publish such a sequence only when the current outbreak took place and people started questioning the origin of the Wuhan coronavirus? [Her "smokescreen" statement was mentioned earlier: "As publicly stated, the goal of her research is to identify animal coronaviruses that have the potential of crossing-over to infect humans and thereby help the public avoid SARS-like disasters in the future"]" (So, what a big contradiction between her stated purpose and her behavior by hiding the closest danger to humans!!!!, what a RaT!!!).
"...RaTG13 is a fake virus – it exists on Nature (the journal) but not in nature..."
"A closer look at the gene sequence of RaTG13’s spike reveals clear evidence of human manipulation"
"...on average and under normal conditions, the ratio between the number of synonymous mutations and that of non-synonymous mutations should be around 5:1" [In the artificial sequence, artificially, which means in a forced and abnormal way, this ratio is also, by hand, "achieved"..., EXCEPT for the second key region of spike, S2, where the ratio, indicative of the HUMAN HAND intervening, is of 44:1, whaaat??? Yeah, this is the clear evidence of the small hand of Shi Zhengli modifying the RaTG13 sequence!!!, as it will be seen below (and this not even mentioning the MOST even vital and discrepant sites of S1, as are these three: RBD, Protease cleavage, which is absent in the RaTG13, ad the left region of the RBD where the significantly similar to immunodeficiency sequences are present, which even Shi pointed out that were vital for the infectivity of the virus)].
See now the figure of the graphics with the red, lower, and the green, upper, curves, the sentence reads:
"Figure 3. Comparing the nucleotide sequences of different spike proteins on the synonymous mutations (green curve) and non-synonymous mutations (red curve) reveals evidence of human manipulation", in brief, the reason is that when comparing two natural sequences, natural almost 100 synonymous mutations occur in 1,200 codons; while when comparing the RaTG13 with the virus of COVID-19, the jump is to more than 230 in those 1,200 codons, plus an antinatural plateau of 30 non synonymous mutations starting when 500 codons are compared, in the natural situation, there is not such a plateau. This is how the author explains these anomalies between a natural diverging pair of sequences and an artificialy made in a lab diverging of sequences:
"...you can immediately appreciate is that, in the second half of the sequence, while the green curve continues to grow steadily, the red curve stays flat... For a region as wide as over 700 amino acids (corresponding to 2100 nucleotides), which is statistically substantial, the synchronization between the two curves is non-existent..."!!!
"...between ZC45 and ZXC21[the example of NATURAL VARIATION contrasted with an artificial "variation"], a total of 32 nucleotides have changed and 5 of them lead to amino acid mutations (27 synonymous mutations vs. 5 non-synonymous mutations)... every six nucleotide changes result in the change of one amino acid; synonymous/non-synonymous ratio is about 5:1."
"In contrast, for the same S2 region, between the Wuhan coronavirus and RaTG13, there are a total of 90 nucleotide changes and only two amino acid mutations. Here, every 45 nucleotide changes correspond to one amino acid change. The synonymous/non-synonymous ratio is 44:1"!!!
And about RaTG13 and the virus of COVID-19 Sars-CoV-2?, I clearly see that "neither of them came from nature"!!!
The author asks:
"How could Zhengli Shi fail so badly in fabricating the RaTG13 sequence?... It is hard to be a cheater after all"!!!! Heheee!!! I completely agree, and remember that I busted another team of Chinese cheaters that had been cheating during 10 years working in an "artifact" based on the EcoRI Restriction Enzyme linker, contaminating thousands of Genbank sequences!!!
"A deeper reason that Shi and the CCP needs the cover of RaTG13"
"...discredit any scientific publication, which BASED its analysis on the RaTG13 sequence and subsequently ARRIVED at the conclusion that the Wuhan coronavirus is of NATURAL origin"!!!
"When you do a clean-up like that, you will see that there is practically nothing left"!!!
"Next, we can look back to see what other coronaviruses are close to the Wuhan coronavirus in terms of sequence similarity. It turns out the two bat viruses featured in Figure 3A (the same one mentioned earlier of the green/red contrast for a more natural variation, but with the CCP, you will never fully trust in their submitted sequences that are not peer-evaluated by nobody else: "ZC45 and ZXC21 are bat coronaviruses discovered, collected, and published by a military research lab of the Chinese Communist Party (CCP)" (Hu et al. Emerg Microbes Infect. 2018;7(1):154)), ZC45 and ZXC21, are the next hits, each sharing 95% amino acid sequence identity (~89% nucleotide identity) with the Wuhan coronavirus. What is striking is the manner that the Wuhan coronavirus resembles these two bat coronaviruses – while every other protein remains highly identical, the S1 part of Spike, which dictates host selection, is only 69% identical. I have posted an article earlier: https://nerdhaspower.weebly.com/ (WOOOOW!!!), where I thoroughly analyzed this pattern and discussed how it is interlocked with the Wuhan coronavirus being a bioweapon made with ZC45 or ZXC21 as a template."
"I would like to add an additional piece of evidence, which was brought up in a comment of my earlier article by someone who is clearly an expert":
""The E protein of β coronaviruses is a structural protein that is tolerant of mutations as evidenced both in SARS and in bat coronaviruses. However, on the amino acid level, E protein of the Wuhan coronavirus identified at the beginning of the outbreak is 100% identical to those of the suspected templates, ZC45 and ZXC21 (Figure 4). What is striking is that, after a short two-months spread of the virus in humans, the E protein is already mutating. Sequence data obtained within the month of April indicate that mutations have occurred to four different locations (Figure 4). Note that the E protein makes very limited interactions with host proteins and thus is not under evolutionary pressure to adapt to a new host. Not only the E protein can tolerate mutations but also its mutational rate is held constant across different coronavirus species. The fact that the E protein of the Wuhan coronaviruses is already mutating in the short period of human-to-human transmission is consistent with its evolutionary feature. In stark contrast, while ZC45/ZXC21 and the Wuhan coronavirus are more distant evolutionarily, the E proteins within them are 100% identical. In no way this could be a result of natural evolution."" WOOOOAH!!!
"The most plausible explanation: the Wuhan coronavirus is a bioweapon made using ZC45/ZXC21 as a template"
"Figure 4. Alignment of E proteins of bat and human coronaviruses shatters the notion that the Wuhan coronavirus came from nature. While the early copies of Wuhan coronavirus share 100% identity of the E protein with ZC45, ZXC21, and RaTG13, sequence data of most recent Wuhan coronaviruses indicates that mutation has been observed in four different locations. Accession numbers of viruses (not including the ones listed in Figure 3): Feb_11: MN997409, April_9: MT300186, Apr_13: MT326139, Apr_15_A: MT263389, Apr_15_B: MT293206, Apr_17: MT350246." WOOOOAH AGAIN!!!
"Added on May 10th, 2020: Following the suggestion given by Viennah K. Erchus, additional information is added here to illustrate how E proteins are tolerant of mutations. As shown in Figure 5, mutations and insertion/deletions in E proteins have been observed at multiple locations both in SARS coronaviruses and in bat coronaviruses. This clearly indicates E protein’s tendency and permissiveness toward mutations across β coronavirus species. What is inconsistent with this trait is the fact that ZC45/ZXC21 and the Wuhan coronavirus, while significantly distant from each other in evolution, share 100% identity in E proteins. Again, in no way this could be a result of natural evolution. This further supports the claim that the Wuhan coronavirus is made in a lab by following ZC45/ZXC21 as a template." [Thank you very much, oh good mother V. K. E.!!!, you also prepared the ready-for-analysis sequences!!!, thank you with all the very bottom of my tibetan monk..., surely yours, he says, the H. H. (Q)].
"I believe dearly that the persons behind these names are the most decent and brilliant kind": Elannor D. Allens, Champion's Daddy, John F. Signus, VKE...
PLEASE DEAR READER, IF YOU STILL VALUE YOUR FREEDOM DO YOUR BEST TO SPREAD THE KNOWLEDGE THAT THE COVID-19 PANDEMIA HAS AN ARTIFICIAL ORIGIN, WHICH LEADS US TO THINK THAT THE WHOLE THING WAS ENGINEERED BY CRIMINAL MINDS THAT NEED TO BE HELD RESPONSIBLE AS SOON AS POSSIBLE!!! Amen.
1 Recommendation
14th May, 2020
Fernando Castro-Chavez
Former PostDoc at Baylor College of Medicine & New York Medical College
LQPRTFLLKYNENGTITDAVD is an irrefutable immunosuppressive long strand of amino acids present in the Sars-CoV-2 (agent of COVID-19) portion within the S1 par of Spike; and according to the experts, the key sequence is LQxR (where x can be another amino acid), the same authors also talk about other portions most possibly being present within the S1 region also causing immunosuppression to make more pernicious the attack of the current virus, for example, they say that a short domain such as the one that we see of GT, as in GTxR, which is what we have here in our current analysis: NGTKR, which also can be immunosuppressive, which is just showing that the COVID-19 virus was carefully selected to have multiple immunosuppressive segments in the S1 portion of the protein Spike!!! (other important immunosuppressive features within the long sequence posted at the beginning are, of course: GTxT, which is highly similar to the one that we are discussing here, as well as the KY portion that also can be RY, so, within the longer immunosuppressive region at the top, we have contained an immunosuppressive region similar to the one that we are discussing here: NGTKR versus NGTIT) The authors also demonstrate other regions that are more peculiar to the Sars-CoV-2, due to also being rich in "G", a feature which: "show them to have a high overall turn propensity, indicating they are probably extensions in Wuhan (the way the authors call the Sars-CoV-2), to turns between beta sheets": GTNGTKR (my region under consideration, a turning or revolving immunosuppressive door, due to the "G" that precedes it, connecting two beta sheets), SYLTPG, GDSSSG (all of them, possible revolving doors, also possible immunosuppressors, and the ones that contain S, are also..., especially for the last one: "S residues calculated to be likely sites of O-glycosylation...")...
Other fragments of their interesting discussion regarding potential immunosuppressive domains present in the S1 portion of Spike are as follows:
"Close re-examination of the Wuhan nCoV2019 (Sars-CoV-2) sequence reveals a feature not seen anywhere in the SARS S1/S2 sequence but common to a number of other Class I Viral Fusion/Entry proteins, namely, a potential immunosuppressive domain (Cianciolo et al. 1985; Morozov et al. 2012)."
Cianciolo GJ, Copeland TD, Oroszlan S, Snyderman R. 1985. Inhibition of lymphocyte proliferation by a synthetic peptide homologous to retroviral envelope proteins. Science. 230:453-5.
Morosov VA, Morozov AV, Sernaan, M, Denner. J. 2012. Single mutations in the transmembrane envelope protein abrogate the immunosuppressive property of HIV-1. Retrovirology 9:67.
"We mentioned this feature earlier, in our discussion of Syncytin-1 and Syncytin-2 expressed during pregnancy from the human genome (have also a natural immunosuppressive effect, being expressed in the pregnant woman in order for her not to expel the upcoming child!!! WOOOW!!! The sense of wonder of the perfection and beauty of God's Creation leaves me breathless, speechless,,,)."
"An alignment of this region of S1 with several known immunosuppressive domains, is shown in (the figure posted above)"
All of this is taken from the amazing book called the Wuhan Virus, by the Gallaher team of a father and his son (pp. 39-40).
The image also presents other viruses or regions of the human genome able to cause immunosuppression!!!:
EBOV76, Ebola Mayinga 1976;
MPMV, Mason-Pfizer monkey virus;
Syn 1, Syncytin-1 from the HERV-W "endogenous retroviral-like sequence" on chromosome 7 of the human genome;
HIV-1, human immunodeficiency virus, BH10;
Wuhan, nCoV2019: Sars-CoV-2, the agent of COVID-19.
I am humbled to my knees for all of you that are reading this and making it your own, to end as soon as possible with this enginered madness with the help of all of you!!!