Question
Asked 19th Aug, 2012
Deleted profile

Poor transformation, which points are critical?

I want to transfect genes after ligation of 4 subloning gene. I have done PCR on genes, affect restriction enzyme on PCR products and vectors, cleaned up and then ligation using T4 ligase. I tried transfect the genes to TOP10 CaCl2 competent cells but I got noting (No colony on AMP+ plate)
Protocol for competent was:
Overnight culture of TOP10 stock in 10 ml LB, then 80 microliter of culture to 6 ml LB for 8 hr,, then centrifuge 8000 g 5 min, resuspend, add 1 ml CaCl2 (0.1 M) cold, 30 min on ice, centrifuge 8000 g 3 min, discard supernatant, 0.670 ml CaCl2 (0.1 M), 30 min on ice, centrifuge 8000 g 3 min, discard supernatant, 0.330 ml CaCl2 (0.1 M), resuspend
Protocol for transform:
8 microliter of ligation + 50 microliter TOP10 competent, mix, 30 min on ice, 2 min on 42 C (thermoblock), then 1o min on ice, then added 1 ml LB with out antibiotic in 37 C, then centrifuge 8000 g for 5 min and then discard 800 microliter of supernatant and transfer of resuspend to LB agar + 100 microgram/ml ampicilin and incubate for 24 hr
And I got nothing
In the protocols which points are critical?
Is there any beter protocol?
Can I transfect by electroporation? How it works? There is a deteailed protocol?
(using ependorf electroporator)
Thank you

Most recent answer

25th Nov, 2019
Umar Abdulmutalib
Yusuf Maitama Sule University
The heat shock duration might be longer than usual, 45 seconds has been quite useful in my transformations using efficient competent cells.

Popular Answers (1)

19th Aug, 2012
Stephen R. Doyle
Wellcome Sanger Institute
There a couple of problems with your protocol actually.
1. Less volume of ligation mix often works better - I set up my ligations to contain 50ng/ul plasmid with appropriate amount of insert, so that in the tansformation, using 1-2ul ligation, mix will contain 50-100ng of plasmid (which is heaps)
2. Heat shock temp and time is really critical - I think you are doing it for too long. My cells work fine at 90 seconds (according to Sambrook Molecular Cloning), however some work better at 60 or even 30 seconds. You are putting a lot of stress on the cells here at 2 mins
3. After heat shock, put them on ice for 2-3 mins, followed by 45 mins at 37C in a shaking incubator. This is very important to allow both the E.coli to recover from the heat shock, and to allow them to start to express the antibiotic resistance genes (ampicillin). This should not be too much longer than 45mins as you do not want them to divide, but just recover.
4. After plating the cells out, you should only need to incubate for 16-18h or so at 37C. Too long an incubation with ampicillin and you will get satellite colonies. Not good.
More of a final comment about competent cells - they can be difficult to make and therefore challenging to make really competent. Make sure you keep them on ice and 4C centrifuge if you can. You want to be as gentle as possible with them - NO pipetting to resuspend, I would not even vortex - just make an ice slurry and swirl/gentle shake them to resuspend. 8000g is pretty heavy-handed and 4000g for 5 mins would work fine. I would certainly be including a positive transformation control too just to make sure your competent cells are working fine. Just find any plasmid that contains AmpR and transform it alongside your ligations.
Good luck and make sure you keep us updated!
Cheers,
Steve
34 Recommendations

All Answers (14)

19th Aug, 2012
Manoj Balakrishna Menon
Indian Institute of Technology Delhi
Dear Saeed,
first of all u are talking about transformation of bacteria ( and not transfection, which normally refers to eukaryotic cell culture DNA transfer). Your protocol seems OK, except 10min after heatshock could be cut short to 1-2 min and you should allow the bacteria to recover in LB/SOC medium without antibiotics for upto1h at 37degrees, before going for spinning down and plating it. If still u do not get any colonies, please give details of ur cloning procedure (restriction sites, blunt/sticky, directional etc etc) before going for alternatives.
Good Luck
1 Recommendation
19th Aug, 2012
Stephen R. Doyle
Wellcome Sanger Institute
There a couple of problems with your protocol actually.
1. Less volume of ligation mix often works better - I set up my ligations to contain 50ng/ul plasmid with appropriate amount of insert, so that in the tansformation, using 1-2ul ligation, mix will contain 50-100ng of plasmid (which is heaps)
2. Heat shock temp and time is really critical - I think you are doing it for too long. My cells work fine at 90 seconds (according to Sambrook Molecular Cloning), however some work better at 60 or even 30 seconds. You are putting a lot of stress on the cells here at 2 mins
3. After heat shock, put them on ice for 2-3 mins, followed by 45 mins at 37C in a shaking incubator. This is very important to allow both the E.coli to recover from the heat shock, and to allow them to start to express the antibiotic resistance genes (ampicillin). This should not be too much longer than 45mins as you do not want them to divide, but just recover.
4. After plating the cells out, you should only need to incubate for 16-18h or so at 37C. Too long an incubation with ampicillin and you will get satellite colonies. Not good.
More of a final comment about competent cells - they can be difficult to make and therefore challenging to make really competent. Make sure you keep them on ice and 4C centrifuge if you can. You want to be as gentle as possible with them - NO pipetting to resuspend, I would not even vortex - just make an ice slurry and swirl/gentle shake them to resuspend. 8000g is pretty heavy-handed and 4000g for 5 mins would work fine. I would certainly be including a positive transformation control too just to make sure your competent cells are working fine. Just find any plasmid that contains AmpR and transform it alongside your ligations.
Good luck and make sure you keep us updated!
Cheers,
Steve
34 Recommendations
20th Aug, 2012
Phoebe Stavride
Foundation for Research and Technology - Hellas
Everything the previous posters said is correct. You absolutely need to include a control to know if the problem is with your competent cells/transformation, or with your cloning the DNA. In case it's your cloning, a number of things could have gone wrong. One of them is that you didn't include extra nucleotides at the end of your primers. Enzymes need at least one nucleotide next to their recognition sequence in order to cut, and often they need more. There's a table in enzyme companies' catalogues, like NEB, or their website, so check this. If that's the case and your inserts are small, you could try blunt cloning and have better luck - but there's a lot of things that could be wrong.
What I propose to you, is forget about your ligation for a day, and make a batch of competent cells. Leave some aliquots aside for testing and put the rest in the -80 freezer. You need to test a couple of things. Find a plasmid that has the correct antibiotic resistance (the same as the one your cloning vector does), make a couple of dilutions and use it to transform, and see what you get . Using a couple of dilutions will allow you to see just how competent your "competent" cells are. If you are using 50 ng of vector in a ligation , it's reasonable that you need cells that will give lots of colonies with 50 ng of vector, because it's actually less than that that in your ligation, right? If your cells aren't that competent, it's still possible that you will get colonies with more DNA, so you'll know to leave them in CaCl2 more, for example. At the same time, do a mock transformation to make sure that your bacteria won't be able to grow in that antibiotic by themselves.
After you have a batch of verified competent cells, and if your ligation still doesn't give colonies, we can discuss your cloning process itself. Good luck!
6 Recommendations
21st Aug, 2012
Tomáš Hluska
Nagoya University
as Stephen Doyle said, decrease amount of ligationsample (I usually go with 1-2 ul); the heat-shock is too long, usually 45-60 seconds should work well (check the temperature to be sure it's really 42°C, not more, not less), immediately add the SOC medium and keep at 37°C for some time.
21st Aug, 2012
Peera Hemarajata
County of Los Angeles
I agree with most of the above comments, but there are some points I'd like to add:
1. I personally hate the CaCl2 prep for chemicomp cells. They are ok for plasmid propagation but I like my cells to be more competent for cloning. Look up rubidium chloride prep and try it. The competence of cells from this prep rivals that of TOP10 that Invitrogen sells.
2. I'd never try to spin down my transformed cells. Despite the 1 hour of recovery the cells are still fragile. Even vigorous shaking during recovery can easily lyse and kill the cells. If you want your cell suspension to be more concentrated, recover in a less amount of SOC, such as 500 ul.
3. You don't really need to recover the cells if you are selecting with ampicillin or carbenicillin (which I prefer over amp because of better stability at 4c). These drugs do not kill the cells right away. All you need to do is to make sure your plates are nice and warm by the time you are done with heat shocking. After you put the cells back on ice for a couple of minutes you can plate on warm plates right away without having to recover. If you don't believe me, check out the manual for Invitrogen's TOP10 cells and you'll see. However if you are selecting using other antibiotics (kanamycin, erythro, chloramphenicol, etc) you NEED to recover the cells as usual.
4. The culprit may lie at your cloning strategy. Once you are sure that your cells are competent enough you might need to troubleshoot the cloning, which is a totally different beast altogether.
5. You can try electroporation. The competent cells are made differently, and you may need to treat your ligation (using dialysis or column purification) to get rid of the salts in the ligation buffer (unless you want to fry all of your cells when you electroporate).
5 Recommendations
22nd Aug, 2012
Mohan Harikrishnan
Louisiana State University
Hi Saeed in your question you did not mentioned the protocol you are following for setting up your ligation reaction. I can add some comments on the ligation protocol. You can try with equimolar concentrations of DNA of interest and vector + 1 ul of T4 dna ligase and keep overnight at 16-22 deg cel or try 1:3 ration of vector and insert concentration. For transformation try heat shock at 42 deg c for 90 sec and snap cool immd in ice for 5 mins. Also you can harvest the cells at 3000 rpm for 5 mins.
Deleted profile
Thank you all for your responses
I have read the comments and followed them in details
I repeated the protocols using mentioned comments and I got so many colons
As:
Don’t wortexing
100 ng vector for ligation
90 s 42C
Check for exact 42 C
5 min ice after 42 C
45 min 37 C
Positive control (as intact vector) was positive
Competent on Amp+ was not growth
Competent on Amp- was growth
The yield was good
Thank you
But !
I have done colony PCR on 20 colon of my subcloned genes
But for all PCR was negative
It may be just vector ? or be problem in ligation step !
Now I want to repeat the protocols
Please let me know the critical points in these steps
My RE are BamHI/SmaI and for a gene BamHI/BamHI
MCS for these REs is
cgcgggcccgggatccgcccct
single digest on vector 37 C for 16 hr is complete digestion for each RE (with common buffer)
may their overlap stop working?
If SmaI work first BamHI have intact site with 1 extra nucleotide
may it is better I digest first by SmaI and then after X hr add BamHI?
For pirmeres there is 3 extra nucleotide after RE sites (9 overhang)
PCR products are single band
Vector is 11000 bp
Genes about 950 bp
Then run in electrophoresis and extract the bunds using gel extract kit
Digested Vector and PCR product had sharp band in electrophoresis after gel extract
My ligation protocol is:
12 microliter DDW,,, 2 microliter 10XB,, 1 microliter T4 ligase,, and two ratio of Inset/Vector (I/V=4/1 and 5/2)
Then incubate for 1 hr in 22 C thermal cycler and then overnight in 4C
Then transformation
Which point may be wrong or didn’t work?
I repeat all process or ligation step only?
What the points are for improve ligation yield?
After ligation electrophoresis may help to evaluate how ligation worked?
I also attached single digestion of vector using BamHI and SmaI
Thank you
2 Recommendations
25th Aug, 2012
Peera Hemarajata
County of Los Angeles
Try to ligate at 16c overnight in a thermocycler. People sometimes do 1-2 hour at room temp or use the 5-min Quick Ligase, but those don't work all the time. For difficult ligations you will need to do 16c overnight.
2 Recommendations
25th Aug, 2012
Mohan Harikrishnan
Louisiana State University
Hi You can see the attached file for trouble shooting your problem. Since the size of your vector and Insert are almost of same size you can try with 1:1 ratio of vector:insert and as mentioned above keep @ 16 deg cel overnight in thermal cycler. Are you digesting your PCR product also with BamH1 and Sma1 if not you can try digesting your PCR product and then column purification before ligation. This might increase your ligation efficiency.
18th May, 2017
Søren Lindskog
University of Copenhagen
Regarding your digest with SmaI + BamHI; I'm pretty sure that's your problem!
Normally I would choose RE's in the MCS that had at least 12 nt spacing
try to look at NEB's webpage and search for near end cutting (BamHI will cut with 0-20% eff. if only one nt!)
So your sugestion with SmaI first and then BamHI is a valid one ;o)
But since SmaI is a Blunt end enzym, why don't you see if you have another blunt end enzym in your vector MCS
And regarding Vector Insert ratio (and amount of DNA) try 1:1, 1:3 and 1:10 (using 50ng of vector with (1:1) 4ng insert, (1:3) 12ng insert and (1:10) 40ng insert
31st May, 2017
Attha Tallat
University of Gujrat
All of the people... can you please guide me as well as  aquestion from the query aove..she gave heat shock in thermopole stand or thermoblock..
I also did a mistake .i gave heat shock by fixing the ependorfs in a thermopole sheet stand...would it effect the heat shock method.....??
2 Recommendations
28th Nov, 2018
M. A. A. Al- Fatlawi
University of Al-Qadisiyah
Following
regards

Similar questions and discussions

Related Publications

Got a technical question?
Get high-quality answers from experts.