Is anyone measuring phosphonatase activity in soil?

"Crazy roots" pathogen, Agrobacterium bv1 with Ri plasmid, change plant roots geotropism. Any idea how the pathogen makes it?

I want to know if I want to apply the metagenomics test routinely to my soil throughout planting cycles to diagnose and predict harmful pathogens that might affect crop health and overall yield. How often should I take a soil sample?

I wish to treat the Arabidopsis cell suspension culture with GA3 to study the effect of GA3 on the expression of a gene involved in cell division.

Does anybody know the appropriate concentration of Gibberellin (GA3) that should be used to treat the Arabidopsis cell suspension culture?

#gibberellin #arabidopsis

In bee pathogen diagnostics, we often use different sets of primers to identify pathogens in bee guts.

One of the primer sets we have been using a while in PCR, we are now using to quantify pathogen loads via qPCR.

However, we discovered that a frequently used primer set, published years ago and used frequently in different papers, is showing a strange curve. It amplifies a fragment of the 18S rRNA gene, of Microsporidian pathogens belonging to the genus Nosema.

We tried different conditions and concentrations, but the curves stay the same.

In addition is a BioRad data file with the standard curves, and a picture for those who cannot open these types of files.

Efficiency is always low when using these primers, while R² is high, so we think it is due to the weird curves.

Does anyone know what could be the reason for the amplification curves?

Or the reason of the low efficiency?

Thanks!

More info:

Primer info:

Forward = Nosema universal, edited by Fernandez 2012, originally from Higes 2006 (TATGCCGACGATGTGATATG)

Reverse = Nosema universal, from Higes 2006 (CACAGCATCCATTGAAAACG)

qPCR Program:

2 min at 95°C, 39 times: 15 sec at 95°C, 30 sec at 56°C, 45 sec at 72°C

Fernández, J. M. et al. (2012) ‘Asymptomatic presence of Nosema spp. in Spanish commercial apiaries’, Journal of invertebrate pathology. J Invertebr Pathol, 111(2), pp. 106–110. doi: 10.1016/J.JIP.2012.06.008.

Higes, M., Martín, R. and Meana, A. (2006) ‘Nosema ceranae, a new microsporidian parasite in honeybees in Europe’, Journal of Invertebrate Pathology. Academic Press, 92(2), pp. 93–95. doi: 10.1016/J.JIP.2006.02.005.

So, i've added 2uL of chlorpyrifos in my culture of RT-Gill cells that were in L15 medium. The first thing that concerned me, was that it inmediatly reacted forming some tiny bubbles, like when you open a bottle of soda. Also, the color of the medium changed from colorless to redish. (See the first photo, "T" are the ones with chlorpyrifos, and "C" my control). I inmediatly thought that my cells died, but they looked fine (i think) when i saw them under a microscope. 48Hrs later, i came back to see the medium and do a protein extraction, so i took the medium but ones with chlorpyrifos left a jelly thing in the bottom (like solidified silicone), and took a bit by scraping it (see the last photo).

I honestly have no idea what caused this reaction.

I am using DOTAP liposomal transfection reagent (Roche) to form lipoloxes with miRNA mimics. I used different N/P charge ratios and ran the samples on a 1.5% agarose gel with SYBRSafe. I detected an intense band for free RNA, no band for free DOTAP. While the band intensity for 1:4, 1:6 and 1:8 ratios was less intense:

1) It was still very intense.

2) I did not see a band at the top of the well for encapsulated RNA unlike publications.

What should I observe? What does this mean? How do I proceed?

Could you also provide the solubility of DIMP in water? I found some contradictory informations.

I would like also to know the solubility of dimethyl methylphosphonate (DMMP) and diethyl methyl phosphonate (DEMP) in methanol. Thanks!

Hi everyone! Currently, I am trying to synthesize an aromatic phosphonate containing a alkoxysilyl group (CAS: 91938-04-4) by performing the corresponding Arbuzov-Reaction with 5 mol% NiBr₂ as catalyst.

The ¹H and ³¹P-NMR spectra of the crude product strongly suggest the formation of my desired compound in moderate high yields. However, I have struggled to purify the crude product. A lengthy distillation using a Kugelrohr under reduced pressure at ~ 100 °C and 1x10^-2 mbar in the presence of the nickel catalyst seemed to lead to a follow-up of various side reactions and is degrading the desired compound. Therefore I tried to remove the nickel catalyst first. A (flash) column chromatography with silica and various Al₂O₃ seemed to fail, naturally because the alkoxysilyl groups stick strongly to the column and are being degraded as well. Therefore, what is a suited method of removing the nickel catalyst under mild conditions without degrading my product?

Hi to anyone who works a lot with RNA. I'm planning on doing a lot of RNA work and horizontal gel electrophoresis using EMSA (gel retardation assay) to understand peptide/siRNA complexes.

Any tips on keeping the electrophoretic equipment RNase free.

Thank you