Do I also get plasmids in my gDNA extraction?

I'm looking for a valid source that confirm or reject this issue; for commercial PCR kits it's better to set a ready-to-use master mix or content-made master.

Primers and Taq enzyme can decrease master mix efficacy or stability or not.

Hello,

I am currently working on a cloning a 6 kb insert into 14 kb vector by Gibson Assembly. Following heat shock transformation into chemically competent TOP10 cells, I had multiple positive colonies as identified by colony PCR (1 vector-specific + 1 insert-specific primer).

However, following miniprep all colonies were found to contain the original 16 kb vector (all plasmids were run on a gel as a 6 kb insert difference should be easily distinguishable from the 14 kb vector + two colonies were sequenced by whole plasmid sequencing to verify). All fragments are amplified by PCR, and I use DpnI digest + small template amounts (1 ng) to minimize template carryover. I also use a blank plate which substitutes the insert for an equal volume of water. The blank plate had only two colonies compared to 12 on the transformation plate. This cloning procedure has also worked successfully for me in the past with smaller fragments (<15 kb total construct size).

I am suspecting that the cells were unable to take up the 20 kb plasmid, and colony PCR was detecting the successful Gibson construct which was spread on the plate during transformation. I emailed ThermoFisher and they said 20 kb in TOP10 by heat shock should be fine, but I am wondering if anyone else can share their experiences. If chemically competent TOP10 is not feasible, should I think about electroporation or using an alternative strain?

Hello,

I'm interested in optimizing the cost-efficiency of the purification of PCR products from macro fungi for Sanger sequencing using Exo+Sap mixture.

My Exo+Sap product protocol suggests using 2 ul of undiluted Exo+Sap mixture for 4 ul of PCR product. Could I do 1:5 or 1:10 dilutions of my stock Exo+Sap?

If so, what would be the correct proportion of diluted Exo+Sap mixture to PCR product?

Hi,

I extracted the plasmid manually and measured a concentration of 12,000 using the Nanodrop. However, nothing shows up on the gel electrophoresis.

Are there any specific techniques or tips I should follow during the extraction process? I’d really appreciate your guidance.

Thanks a lot🙏🏻

while conducting a research with a small sample size (5-6) with a large exome size (21-25), should you go for Sanger sequencing or NGS? Keeping cost, labour and practicality in context.

I am now preparing a DNA chain with sticky ends, one side of which is a 4nt sticky end and the other side is a 35nt sticky end. It is prepared by primer return and is divided into four groups: 1.CAGATTGCGGACCCACAGTCGAGTTCTGGAGAATCCCGGTGCCGAGGCCGCTC CTGTGAGCGGCCTCGGCACCGGGATTCTCC 2.ATCATGCTGACGTATTCTGTATCCTACGGAGTATCCCGGTGCCGAGGCCGCTC

CTCCGAGCGGCCTCGGCACCGGGATACTCC

3.ATCATGCTGACGTATTCTGTATCCTACAGGATGTATATATGTGACACGTGCCT

CTCCAGGCACGTGTCACATATATACATCCT

4.AGGTGCTGAAGCAGGTCCACCCCGACACCGGCATCTCGTCCAAGGCCATGGGC TGATGCCCATGGCCTTGGACGAGATGCCGG

However, after annealing the four sets of primers and performing PAGE electrophoresis (9% TBE), it was found that the band positions of the three were different. Why is this?

We use phenol-chloroform method to extract DNA from peanut leaves. The protocol is as followed:

- Grind peanut leaves in 1% SDS in Tris buffer, incubate at 60 oC for 5 mins. Centrifuge.

- Pour supernatant into a mixture of phenol : chloroform : isoamy alcohol (25:24:1). Gently shake. Centrifuge.

- Carefully move upper layer into isopropanol. Incubate at -20 oC for 30 mins. Centrifuge.

- Wash the pellet with ethanol 70%. Centrifuge.

We failed to remove the pigment from the DNA with this protocol. The resulted DNA pellet was dark green.

We have tried using CTAB, adding activated charcoal, B-Mecaptoethanol, repeat the phenol : chloroform step twice. None worked.

Has anyone had experience with extracting DNA from peanut leaves? Can you give us some suggestion how to deal with the color?

I was doing the clone for a 5kb CDS in pJET1.2 vector now. There are the colonies in the medium while when I selected some colonies for PCR amplification (a small fragment in the full length CDS) it's always failed, could someone offer me some advices or discuss a little bit the potential problem ? Really thank you

Hello,

I'm trying to clone some short genes *up* to 350 bp into an expression vector the clasiccal way. For this, I do PCR with Q5 and get (mostly) nice band. I cut it from the gel and purify using Macherey-Nagel kit.

I digest this DNA with BamHI and either HindIII or PstI. The first time I aimed at 2 ug, the second time I simply digested all DNA. I run the digested DNA on gel again and purify with the kit again.

After this I get low concentration (5-40 ng/ul) and often poor purity (A260/A230) way below 1.8 (I attached a picture of one such sample, where I had actually peak at 230 nm; that's one extreme). The concentration of plasmid is repeatadly in the range 6-10 ng/ul (it's 5.5 kbp).

Any idea, what could be the problem? In other projects, I usually have sufficient purity and reasonable yield after gel-purification.

Thank you