Journal of Applied Phycology

Published by Springer Nature
Online ISSN: 1573-5176
Learn more about this page
Recent publications
Article
  • Quynh Thi Nhu BuiQuynh Thi Nhu Bui
  • Han-Sol KimHan-Sol Kim
  • Jang-Seu KiJang-Seu Ki
Salinity is an important factor in the physiological regulation of algae; however, its influence on the genomic responses in toxic dinoflagellates is insufficiently understood. In the present study, we evaluated the effect of salinity stress on the physiology, photosynthesis, and molecular responses of the toxic dinoflagellate Alexandrium pacificum (group IV). When exposed cells to different salinities of 20–40 psu, we detected the lowest cell density (3.25 × 10³ cells mL⁻¹) and highest cell size (30.6 µm) at 20 psu. Photosynthesis efficiency considerably decreased at 20 and 40 psu compared to the control (33 psu). Quantitative real-time polymerase chain reaction revealed that psbA, psbD, and atpC expression levels were significantly downregulated under conditions of salinity stress for 72 h. In contrast, the expression levels of antioxidant genes MnSOD and GPx were greatly upregulated at 20 psu (13.2- and 15.2-fold changes at 6 h; 8.8- and 8.3-fold changes at 24 h, respectively). The expression levels of other antioxidant genes, CuZnSOD, GST, and APx, increased steadily over time under salinity stress. Such conditions increased the relative levels of reactive oxygen species by 2.2-fold in 6 h and 2.4-fold in 24 h at 20 psu. These results suggest that low salinity may cause cellular oxidative stress, leading to a decrease in photosynthesis and affecting specific antioxidant systems in toxic dinoflagellates.
 
Article
Gracilaria dura, a source of high-quality agarose, has emerged as the preferred choice for commercial aquaculture in India. Still, scanty distribution and seasonal occurrence are two impediments for the availability of planting material to the seaweed enterprise. The experiments were conducted to select the appropriate size of explant, and stock density, followed by pre-treatment of bio-effectors, namely, growth regulators and seaweed extract individually and in conjugation, based on survival and regeneration. The viable explant size was 0.25 cm, while the effective seedling weight to culture media ratio was 1: 200 g mL-1 with respective to survival. The prospects of regeneration as well as survival differed by various treatments. The maximum regeneration of 88.43 ± 7.98% was under the combination of BAP 0.25 mg L-1 for 60 min: 1 g L-1 commercial seaweed extract for 60 min: KIN 0.25 mg L-1 for 30 min (statistically significant). Thereby making the treatment of two different cytokinins in conjugation with commercial seaweed extract more potent than the individual effect. The study substantially contributes to developing a protocol for a sustainable supply of planting material for this industrially important seaweed. The economic evaluation under scaled-up operations is essential to verify the efficacy of suggested treatments for standardization of nursery rearing aimed at mass production. The comprehensive understanding of the science behind the combined action of plant growth regulators and commercial seaweed extract on survival and regeneration still remained elusive. The studies on how combined effect modulates vital biological processes at biochemical and molecular levels should be undertaken for better application prospects.
 
Bayesian tree of Kappaphycus and Eucheuma based on the concatenated cox2–3 spacer–cox1 dataset. Number at nodes indicates ultrafast ML bootstrap support and Bayesian posterior probabilities. The colours green, blue and red are used to represent the haplotypes of K. striatus, K. malesianus and E. denticulatum, respectively. Samples were presented according to haplotypes and new haplotypes identified in the present study are in bold. Letters in square brackets indicate locality of origin: Id = Indonesia, My = Malaysia, Pp = Philippines, Vt = Vietnam
Haplotype networks of Kappaphycus and Eucheuma denticulatum based on the concatenated dataset. Coloured codes indicate haplotypes of specimens collected in this study, while codes in black indicate haplotypes from previous studies (see Table S1). The size of each haplotype circle corresponds to its number of component samples. New haplotypes are in bold. Each line represents a point mutation (a step), whereas black circles indicate hypothetical haplotypes. Grey boxes indicate currently recognized species boundaries based on genetic data
Map showing location of sampling sites and number of specimens collected in the present study: Pulau Salakan (n = 13), Pulau Omadal (n = 70), Palang-palang (n = 9), Pulau Karindingan (n = 14), Singgah Mata (n = 9) and Pulau Sebangkat (n = 80). Also shown are the species and concatenated haplotype diversity of various eucheumatoids indicated by colour. Each code indicates a haplotype. Colouration: green = Kappaphycus striatus; blue = K. malesianus; red = Eucheuma denticulatum; orange = Mimica arnoldii
Gross morphology of selected wild Kappaphycus malesianus identified as new concatenated haplotypes in the present study. a = OMD1; b = OMD43; c = PLW1; d = SBK1; e = SBK18; f = SBK21; g = SBK31; h = SBK33; i = SGM5; j = SGM7; k = SLK7. Arrow indicates damage by grazing. Asterisks indicate cystocarpic specimens. Scale bar = 2 cm
Gross morphology of selected wild Kappaphycus striatus (except SBK11), E. denticulatum and Mimica arnoldii identified as new concatenated haplotypes in the present study. a–f = K. striatus; g = E. denticulatum; h = M. arnoldii. a = OMD4; b = OMD54; c = OMD62; d = SBK8; e = SBK12; f = SBK11; g = PLW3; h = KRD11. Arrow indicates epiphyte infection. Asterisks indicate cystocarpic specimens. Scale bar = 2 cm
Article
The region of Eastern Sabah, Malaysia, harbours a rich diversity of eucheumatoid (i.e. Kappaphycus and Eucheuma spp.) algae. The global cultivation of this group of red algae has generally been increasing over the last five decades to respond to worldwide demand in carrageenans. Yet, the industry relies on a handful of clonally propagated individuals; hence the diverse populations of eucheumatoids in Eastern Sabah, Malaysia are widely regarded as potential source of novel germplasm useful for marker-assisted breeding. Based on an unprecedented depth of sampling of previously surveyed areas, this study was undertaken to determine the specific and intraspecific diversity of wild eucheumatoids in the Eastern Sabah region. Six eucheumatoid populations were haphazardly sampled, yielding 195 specimens. Using our previously established methods, the cox2–3 spacer (332 bp) and cox1 (1,407 bp) genetic markers were sequenced and analysed. Our data confirm that eucheumatoids in this area are extremely diverse: four eucheumatoid species in total were encountered and up to three different species coexist in each location surveyed; across all species, 17 novel haplotypes were uncovered. Importantly, we also found that the populations at the six sites investigated were highly differentiated, suggesting that nearby islands may also harbour distinct populations and more unknown haplotypes. Our findings also identified several cox2–3 spacer farmed haplotypes of K. alvarezii (haplotype 3, SWAG) and K. striatus (haplotype 89), suggesting that escapees from farms reproduce in the wild and may potentially compete with the indigenous eucheumatoid population in East Malaysia. These results highlight a need to extend genetic surveys to other islands for discovering novel diversity and to extend the coverage of conservation policies. They also stress the importance of Malaysia acting now to develop its own cultivars by tapping into the country’s rich natural diversity, as well as assessing the risks of bioinvasion to the natural population via long-term biodiversity assessments.
 
Article
A novel chlorophyte algae strain with outstanding resilience to high inorganic phosphate (Pi) concentrations in the medium was isolated from a phosphorus-polluted site near a rock phosphate mine. According to the morphological, ultrastructural and genetic criteria the strain was assigned to the species Micractinium simplicissimum H.Chae, H.-G. Choi & J.H.Kim. This strain retained cell viability and growth capacity in the presence of Pi concentrations up to 14 g L–1. The uptake of Pi by the cells was moderate (equal to ca. 0.7% increase in cell dry weight P percentage) regardless of the amount of the exogenic Pi added to the culture. At the same time, approximately a half of the Pi removed by the M. simplicissimum from the culture was reversely adsorbed by the cell surface and/or the intercellular matrix and cell debris. The ultrastructural studies indicated the metabolically active status of the cells together with the presence of phosphorus-rich (likely, polyphosphate) inclusions outside and inside the cells (mainly in vacuoles). We hypothesized that the Pi resilience of the studied strain stems from its high Pi adsorption capacity together with its ability to throttle the Pi influx into the cell preventing the rapid buildup of intracellular Pi and potentially toxic short-chain polyphosphate.
 
Article
Addressing the growing challenges for food production imposed by abiotic stresses, the aim of this work was evaluate the effect and determine the ideal dose of the green microalga Asterarcys quadricellulare (CCAP 294/1) biomass added to Bradyrhizobium inoculant to mitigate the harmful effects of salinity in soybean. For that, two experiments were conducted: i) with soybean seeds testing salinity levels (40, 60 and 80 mmol L −1 of NaCl) and microalgal biomass doses (1.0; 1.5; 2.0 and 2.5 mg L −1) added to commercial soybean inoculant, evaluating germination and seedlings shoot and root length; ii) in greenhouse, testing the biomass doses of 1.5 and 2.5 mg L −1 and salinities of 60 and 80 mmol L −1 of NaCl in two soybean cultivars at early growth stages, evaluating biometric, biochemical and enzymatic variables. The germination and development of soybean seedlings were affected by salinity from 60 mmol L −1 of NaCl and the use of algal biomass at doses of 1.5 and 2.5 mg L −1 reduced the harmful effect of salinity. The microalga biomass added to inoculant was effective keeping plants growth, with the contents of total free amino acids, proline, proteins and antioxidant enzymes activity increased, as well roots nodules volume improved. Therefore, the use of A. quadricellulare (CCAP 294/1) biomass in soybean seeds was considered efficient to mitigate the salinity effects.
 
Article
This study assessed a culture system using a static magnetic field (SMF) for improving biomass and astaxanthin production in Haematococcus lacustris. Different intensities of SMF (0, 2, 4, and 8 mT) were applied to H. lacustris cell suspension culture at the beginning of the logarithmic phase, and then cell growth, antioxidant compounds, and oxidative damage were analyzed after 12 days. SMF at 8 mT caused a significant increase in cell growth, chlorophyll (a and b) concentration, total carbohydrate and protein contents, and antioxidant enzyme activities, including superoxide dismutase (SOD), catalase (CAT), and ascorbate peroxidase. Maximum astaxanthin accumulation (21.05 mg g⁻¹, 4.9 mg L⁻¹ dry weight) was identified at 4 mT, which was 1.58 times compared to control. SMF increased significantly hydrogen peroxide (H2O2) level and decreased malondialdehyde content, especially at 4 mT. Electrophoretic patterns displayed Mn-SOD, and CAT1 isoforms were the main isoforms to scavenge the ROS in H. lacustris cells. Moreover, SMF significantly enhanced total phenol, flavonoid, and DPPH scavenging activity. SMF-treated H. lacustris extracts showed an antibacterial potential against Staphylococcus aureus. These results provided an efficient method for improving growth and astaxanthin production and displayed the biochemical mechanism underlying secondary metabolite production in H. lacustris.
 
Growth curves (biomass in dry weight) of A. platensis MGH-1 at different concentrations of a) FeSO4, b) ZnSO4, c) MnCl2. 4H2O. Data are mean ± SE of three replicates
Accumulation of a) Fe b) Zn, and c) Mn in A. platensis MGH-1
Article
The effects of various concentrations of iron, zinc, and manganese on Arthrospira platensis MGH-1 growth and the capability of this cyanobacterium to accumulate these micronutrients were investigated. Maximum growth parameters were exhibited by A. platensis MGH-1 at 0.1 g L⁻¹ iron, 2.0 mg L⁻¹ zinc, and 6.0 mg L⁻¹ manganese. The maximum bioaccumulation value was observed in 0.3 g L⁻¹ iron, 8.0 mg L⁻¹ zinc, and 40 mg L⁻¹ manganese. The selection of the appropriate concentration for each micronutrient to produce A. platensis MGH-1 fortified with iron, zinc, and manganese was performed based on both the parameters of growth and accumulation of these metals. Then, the effects of selected concentrations for each micronutrient were investigated on photosynthetic pigments, protein and sugar contents, antioxidant enzyme activity, phenolic compound, and fatty acid content in A. platensis MGH-1. Maximum soluble sugar, phenolic compounds, and palmitoleic acid content were exhibited at 0.1 g L⁻¹ iron. The highest amount of antioxidant enzyme activity and palmitic acid content was detected at 4.0 mg L⁻¹ zinc-treated A. platensis MGH-1. The chlorophyll-a content increased significantly at 25 mg L⁻¹ of manganese. Arthrospira platensis MGH-1 treated with the micronutrients contained high amounts of γ-linolenic acid (GLA, 18:3n-6) compared to the control. Overall, this study showed that 0.1 g L⁻¹ iron and 25 mg L⁻¹ manganese were appropriate concentrations of micronutrients to enrich A. platensis MGH-1 and it can be suggested for the development of functional foods. Also, A. platensis MGH-1 fortified with 0.1 g L⁻¹ iron has more potential to be used in nutraceutical/ functional food since it is very rich in bioactive compounds.
 
Study area and experimental design. A Surface ocean currents in the Yellow Sea, East China Sea, Korea strait, and East/Japan Sea, showing the Kuroshio Current, Tsushima Warm Current (TWC), Jeju Warm Current (JWC), Chinese Coastal Current (CCC), Yellow Sea Warm Current (YSWC), West Korean Coastal Current (WKCC), East Korean Warm Current (EKWC), and North Korean Cold Current (NKCC). B Location of the sampling station where F. koreansis was isolated from (south of Jeju Island). C Design of the experiments, in which there were 6 experimental groups (no agitation + no MPD; no agitation + PE film; no agitation + PP rope; agitation + no MPD; agitation + PE film; agitation + PP rope) with 3 replicates per group, and cells were incubated at 25°C, and photon flux density of 60 μmol m⁻² s⁻¹ with a 12 h light:12 h dark cycle. D Attachment of cells to PE film (scale bar: 10 mm). E Attachment of cells to PP rope (scale bar: 10 mm). F Microscope image of cells attached to PE film (scale bar: 1 mm) using light microscopy (100×) G Microscope image of cells attached to PP rope (scale bar: 1 mm) using stereomicroscopy (80×)
Growth of F. koreansis cells without agitation (A) and with agitation (B) without MPD (orange), with PE film (green), and with PP rope (purple). Y-axis scale is different from (A) and (B), the y-axis scale of (A) is 4 times larger than (B). Error bars represent standard deviation (n=3)
Total abundance of F. koreansis cells grown without agitation (A) and with agitation (B). Cell abundance was determined in the growth medium (orange), on the PP film (blue), and on the PE rope (blue) at the beginning of the experiment (day-0) and the end of the experiment (day-15). Error bars represent standard deviation (n=3)
Article
Marine plastic debris (MPD) can significantly impact marine ecosystems because it can function as a dispersal vector for organisms, including toxic and alien species. We performed laboratory experiments to assess the possible function of MPD as a dispersal vector for the harmful epiphytic dinoflagellate Fukuyoa koreansis. Specifically, we monitored growth of these cells under 6 conditions: no MPD (control; with or without agitation), with polyethylene (PE) film (sheet-like MPD; with or without agitation), and with polypropylene (PP) rope (cylindrical MPD; with or without agitation). Growth without agitation was not significantly different between experimental groups (p > 0.05, χ² = 0.228, Kruskal-Wallis test), indicating that the presence of MPDs had no significant effect on growth of F. koreansis under non-agitating conditions. After 15 days, growth without MPD was 25-fold greater without agitation than with agitation (150 ± 42 cells mL⁻¹vs. 6 ± 1 cells mL⁻¹). When grown with both floating MPDs and agitation, 78 ± 1 % of the cells were attached to the MPD, which was 4-times greater than when they were grown without agitation. These results suggest that MPD or another attachment substrate is essential for the growth of F. koreansis in an unstable water mass, and that MPD may provide a habitat or shelter for F. koreansis and thereby function as a dispersal vector for this harmful epiphytic dinoflagellate.
 
Article
The kelp Ecklonia radiata has become a target for controlled cultivation. However, to date there are no standardised protocols for the hatchery stage of this species that result in high rates of germination, gametophyte development and transition to sporophytes. Therefore, the objective of this study was to quantify the effect of photoperiod, light intensity, temperature, nutrient media and use of GeO2 on the key hatchery processes of germination, gametophyte development and transition to sporophytes in controlled laboratory experiments. Germination of E. radiata was high (≥ 85%) throughout the study, regardless of treatments. Temperature had a major effect on the length of gametophytes, which increased with increasing temperature. The formation of sporophytes was favoured when individuals were maintained under 17 °C continuously, while reduced by approximately 30% when using F/2 compared to PES nutrient media. Overall, the recommended conditions for the hatchery stage of E. radiata are to maintain cultures under a 12 h L:12 h D photoperiod at 17 °C as this resulted in higher germination rates, good gametophyte development and higher transition to sporophytes compared to other treatments. Moreover, the use of GeO2 has to be limited to no more than 2 days as extended use has detrimental effects on the development of sporophytes. Finally, storage of sorus-bearing fronds of sporophytes up to 4 days after the collection from the field generally increased the number of released zoospores and is a simple mechanism to increase the fertility of brood stock.
 
Article
The phycobilisomes attached to the outer side of the thylakoid membrane absorb and transmit light energy in cyanobacteria and red algae. They consist of phycobiliproteins and linker polypeptides. LCM involved in the attachment of the phycobilisomes to the membrane is called core–membrane linker polypeptide. This study aimed to clone the apcE gene encoding the core–membrane linker polypeptide ApcE from Arthrospira platensis FACHB314. Then, the apcE gene was expressed with phycocyanobilin synthesis–related elements in Escherichia coli. The fluorescence emission spectra showed that purified ApcE was fluorescing (λmax = 670 nm), indicating that ApcE could bind with phycocyanobilin in low yield in an autocatalytic reaction. The Cys201, Cys419, Cys616, and Cys644 of the polypeptide were mutated to investigate the binding sites of ApcE with phycocyanobilin. The fluorescence peak of mutant strain E.coli HPApcE201 almost did not exist, implying that Cys201was the binding site of ApcE. The ApcE and allophycocyanin (APC) or phycocyanins (PC) were co-expressed in E. coli separately to investigate the role of ApcE in the fluorescence activity of phycobiliproteins. The mass spectrometry results showed that high–molecular weight protein polymers of ApcE and APC or of ApcE and PC might exist. The fluorescence emission spectra showed that the characteristic fluorescence peak of APC and PC was higher and the wavelength range of fluorescence peak was larger with ApcE expression.
 
Article
This work aimed to improve the techniques for cultivating the species Gelidium floridanum, testing different sources of calcium. Tetraspores and explants were grown in the laboratory for 20 days with seawater enriched with 50% von Stosch solution and oyster or mussel shell powder (252 mg L⁻¹ and 336 mg L⁻¹), or calcium chloride (147 mg L⁻¹ and 295 mg L⁻¹). Tetraspores or explants cultivated with no calcium salts or shell powder were used as control. Tetraspore germination rate and morphology, and germling morphology, average length, and growth rate were evaluated. Besides, the morphology, upright axes formation and growth rate of explants were also evaluated. There was no difference in tetraspore germination among treatments and control. Treatments with shell powder impaired tetraspore viability, indicated by a greenish color, cellular disorganization, and delay in germ tube development. Germlings cultivated with CaCl2 show better initial development but with no improvement compared to control. Concerning explants, those cultivated with mussel shell powder showed the highest growth rate (3.92 and 4.28% day⁻¹, according to concentration) in relation to other treatments. In particular, those cultivated with 252 mg L⁻¹ mussel shell powder had a significant formation of upright axes (10.15 ± 0.85 upright axes) compared to the control (5.18 ± 0.42 upright axes). Based on these results, we recommend using mussel shell powder at a concentration of 252 mg L⁻¹ to optimize explant cultivation.
 
Gene maps of organellar genomes of H. cervicornis (a, mitochondrial genome; b, plastid genome). Genes on the outside of the maps are transcribed in a clockwise direction, whereas those on the inside of the maps are transcribed counterclockwise
Venn diagrams of protein-coding gene content from ten reported mitochondrial genomes (a) and eight reported plastid genomes (b) of the Gigartinales
A comparison of the sequences of the stem-loop structures from nine Gigartinales mitochondrial genomes (a) and hairpin structures from ten Gigartinales mitochondrial genomes (b). *Only the partial sequences of the stem -loop from C. okamurae is shown in Fig. 3a. The complete sequence is as follows: CCTACCCTATATCCCTTACCCCCTATTATACTTAAGTCATTAGTATTATATTTGTTGGAAAAAGAGAAACAGTGGGAGAGACAGTAGACCCCCCCTCTTATAGTAAACGCTTTTTTTATGTAAGGTTATTTTTTTTCAAAAGTAACG—-—A—-—CGTTACTTTTGAAAAAAAATAACCTTACATAAAAAAAGCGTTTACTATAAGAGGGGGGGTCTACTGTCTCTCCCACTGTTTCTCTTTTTCCAACAAATATAATACTAATGACTTAAGTATAATAGGGGGTAAGGGATATAGGGTAGG
Whole-genome multiple alignments of ten mitochondrial genomes (a) and eight plastid genomes (b) from the Gigartinales using Mauve software
The Ka/Ks values of 24 protein-coding genes in the mitochondrial genomes (a) and 186 protein-coding genes in the plastid genomes (b) of H. cervicornis versus other sequenced species from the Gigartinales
Article
Hypnea cervicornis J. Agardh (Gigartinales, Florideophyceae) is a commercially important carrageenan producing seaweed. Currently, there are no organellar genomes of Hypnea species available in public databases. Here, we report the complete organellar genomes of H. cervicornis using next-generation sequencing technology. The mitochondrial genome has a circular mapping organization with a total length of 25,060 bp and consists of 50 genes (24 protein-coding, 2 rRNA, and 24 tRNA). The plastid genome is also a circular molecule and is 176,446 bp in length and includes 230 genes (194 protein-coding, 3 rRNA, 30 tRNA, 1 tmRNA and 2 misc_RNA). Colinear analysis show that the organellar genomes in the Gigartinales are conserved, except for the inversion of two genes (trnY and trnR) in the mitochondrial genome and a 12.5-kb rearrangement in the plastid genome. One stem-loop structure at the intergenic regions between trnS2 and trnA, plus one short hairpin structure between cob and trnL2 are detected in the mitochondrial genome of H. cervicornis. The Ka/Ks analysis reveal that values for most of the protein-coding genes in organellar genomes of H. cervicornis are below one, reflecting the importance of those genes. Phylogenetic relationships based on shared protein-coding genes from the organellar genomes of Rhodophyta are also examined.
 
Article
Converting microalgal lipids into biodiesel is considered a promising route in the field of biofuel production. However, the cost of microalgae-based biodiesel is still too high to be economically feasible, especially economical and effective methods for microalgae cell wall breaking are still lacking. In this study, five algicidal bacteria and their cell-free supernatant were evaluated by the percentage of cell disruption and lipid extraction of Chlorella sp.. Results showed that both bacteria and supernatant could induce cell disruption of Chlorella sp. to release lipids. Among them, the supernatant of Aeromonas hydrophila showed the best effects both in terms of the percentage of cell disruption and lipid extraction, and the cell disruption percentage increased with the extension of co-culture time with A. hydrophila supernatant. The inoculation volume of co-culture (A. hydrophila cell-free supernatant and Chlorella sp.) was explored, indicating that 10% volume ratio of A. hydrophila supernatant was identified as optimal proportion to improve lipid extraction. In addition, A. hydrophila supernatant showed obvious effects on the composition distribution of lipids extracted from Chlorella sp. that the fraction of unsaturated fatty acids decreased apparently, which would be beneficial to biodiesel production. The mechanism of microalgal cell disruption by A. hydrophila supernatant was further studied by scanning electron microscopy, ROS levels and antioxidant responses. This indicated that the cell morphology of Chlorella sp. changed dramatically with the time of co-culture with A. hydrophila supernatant.. These findings implied that algicidal properties of bacteria components are a promising tool for microalga cell disruption and lipid recovery, providing a new insight into the method for biofuel production.
 
Article
Carotenoids are among the most widely distributed pigments in nature with broad application options in pharmacology, cosmetics and food industries. For commercial-scale production using microalgae, however, it is crucial to find the best performing strains regarding growth and yields of the products of interest. As terrestrial microalgae present the ability to quickly adapt to changing or unfavorable environmental conditions through cell-specific defense mechanisms, they constitute highly promising candidates. The present study thus aimed to investigate the potential of five terrestrial microalgal strains to increasingly produce the carotenoids β-carotene, canthaxanthin and astaxanthin when being exposed to UV-A stress. Light stress experiments were performed using a novel irradiation system based on UV-LED technology. Microalgal cultures were treated with UV-A radiation to stimulate carotenogenesis and the time-dependent effects were investigated by high-performance liquid chromatography analysis. The potential of the microalgae to enhance de novo biosynthesis of the targeted metabolites under the influence of UV-A light could be confirmed by significantly increased yields of canthaxanthin in four out of five strains and by a significantly enhanced β-carotene concentration in at least one strain during 72 h of investigation. Overall, the results provided evidence that UV-A light stress can be effective in rapidly inducing carotenogenesis in terrestrial microalgae and thus harbors vast potential for further exploitation regarding large-scale carotenoid production.
 
Article
This work addresses the evaluation in vitro of different marine (Dunaliella salina REC-0214B and Microchloropsis gaditana REC-0251B) and freshwater (Anabaena sp. BEA-0300B, Arthrospira platensis BEA-0007B, Chlorella vulgaris BEA-0753B, Spirogyra sp. BEA-0666B) microalgae and cyanobacteria as potential dietary ingredients in aquafeeds. For this purpose, total protein content, amino acid composition, and the presence of protease inhibitors were evaluated. In addition, protein bioaccessibility was estimated using a species-specific in vitro assay using Sparus aurata digestive enzymes. Overall, all the microalgae showed high protein content ranging from 25 to 61%, and a balanced essential to non-essential amino acid content (from 0.81 to 0.95). The inhibition assay confirmed the absence of protease inhibitors whatever the microalgae considered. Finally, the in vitro assays showed differences in the degree of protein hydrolysis with values for the coefficient of protein degradation ranging from 49.4% in Spirogyra sp. to 85.5% in D. salina. Similarly, the total amount of free amino acids released from the microalgal biomass (from 12.8 to 20.8 g L-leucine equivalents (100 g protein)⁻¹), as well as their qualitative amino acids profile varied among the different species, although the profile can be considered as well balanced in all cases. In conclusion, the results obtained revealed that, even if significant differences were observed among species in terms of their susceptibility to be hydrolysed by S. aurata digestive enzymes, all the microalgae and cyanobacteria evaluated presented an adequate protein content and a balanced amino acid profile.
 
Average fresh weight of basil plants (n=15 per treatment) measured weekly during the first (a), second (b), and third (c) trial. Growth increase (n=15 per treatment) of treated plants at the end of the trials compared to their respective control (d). Bars represent standard error. * indicates significant differences between treatments and controls at P ≤ 0.05. For ANOVA results see tables in S1.
Increase in shoot (a) and root (b) fresh weight (n=15 per treatment) with respect to the controls recorded at the end of the trials. Bars represent standard error. * indicates significant differences at P ≤ 0.05; ** indicates significant differences at P ≤ 0.01. For ANOVA results see tables in S2.
Increase in number and fresh weight of leaves (n=15 per treatment) at harvest time compared to controls. Bars represent standard error. * indicates significant differences at P ≤ 0.05; ** indicates significant differences at P ≤ 0.01. For ANOVA results see tables in S3.
Biochemical composition (a) and elemental composition (b) of the five cyanobacterial hydrolysates and the two commercial biostimulants used in the trials. Data are expressed as % of hydrolysate dry weight
Article
In the coming years biostimulants will play a key role in the sustainable intensification of agriculture due to their capacity to improve crops quality, nutrient use efficiency and tolerance to abiotic stresses. Cyanobacteria are nowadays considered one of the most promising sources of new biostimulants; however, in vivo studies using cyanobacteria are still scarce and often limited to a few genera. In this work the biostimulant activity of five cyanobacterial hydrolysates was evaluated on Ocimum basilicum L. grown in hydroponics. Plants were treated weekly with foliar applications of the cyanobacterial hydrolysates and of two commercial products. Three of the tested cyanobacterial hydrolysates, administered at the concentration of 1 g L⁻¹, were effective in increasing plant growth (up to +32%), and number (up to +24%) and fresh weight (up to +26%) of the leaves compared to controls. Moreover, the cyanobacterial hydrolysates performed better than the commercial biostimulants. The biochemical characterization of the hydrolysates suggests that the observed bioactivity can be related to a high carbohydrate content. Our results indicate that cyanobacteria-based biostimulants can be an effective tool for sustainably enhancing plant growth and yields.
 
Hypothetical via a monotonic model a) threshold, b) linear without a threshold (LNT), and via non-monotonic model as c) Hormesis and d) non-monotonic/non-hormetic dose-response (paradoxical effect). The broken lines indicate the control response
Hormesis and non-monotonic/non-hormetic responses in different parts of mung bean plants. a,b) Shoot length, c,d) root length, and e-f) dry weight shown as average values (n = 100) given the dose concentrations of seaweed liquid extracts (SLEs) from Sargassum horridum (SH) and Gracilaria parvispora (GP) obtained via either autoclave (A) or water bath (B) extraction. The horizontal line at 0 indicates the control value. The y-axis shows the % change (maximum stimulatory response, MAX) of the response variable over that of the control
Effect of the blended seaweed extract (BSE) from Sargassum horridum and Gracilaria parvispora (SHGP) obtained via autoclave (A) or water bath (B) extraction shown as an inverted J-shaped hormetic effect response in different parts of the mung bean plants. a) Shoot length, b) root length, and c) dry weight are shown as average values (n = 100). The y-axis indicates the % change (maximum stimulatory response, MAX) of the response variable over that of the control. The horizontal line at 0 indicates the control value
Principal component analysis (PCA) of the physicochemical characteristics of the blended seaweed extract (BSE) from Sargassum horridum and Gracilaria parvispora (SHGP) obtained via autoclave (A) or water bath (B) extraction
Hormesis Dose-Response models for different mixture effects illustrate synergistic of a binary blended (BSEs) on the magnitude of the stimulatory response by SLEs in the root of plants. The line indicates the control response
Article
Hormesis and other non-monotonic growth responses have been observed in numerous plant species that are independent of biological or physicochemical agents, which may be potentially exploited to increase crop productivity. A dose–response study was performed on mung bean (Vigna radiata) by applying seaweed liquid extracts (SLEs) from Sargassum horridum (SH) and Gracilaria parvispora (GP) and blended seaweed extracts (BSEs) from these species (SHGP). Autoclave and water bath extraction were used to obtain the extracts which were applied to seedlings over a wide dose range to evaluate growth stimulation patterns. Shoot length, root length, and dry weight responded to the SLEs and BSEs in a hormetic and paradoxical manner. A biphasic dose–response confirmed the relationships between autoclave-extracted SLEs and shoot length and dry weight, which were due to the constituent properties of the SLEs. In contrast, plant roots treated with autoclave-extracted SLEs exhibited responses with maximums and/or minimums that were attributed to non-monotonic/non hormetic dose–response relationships (i.e., paradoxical effects). SLEs at all concentrations showed toxic effects (i.e., reduced root length), while the autoclave-extracted SHGP exhibited beneficial effects on root length. A physicochemical analysis indicated that the SLEs and BSEs contained significantly different amounts of different compounds. The PCA results indicated that four, clearly separate clusters were present among the mung bean plants from SLE and BSE treatments. The growth stimulation patterns found in this study will contribute to establishing safe application guidelines while providing a strong foundation for future research protocols to study the effects of SLEs and BSEs.
 
Culture optical density (A), cell numbers (B) and average cell diameter (C) of Chlorella sorokiniana control culture (CC, dark green) and enriched culture (EC, light green). Error bars represent SD (n=3). Significant differences between EC and CC at the same time-point were determined by Student’s t test and indicated by asterisks (*p<0.05, **p<0.01, ***p<0.001)
Pigment contents in Chlorella sorokiniana cells. Chlorophyll-a, -b and total carotenoids were measured in CC (dark green) and EC (light green) cells. Error bars represent SD (n=3). Significant differences between EC and CC at the same time-point were determined by Student’s t test and indicated by asterisks (*p<0.05, **p<0.01, ***p<0.001)
Fv/Fm value of Chlorella sorokiniana control culture (CC, dark green) and enriched cultures (EC, light green) at 48 h (A). Image representing Fv/Fm (B) of CC and EC was obtained by Imaging-PAM; The false-colour scale ranging from black (0) to purple (1) is indicated under the image. Light response curves of ΦPSII (C), NPQ (D) and ETR (E) in CC and EC Chlorella sorokiniana cells at 48 h. Error bars represent SD (n=3). Significant differences between EC and CC at the same light intensities were determined by One-way ANOVA with post-hoc Tukey HSD Test (*p< 0.05, **p< 0.01)
Article
Galdieria spp. (Rhodophyta) are polyextremophile microalgae known for their important antioxidant properties in different biological systems. Nowadays, the beneficial and bio-stimulant effect of microalgal extracts is widely tested on crops. Here, for the first time, potential positive effects of aqueous extracts from Galdieria were tested on a second microalgal culture systems. Chlorella sorokiniana cultures were supplemented with Galdieria phlegrea extracts (EC) and the short-term (48 h) effects of extract addition on growth and biochemical and physiological parameters were monitored and compared to those of non-supplemented Chlorella (CC). Growth of Chlorella was improved in EC as shown by higher optical density and cells number in the enriched cultures. In addition, EC appreciably increased the pigments (chlorophyll (a and b) and carotenoids) contents of Chlorella cells. Increase of photosynthetic pigments was associated with higher photosynthesis and lower non-radiative dissipation of light in EC as indicated by chlorophyll fluorescence parameters. Reduced activities of antioxidant enzymes (SOD, CAT and APX), but increased total antioxidant capacity (ABTS) were observed in EC, suggesting that this culture was under a low oxidative status, but can activate antioxidant defences if exposed to oxidative stress. In conclusion, a short-term positive effect of the addition of G. phlegrea extracts on growth and physiology of C. sorokiniana was demonstrated.
 
Article
In this work two-stage cultivation of Scenedesmus acuminatus to enhance lipid productivity was investigated. Two two-stage cultivation strategies were employed: 1) S. acuminatus was cultured in nitrogen-limited conditions (0.75 g L⁻¹ NaNO3, stage I), then nitrogen-limited condition (stage II); 2) S. acuminatus was cultured in sulfur-replete conditions (86.80 g L⁻¹ MgSO4, stage I), then nitrogen-limited conditions (stage II). The lengths of stages I and II were varied within a total culture period of 20 days. The highest biomass (12.41 g L⁻¹) and lipid productivity (346.51 mg L⁻¹ day⁻¹) were obtained when stage I lasted 8 days and the cells were then transferred to medium containing 0.3 g L⁻¹ NaNO3 (stage II) for another 12 days; these values were 1.72- and 2.18- times higher, respectively, than those for the control group (single-stage cultivation in control group, 1.5 g L⁻¹ NaNO3). Biochemical analyses indicated that S. acuminatus produced higher biomass and lipid content if stable carbon partitioning model occurred in stage II of culture. Overproduction of carbohydrates or soluble protein after transfer to the second stage was not conducive to the optimal balance of cell growth and lipid content. The findings of this study indicate that the regulation of nitrogen concentration to promote lipid accumulation is more effective than regulation via the sulfur concentration. This two-stage cultivation process is of interest for large-scale cultivation of S. acuminatus for enhanced lipid accumulation.
 
Schematic presentation of Chlorella biomass production and cell wall disruption techniques.
Publications focused on binding and/or removal efficiency of different species of Chlorella for radionuclides and heavy metal ions.
Article
Release of radionuclide and heavy metals in environment during healthcare, agriculture and military practices, and mining and energy production, poses a serious threat to humans and whole ecosystems. Acute or chronic exposure to human causes serious health effects such as acute radiation syndrome, burns, neurological disorders, renal damage and cancers. Hence, there is a need to find safe, wide-spectrum and cost-effective agents for removing internalized radionuclides and preventing internalization of these ions. In this direction, nutritional supplements offer an excellent option. The present review examines the potential of Chlorella for removal of radionuclide and heavy metal ions. Chlorella is a green alga consumed as dietary food supplement in powdered form. In addition to its high nutritional value, it is reported as an excellent detoxifying agent. The powdered Chlorella has been reported for removal of mercury, cadmium and radioactive strontium from the body. Chlorella contains a variety of metal-binding functional groups such as carboxyl, amino, phosphoryl, hydroxyl and carbonyl groups, which have high affinity towards various metal ions. Different species of Chlorella in live, dead or powdered forms has shown removal efficiency for different toxic metal ions from living as well as non-living things.
 
Sampling scheme for growth rate determination. Two plates were used for each algal strain and all 48 wells inoculated at once. The first three replicates were removed by pipetting each respective day for cell counts and the wells were kept empty henceforth. The fourth replicate of each day stayed untouched for continuous measurements over the 12 days
Chlorophyll-a auto-fluorescence growth measurements and cell numbers of Chlorellavulgaris. Blue circles: top reading mode; red squares: bottom reading mode both given as relative fluorescence units (left-side y-axis); black triangles: cell number given as cells mL⁻¹ (right-side y-axis)
RFU (top read) to cell number relation during exponential growth for all tested algae with linear
Article
Micro-algae play important roles in primary production, nutrient cycling, and applied biotechnology. Mico-algae are phylogenetically, morphologically and physiologically diverse and often easy to grow in cultures. Growth is the key parameter of viability and crucial for survival in situ and efficiency in vitro . Therefore, growth is often used in eco-physiological experiments to describe the fundamental niche and optimum conditions. In vivo chlorophyll- a fluorescence (IVCF) is a well-established proxy for the growth of micro-algae and is based on constant cell properties during exponential growth. High-throughput IVCF measurements have been applied for about 20 years for few, mostly green algal strains. Here, we tested the IVCF using microtiter plates on strains of four different algal phyla (Chlorophyceae, Cyanobacteria, Bacillariophyceae, Rhodophyceae) and compared the data with cell counts and chlorophyll contents. The microtiter plate reader based IVCF (MPR-IVCF) approach worked best for the diatom Cylindrotheca closterium and the cyanobacterium Synechococcus elongatus . Differences between IVCF and cell count-based growth rates were found for Chlorella vulgaris and Rhodella sp. The IVCF growth rates were lower than the growth rates based on cell counts in both cases, thus underestimating absolute growth rates. The MPR-IVCF method is robust in terms of light scattering and non-photosynthetic contamination but prone to changes in light regimes and also to aggregating algal cells. Thus, we recommend using the MPR-IVCF approach (1) for diatoms and cyanobacteria as an absolute growth rate measure, (2) for relative measures of growth rates, intra and interspecific during the same experiment, also for all algal phyla except Rhodophyta.
 
Article
Hydrogen produced from microalgae is attracting the attention of scientists as a potential new ‘Bio-Circular-Green’ energy source. We screened a selection of naturally occurring algal strains for H2 yield as a basis for high yield development. The best strain was a new strain of biohydrogen-producing green algae from a fresh water source at King Mongkut's Institute of Technology Ladkrabang, Thailand. Using morphological and 18S rDNA sequencing analyses, this alga was identified and classified as Chlorella sp. KLSc61. When adapted cells in TAP-K medium (with starting pH at 9.0) containing 25 mM ethanol, with 54 μmol photons m⁻² s⁻¹ light, and incubated at 35 °C, Chlorella sp. KLSc61 showed a maximum H2 yield of 9,804 ± 469.5 μmol H2 mg⁻¹ Chl at day 7. Under these conditions, the cells produced ~ 12.2 times more H2 gas than without optimization (753.0 μmol H2 mg⁻¹Chl). Our optimized system also produced H2 at a rate 11–570 times greater than previously reported microalgae. Thus Chlorella sp. KLSc61 could be a viable strain for biohydrogen production as a clean future energy source.
 
Article
Neopyropia J. Brodie & L.-E Yang has been cultivated in Asia for centuries and the total production was nearly three million (fresh weight) with an economic value of US$2.7 billion in 2019. It has been traditionally used as human food. Recently its diverse secondary metabolites as functional components, including porphyrin, phycobiliproteins, carotenoids, mycosporine-like amino acids (MAAs) in the cosmetic and pharmaceutical industries have received much attention. In this review we first discuss the nomenclatural history of Neopyropia, its characterization, and circumscription and species delineation; current systematics, biogeography and speciation, genomics and transcriptomics, ecology, life history, cultivation, and bioactive chemicals. Currently, 22 species have been described in this genus and 32 varieties or cultivars have been developed in Korea, China, and Japan. Most species show a large degree of phenotypic plasticity. This genus may be found on all continents except for the Antarctic. Neopyropia has a heteromorphic life cycle, alternating macroscopic foliose monoecious gametophytic phase and a filamentous sporophytic phase, called the conchocelis. The gametophytic thallus consists of one cell layers in thickness with an extremely high surface area to volume ratio, and therefore, all cells can take up nutrients. Neopyropia can be found in various environments: from marine to estuarine; from eulittoral to sublittoral; and may be epilithic, epiphytic or epizoic. Neopyropia yezoensis has received much more attention than other species in this genus because this species is the dominant aquaculture species and has rapid growth. Recently, a complete plastid and mitochondria genome has been described in N. yezoensis, which provides critical insights to understand the origin and evolution of eukaryotes and the evolution of agronomic traits. This review will describe the most recent advances in these areas.
 
Article
Isochrysis galbana is a microalga that is a potential source of several ‘compounds of interest’ for food and nutraceutical industries. The procurement of these compounds of interest and the generation of bioenergy is a novel and interesting application of microalgae. The present study evaluated the valorization of the microalga I. galbana through the extraction of the carotenoid fucoxanthin and polyunsaturated fatty acids using supercritical fluid extraction (SFE). The spent or extracted microalga I. galbana was valorized through anaerobic digestion (AD) to produce biogas through the integration of the concepts of biorefinery and the circular economy. The biochemical composition of the extracted microalga exhibited a marked decrease in the carbohydrates by approximately ninefold after the SFE, while the proteins and lipids were decreased only to nearly half of their initial contents. The methane (CH 4 ) yields obtained for non-extracted I. galbana and supercritical fluid-extracted I. galbana were 104 ± 5 L STP CH 4 kg –1 VS and 90 ± 2 L STP CH 4 kg –1 VS (VS: volatile solids), respectively, indicating the methane yield loss of only 14.2% when using the extracted microalga. In order to increase methane production, different co-digestion mixtures of I . galbana and olive mill solid waste (OMSW) were evaluated. The methane yield increased to 134 ± 4 and 189 ± 5 mL STP CH 4 g –1 VS for the VS/TKN ratio (w/w) of 20 and 30, respectively (TKN: Total Kjeldahl Nitrogen). These results were encouraging due to the positive synergism established between the co-substrates.
 
OFAT experiment (9 Days) with 3 factors for RSM employed in the study at 9th day for Nannochloropsis sp. All the samples are represented as average of three biological replicates ± S.D
A-F Biochemical constituents in N. oculata at day 9, in different concentrations of nitrogen (N-NO3⁻), phosphorus (P-PO4³⁻) and bicarbonate (NaHCO3) respectively. All the samples are represented as average of three biological replicates ± S.D
A-D Response surface and contour lines indicating the effect of N-NO3⁻and P- PO4³⁻ on biomass, total lipids content, chlorophylls and total carotenoids of N. oculata according to generated response surface polynomials. Actual data points are shown as red circles
Parity plots showing distribution of experimental and predicted values of A) biomass production B) total lipids content C) chlorophylls content and D) total carotenoids content in N. oculata
Article
Since the last few decennia microalgal biomass is of industrial significance for achieving sustainable biofuels pharmaceuticals, nutraceuticals, and functional foods. However, the major bottleneck that needs to be addressed for achieving sustainability is the low biomass productivity of microalgae. In this context, we employed a statistical approach, response surface methodology (RSM), for medium optimization to enhance the biomass of the marine strain Nannochloropsis oculata UTEX 2164 since N. oculata has good growth rate and lipid content along with other biochemical constituents. We investigated the role of macronutrients such as nitrogen (NaNO3—sodium nitrate as the source), phosphorus (NaH2PO4—monosodium phosphate as the source), and carbon (NaHCO3—sodium bicarbonate as the source) in F/2 medium as major factors that obviously control biomass production. The medium optimization was undertaken first to enhance algal biomass and the preliminary data analysis accounted for these quantifiable variables using the one-factor-at-a-time (OFAT) method with varying nitrogen, phosphorus, and carbon concentrations predicting their effect on the overall biomass yield. These findings were refined for the RSM-based experiments using a central composite design (CCD) and later evaluated to demonstrate the combined effect of nitrogen (N) and phosphorous (P) interactions by measuring biomass yields. Our data demonstrate that after nine days of culture with a 21.08 mg L⁻¹ of N-NO3⁻ concentration, the maximum biomass concentration achieved was 576 mg L⁻¹, compared to 460 mg L⁻¹ in the control. Overall, the employed statistical modeling achieved 25% DCW more biomass concentration than the control, with a coefficient of variance (CV) of 8.22%. Thus this study paves the way to further utilize this alga or the refined medium composition to acquire higher cell biomass in other algae.
 
Growth (bars) of Rhodomonas sp. JZB-2 and PX degradation (color lines) in batch cultures (n = 3) as a function of initial inoculation densities. Different letters on the top of the bar denote the means among five treatments were significantly different (P < 0.05)
Growth (bars) of Rhodomonas sp. JZB-2 and PX degradation (color lines) in batch cultures (n = 3) as a function of concentrations of NaNO3 (a) and NaH2PO4 (b). Different letters on the top of the bar indicate the means among five treatments were significantly different (P < 0.05)
Growth (bars) of Rhodomonas sp. JZB-2 and PX degradation (color lines) curves at different concentrations of six trace elements (a. ZnSO4·4H2O; b. CuSO4·5H2O; c. FeCl3·6H2O; d. MnCl2·4H2O; e. Na2MoO4·2H2O; f. CoCl2·6H2O. n = 3). Different letters on the top of the bar show the means among five treatments were significantly different (P < 0.05)
Growth (bars) of Rhodomonas sp. JZB-2 and PX degradation (color lines) curves at different concentrations of three vitamins (a. vitamin B1; b. vitamin B12; c. biotin. n = 3). Different letters on the top of the bar indicate the means among five treatments were significantly different (P < 0.05)
Article
Our previous study had shown that Rhodomonas sp. JZB-2, a newly isolated oceanic microalga, could efficiently remove high concentrations of para-xylene (PX) from seawater. We assessed the effects of inoculum density and exogenous substances such as inorganic nitrogen and phosphorus, trace metal ions (Zn²⁺, Co²⁺, Fe³⁺, Mn²⁺, Cu²⁺, Mo⁶⁺) and vitamins (vitamin B1, vitamin B12, biotin) on the biodegradation of PX in seawater by this microalga. Both nitrate and phosphate were indispensable to PX biodegradation, with a maximum degradation rate (v) of 0.200 and 0.173 mg L⁻¹ h⁻¹ at 300 mg L⁻¹ of NaNO3 and 20 mg L⁻¹ of NaH2PO4, respectively. A concentration of 6.3 mg L⁻¹ of FeCl3·6H2O can accelerate this degradation. The addition of vitamin B1 (0.05 mg L⁻¹) and vitamin B12 (0.002 mg L⁻¹) significantly improved the removal of PX, with maximum v values of 0.149 and 0.169 mg L⁻¹ h⁻¹ respectively; however, the degradation of PX was inhibited when biotin was added. These findings indicate that not all the exogenous substances promoting the growth of microalgae exert positive effects on the biodegradation of PX, which will help to develop more rational bioremediation strategies.
 
Maximum likelihood phylogenetic tree based on 43 rbcL DNA sequences of different species of the genus Gracilaria. Sequence of Gracilariopsislongisimma is used as outgroup. Values at nodes represent bootstrap proportion (> 50%). Analysis conducted in MEGA v.6 (Tamura et al. 2013)
(A) Morphology and anatomy of Tetrasporophyte of Gracilariadura from Indian waters. a: Habit (scale = 5 cm); b: Tetraspore mother cell [T.S.] (scale = 10 μm); c: Bi-spore (scale = 15 μm); d: Tetraspores in surface view (scale = 100 μm); e: Cruciatly arranged tetraspores (scale = 10 μm); f: Decussately arranged tetraspores (scale = 10 μm) g: Nascent tetraspores (scale = 2 μm) (B) Morphology and anatomy of male gametophyte of Gracilariadura from Indian waters. a: Habit (scale = 2 cm); b: Surface view dissecting microscope (scale = 1 mm); c: Surface view compound microscope (scale = 20 μm); d: Cortical cells pit connections (scale = 2 μm); e: Conceptacle henriquesiana type (scale = 20 μm); f: Conceptacle verrucosa type (scale = 10 μm); g: Empty conceptacle (scale = 10 μm) (C) Morphology and anatomy of Cystocarpic female gametophyte of Gracilaria dura from Indian waters. a: Habit (scale = 1 cm); b: Developing cystocarps (scale = 1 mm); c: Carpogonial branch (scale = 2 µm); d: Mature cystocarps [arrow constricted base] (scale = 500 µm); e: Cystocarp T.S. [arrow chain of carpospores] (scale = 50 µm); f: Cystocarp T.S. [arrow distinct plancentum] (scale = 10 µm)
Cultivation of Gracilariadura in Indian waters A: Floating bamboo raft method (southeast coast); B: Biomass harvest from tube net method (west coast)
Relative abundance of different metabolite categories represented in, A: Different collection month; B: Different life phases of G.dura collected from the field
Article
Gracilaria is a genus of Rhodophyta with about 228 taxonomically accepted species, many of which are important as sources of agar. Gracilariadura which has major distribution in Mediterranean and Arabian Sea has fast emergingd as a preferred species for commercial aquaculture, especially in Indian waters. The direct extraction of high-value agar and agarose (gel strength > 1900 g cm⁻² of 1% gel) can be achieved via a simplified surfactant induced down-stream process by coagulating the alkali-treated agar extract. The potential feed-stock applications of farmed biomass to sequentially obtain different bio-products of economic interest via bio-refinery mode has attracted industry attention. The isomorphic, triphasic life history also offers an opportunity for selecting elite germplasm for industrial utilisation, including farming. The floating bamboo raft and tube net method of farming has been perfected for undertaking commercial operations in India. The technology of farming and processing has also attracted the attention of policy makers, thus the Department of Biotechnology, Ministry of Science and Technology, Government of India, has bestowed the “Biotech Product, Process and Development and Commercialization” award in 2020. This review provides the state of the art knowledge in the area of farming and processing, besides basic information on taxonomy, distribution, ecology and life history. The efforts to domesticate this species in other parts of world might pave ways of economic development in coastal rural settings due to its ability to produce high value agar and agarose, which have applications in the pharma, medical and biotechnology sectors.
 
Article
The red algal genus Asparagopsis produces secondary metabolites that when fed to ruminants reduce methane production by up to 98%. However, cultivation methods for Asparagopsis are nascent and fundamental information on reproduction, which is essential for large-scale cultivation, is lacking. In this study we examined asexual propagation in Asparagopsis armata , the regrowth of fragments and mechanisms of attachment to assess the potential for fragments to be used in sea-based cultivation. Asparagopsis armata gametophytes grow specialised structures, barbs, that hook fragments onto substrata. Surveys revealed barbs were abundant occurring at ~ 1 barb every 3–4 cm on gametophyte branches. Barbs did not regrow, but fronds did, either when attached to a barb or on their own. In contrast, fronds doubled in size with most developing barbs within 4 weeks. Barbs were, however, critical for the reattachment of fragments: barbs attached to substrata at four times the rate of frond fragments without barbs and they also attached in higher proportions to mussel rope than polypropylene rope, and two types of net. Utilising fragmentation for the propagation of A. armata gametophytes in sea-based cultivation requires that fragments can attach to a substratum and regrow once attached. We have shown that A. armata fragments in Tasmania require barbs for attachment and frond tissue for growth, which has implications for cultivation. Optimising fragmentation, attachment and out-planting methods are important future steps in establishing fragmentation as a method for sea-based cultivation in A. armata.
 
Morphological image of Tetratostichococcus sp. P1 under a microscope at 100 × magnification. A Morphology under shaking system cultivation. B DAPI staining strain under shaking culture. C Morphology under an air bubbling system with 1% CO2. D DAPI staining strain under bubbling culture. White arrows show chloroplast bleaching; yellow arrows show the accumulation of storage vacuoles
Phylogenetic tree of Tetratostichococcus sp. P1. The tree was inferred using the neighbor-joining (NJ) method, maximum likelihood (ML) method (Kimura 1980), minimum evolution (ME) method (Rzhetsky and Nei 1992), and maximum parsimony (MP) method in the bootstrap test (1000 replicates) (Felsenstein 1985). The evolutionary distances were computed using the Kimura 2-parameter method (Kimura 1980); analyses were conducted in MEGA X (Sudhir et al. 2018). The values indicate bootstrap points of NJ, ML, ME, and MP
Growth curve of Tetratostichococcus sp. P1 under different pH with 1% CO2.a Growth based on OD730. b Growth rate (µ.day⁻¹) after seven days of cultivation (*p < 0.05; **p < 0.01); Trisodium citrate buffer was used for pH 3 to pH 5, MES buffer for pH 6, HEPES buffer for pH 7, and Tricine buffer for pH 8. The error bar indicates the standard deviation (n = 3)
The molar percentage of fatty acid methyl esters (FAMES) contained in Tetratostichococcus sp. P1 under different pH conditions with BG11 media. Asterisk indicates statistical significance (p < 0.05) of FAME against FAME at pH 3. The bar with red color indicates FAMEs contained at a pH of 3, blue indicates FAMEs contained at a pH of 5, and green indicates FAMEs contained at a pH of 7. The error bar indicates the standard deviation (n = 3)
FAME content of Tetratostichococcus sp. P1 under BG11 and peat water. Asterisk indicates statistical significance (p < 0.05) of FAME against FAME at BG11 + CO2. The bar with the red color indicates FAMEs contained in BG11 with 1%CO2 enriched air, blue indicates FAMEs in BG11 aerate with air, brown indicates FAMEs contained in peat water with 1%CO2 enriched air, and the bar with purple indicates FAMEs contained in peat water + air. The error bar indicates the standard deviation (n = 3)
Article
Tropical peat swamp forests are unique ecosystems that are found in the tropical regions of Southeast Asia. Since tropical peatlands have high sunlight penetration, high temperature, and low pH (2.9–3.5), unique microorganisms can survive under certain environmental conditions. Acid-tolerant microalgae, Stichococcus-like species from a peatland in Malaysia, were isolated and identified as Tetratostichococcus sp. P1. This strain showed a high growth rate (µ = 1.47 day⁻¹) with an optical density (OD730) of 9.25 in 7 days. Tetratostichococcus sp. P1 shows four primary fatty acids (C16:0, C18:1, C18:2, and C18:3) at different pH values. The highest total amount of fatty acids was at a pH of 5, followed by at a pH of 3 and a pH of 7 with 102.88 µg mg⁻¹, 75.8 µg mg⁻¹, and 67.77 µg mg⁻¹, respectively. Tetratostichococcus sp. P1 reached an OD730 of 2.85 ± 0.40 at 12 days with a growth rate of µ = 0.22 day⁻¹ when peat water was used as a nutrient source and produced a significant amount of C20:0. This result indicated that tropical peat water could be applicable for the mass growth of Tetratostichococcus sp. P1 to reduce cost for biodiesel production.
 
Dose–response curves of test algae Chlorella sorokiniana, Scenedesmus vacuolatus and Pseudokirchneriella subcapitata grown in different concentrations of the raw effluent (A), in different concentrations of 1.0 g sodium alginate-treated effluent (B) and in 1.0 g sodium alginate-treated effluent with N:P mass ratio adjustment (C)
Bioremoval (%) of total soluble inorganic nitrogen (NH4-N, NO3-N and NO2-N), phosphorus and copper after 7 days growth of Chlorella sorokiniana and Scenedesmus vacuolatus
Mean variations in wt % of total protein, total carbohydrate, and total lipid contents of Chlorella sorokiniana (A) and Scenedesmus vacuolatus (B) grown in 1.0 g sodium alginate-treated effluent with and without N:P mass ratio adjustment
Mean variation of dry biomass (g L⁻¹) of Chlorella sorokiniana and Scenedesmus vacuolatus grown in 1.0 g sodium alginate-treated effluent with and without N:P mass ratio adjustment
Article
Although wastewater reutilization for microalgae culturing can meet the dual goals of wastewater treatment and biomass production, some effluents with high contaminant concentrations are toxic to microalgae, necessitating pretreatment protocols to lower the toxicity before bioremediation. The present study aimed to bioremediate the industrial effluents of El Delta Co. for Fertilizers and Chemical Industries (Mansoura, Egypt), using sodium alginate as a pretreatment to enable reuse as a growth medium for microalgae culturing. Various water quality parameters signified the inferior state of the effluent with an ammonia-N concentration of 185.76 mg L ⁻¹ . Toxicity investigations of the raw industrial effluents revealed toxicity to Chlorella sorokiniana , Scenedesmus vacuolatus and Pseudokirchneriella subcapitata. Effluent bioremediation was adopted using different concentrations of the biopolymer sodium alginate, and 1.0 g L ⁻¹ sodium alginate resulted in the highest removal of both ammonia-N and heavy metals. Chlorella sorokiniana and S. vacuolatus successfully grew in the 1.0 g L ⁻¹ alginate-treated effluent. Chlorella sorokiniana removed 87.8% of the ammonia-N, 75% of the copper, and 100% of the phosphorus. Scenedesmus vacuolatus consumed 85.7% of the ammonia-N, 66.7% of the copper, and 100% of the phosphorus. Adjusting the N:P mass ratio to 9.9 resulted in high tolerance of C. sorokiniana and S. vacuolatus to the effluent toxicity, with an EC 50 > 100%. The 1.0 g L ⁻¹ sodium alginate-treated effluent stimulated C. sorokiniana and S. vacuolatus growth relative to the control. Additionally, C. sorokiniana and S. vacuolatus had the highest biomass production and protein content, reaching 1.42 and 0.74 g L ⁻¹ and 57.04 ± 0.04% and 52.19 ± 0.02%, respectively, in the treated effluent. Therefore, it was concluded that this bioremediation approach using the 1.0 g L ⁻¹ alginate pretreatment followed by microalgal cultivation ( C. sorokiniana and S. vacuolatus ) successfully treated the industrial effluent, representing a promising protocol for bioremediation practices.
 
H2 production of monoculture F. muscicola TISTR 8215 initiated with 0.5 g L⁻¹ of biomass concentration (F) and Chlorella sp. (C) with 0.025 and 0.125 g L⁻¹ of initial biomass concentration compared to the co-cultures of F. muscicola TISTR 8215 (0.5 g L⁻¹) and Chlorella sp. with 0.5: 0.025 and 0.5: 0.125 of initial biomass ratios (F + C). Experiments were done in BG110 medium where the cells were grown under N deprivation illuminated for 2 days with 40 µmol photons m⁻² s⁻¹ continuously. Different letters above the bar indicate the significant differences (p ≤ 0.05) among groups (Duncan’s multiple range test). Data represent mean ± SD, n=3\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$n=3$$\end{document}
H2 yield of F. muscicola TISTR 8215 initiated with 0.5 g L⁻¹ of biomass concentration (F) and the two combinations of the co-cultures (F + C) with biomass concentration of Chlorella sp. at 0.025 and 0.125 g L⁻¹. The cultures were grown in BG110 medium for 6 days under aerobic condition and continuous illumination of 40 µmol photons m⁻² s⁻¹. At indicated times, H2 yield was analyzed after 12 h of anaerobic incubation under continuous illumination of 40 µmol photons m⁻² s⁻¹. Data represent mean ± SD,n=3\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$n=3$$\end{document}
H2 yield in monoculture of F. muscicola TISTR 8215 (0.5 g L⁻¹), Chlorella sp. initiated with 0.025 g L⁻¹, and co-culture of F. muscicola TISTR 8215 and Chlorella sp. with initial biomass ratio = 0.5: 0.025 entrapped within different concentrations of agar matrix. The cultures were grown in BG110 medium for 2 days and entrapped with different concentrations of agar matrix to monitor H2 production under anaerobic condition with illumination of 40 µmol photons m⁻² s⁻¹. Cell concentration in different agar concentrations was 25 g cell wet wt L⁻¹. The 2 mL of agar cubes (0.5 cm × 0.5 cm × 0.5 cm) was transferred into vial glass before detecting H2 production at various times under anaerobic condition. The significant differences (p ≤ 0.05) among groups (Duncan’s multiple range test) are indicated by different letters above the bar. Data represent mean ± SD, n=3\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$n=3$$\end{document}
Repeated cycles of H2 yield of immobilized cells; Chlorella sp. (•), F. muscicola TISTR 8215 (▼) and co-culture (▲) of Chlorella sp. (initial biomass concentration = 0.025 g L⁻¹) and F. muscicola TISTR 8215 (initial biomass concentration = 0.5 g L⁻¹), in agar cubes (0.8% w/v). The agar cubes cut into specific size, 0.5 cm × 0.5 cm × 0.5 cm, were transferred into vial glasses with 2-mL agar cubes, incubated under anaerobic condition, and continuously illuminated with 40 µmol photons m⁻² s⁻¹ for H2 measurement. Data represent mean ± SD, n=3\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$n=3$$\end{document}
Article
N2-fixing cyanobacteria are highly promising microorganisms for sustained and improved H2 production. Among various N2-fixing cyanobacteria that have ability to produce H2, Fischerella muscicola TISTR 8215 is a promising strain with high potential for H2 production. The production of H2 by the two microorganisms, i.e., cyanobacteria and microalgae was investigated to improve photobiological H2 production. The results showed that co-culturing the green microalga Chlorella sp. (initial biomass concentration = 0.025 g L⁻¹, 5% algal culture) with dominant cyanobacterium F. muscicola TISTR 8215 (initial biomass concentration = 0.5 g L⁻¹, 95% cyanobacterial culture) increased total accumulated H2 yield about 1.5-fold compared to the monoculture of F. muscicola TISTR 8215. However, the decrease of accumulated H2 yield was observed when increasing initial cell concentration of Chlorella sp. to initial biomass concentration = 0.125 g L⁻¹ in co-cultivation system. Notably, the co-immobilization of F. muscicola TISTR 8215/Chlorella sp. in 0.8% (w/v) agar led to a 11-fold increase in maximum H2 yield of 13.2 mmol H2 L⁻¹ compared to the co-culture with no immobilization. In addition, the co-immobilization of F. muscicola TISTR 8215 and Chlorella sp. in agar cubes was able to prolong biohydrogen production for 3 cycles up to 324 h. The overall results demonstrated the improvement of H2 production by co-cultivation of F. muscicola TISTR 8215 and Chlorella sp. under optimized conditions.
 
Article
The in-field protein production of four macroalgae (Gracilariopsis vermiculophylla, Gracilaria gracilis, Gracilariopsis longissima, Ulva australis) and three seagrasses (Cymodocea nodosa, Zostera marina, Zostera noltei) was investigated in four transitional water systems over one year. The protein content in macroalgae ranged from 1.0 to 25.1% and was inversely related with water temperature. The annual protein production was the highest for G. longissima (500 g dw m −2 year −1), followed by G. vermiculophylla (350 g dw m −2 year −1), U. australis (33 g dw m −2 year −1) and G. gracilis (270 g dw m −2 year −1). The most productive months spanned between March and August for G. longissima and between December and May for G. vermiculophylla, reaching 78% and 85% of the annual production, respectively. The protein production was more uniform over the year for the other two macroalgae. The protein production in seagrasses was averagely from 3.4 to 12 times lower than in macroalgae and reached 77.8 g m −2 year −1 in C. nodosa, followed by Z. marina with 55.6 g m −2 year −1 and Z. noltei with 30.6 g m −2 year −1. The peak production between April and August accounted for 63-98% of the annual production. Rhizomes displayed the lowest protein contents (1.2-3.4%), almost half in comparison with leaves (2.3-5.1%) and the lowest protein production with 21.0 g m −2 year −1 for C. nodosa, 6.3 g m −2 year −1 for Z. marina and 9.0 g m −2 year −1 for Z. noltei. Aquatic macrophyte productions proved to be competitive with the main crops currently cultivated on land without competing in terms of land and freshwater destination. The challenge is still open on the front of digestibility and protein extraction but sustainable management and production of macrophytes (especially macroalgae) can significantly contribute to the global protein production in coastal areas.
 
Article
Phycocyanin is a water-soluble, blue-colored phycobiliprotein mainly found in cyanobacteria and Rhodophyta. Major commercial interest exists on phycocyanin as an important ingredient for food, pharmaceutical and cosmetics applications. Despite the common interest from industry, there is no dedicated method for optimized extraction of phycocyanin from different species. Yet, biomass type and choice of pretreatment have major influences on the extraction yield and final purity of phycocyanin. Various impurities such as cell debris and other photosynthetic pigments also decrease the quality of extracted phycocyanin. In this study, wet and lyophilized biomass samples from several cyanobacteria (including a local isolate) and a red microalga species were harvested and pretreated with bead-beating, mortar and pestle homogenization, freeze–thaw cycling and sonication techniques. High concentration yielding phycocyanin extracted from Phormidium sp., Synechocystis sp., Desertifilum tharense, Nostoc sp., and Galdieria sulphuraria were purified by ammonium sulfate fractionation combined with acetate buffer elution method. Bead-beating was found to be the most efficient pretreatment technique for the extraction of phycocyanin from the majority of tested biomass samples. Phycocyanin from Synechocystis sp. and Phormidium sp. was further purified with anion exchange chromatography. Overall, food grade phycocyanin (purity ratio A620/A280 > 0.7) extraction was achieved for all tested biomass samples except Scytonema sp. Biomass samples from Synechocystis sp. yielded analytical grade phycocyanin (purity ratio > 4), one of the highest values observed in literature.
 
Daily settlement percentage (means ± SE) of sandfish Holothuria scabra after introduction to settlement substrates with different cues. *Common superscripts represent statistically similar (p ≥ 0.05) means among treatments for a given day
Cumulative settlement percentage (means ± SE) of sandfish Holothuria scabra after introduction to settlement substrates with different cues. *Common superscripts represent statistically similar (p ≥ 0.05) means among treatments for a given day
Means ± SE of final settlement percentage of sandfish Holothuria scabra on settlement substrates with different cues. *Common superscripts represent statistically similar (p ≥ 0.05) means among treatments for a given day
Article
The settlement of sea cucumbers is a crucial phase of larval development because the highest mortality occurs at this stage. Substrates and cues are commonly used to induce larval settlement. Commercial algae and live benthic diatoms are the most common settlement cues being used. The present study evaluated Chaetoceros calcitrans concentrate as a potential settlement cue for H. scabra. Three settlement cues, replicated three times, were compared: commercial ‘Spirulina’, live benthic diatom Navicula sp., and C. calcitrans concentrate. Settlement substrates without cue served as control. ‘Spirulina’ paste and C. calcitrans concentrate were painted onto the settlement substrates, while settlement substrates were introduced into a Navicula sp. culture tank to enable attachment of the benthic diatom. Faster and higher settlement was observed in the treatment with ‘Spirulina’ paste as cue at 89% five days post introduction of substrates, compared with live Navicula sp. and C. calcitrans concentrate at 74% and 63% seven days post introduction, respectively. For the control, only 25% of the larvae have settled eight days after introduction to the substrates. ‘Spirulina’ paste and live Navicula sp. showed better settlement rates, but these were not significantly different compared with C. calcitrans concentrate. Therefore, C. calcitrans concentrate can be a potential settlement cue for H. scabra larvae.
 
Effects of Ulva lactuca and Saccharina latissima alkaline extracts on Albugo disease severity (a and c) and vegetative mass (b and d) in Arabidopsis thaliana. Extract concentrations are; 1 = raw, 2 = 1:2 dilution of raw extract, 4 = 1:4, 8 = 1:8 and 16 = 1:16. Cw is control treatment with water. Inserts above bars give the significance of coefficients from linear models comparing the added effect of extract relative to the control (* P < 0.05, ** P < 0.01, ***P < 0.001, ns P > 0.05)
Effects of Ulva lactuca and Saccharina latissima alkaline extracts on Albugo disease severity (a and e), vegetative mass (b and f), timing of flowering (c and g) reported as days after the first plant in the experiment flowered, and seed mass (d and h) in Arabidopsis thaliana. Extracts were based on U. lactuca samples from May (May), July (Jul) and September (Sep) and from S. latissima samples from May (May), August (Aug), November (Nov) and February (Feb). Controls included water (Cw) and neutralized NaOH (Ca). Different letters indicate significant difference in a multiple comparison test (Tukeys HSD, P < 0.05)
Article
Recent evidence suggests that seaweed extracts can protect plants against microbial disease by upregulating the host’s immune system. However, if this upregulation comes at a cost to host vegetative and reproductive growth it will make the use of seaweed extracts in crop disease protection less attractive. In a series of experiments, using Arabidopsis thaliana infected by white rust (Albugo sp.) and treated with crude extracts of Ulva lactuca and Saccharina latissima, we test the hypothesis that a growth-immunity trade-off exists. We include temporal samples of the two seaweed species because the composition of bioactive molecules in them is known to vary over the year. Our results confirm that extracts of both species have the potential to protect against disease, but that both the timing of seaweed sampling and extraction procedures can introduce considerable variation to this effect. Importantly, these seaweed treatments were also associated with reduced host vegetative mass, though treatment with S. latissima could compensate for this as it also stimulated increased seed mass. We conclude that the effects of crude seaweed extracts from U. lactuca and S. latissima on plant fitness are not immediately predictable, and benefits in terms of disease protection may come with costs.
 
Article
Under nitrogen deprivation (-N), cell growth and protein synthesis of Synechocystis sp. PCC 6803 were inhibited but production of glycogen (GL) and poly-3-hydroxybutyrate (PHB) was enhanced, indicating the importance of -N for increasing the production of such bioproducts. Upon transition from N-deprived to N-supplied medium, GL and PHB were utilized for cell growth recovery. Here, we systematically disrupted the biosynthesis of GL, PHB and/or H2 and examined changes on amount of the remaining bioproducts. Disruption of PHB synthesis increased H2 evolution rate up to 1.7-fold under -N. Disruption of GL synthesis increased PHB level up to 1.4-fold, but did not affect H2 production under -N. Cellular NAD(P)H was elevated 1.6-fold after the disruption of GL synthesis, and by 3.6-fold after the disruption of both GL and PHB synthesis under -N. The double disruption of GL and PHB, GL and H2, or PHB and H2, significantly affected the initial (day 0–4) growth rate upon switching from -N to nitrogen repletion (+N). Under -N to +N condition at day 0–4, the disrupted synthesis of both GL and PHB significantly decreased the levels of total proteins, phycobilins, carotenoids, and chlorophyll a by 32%, 44%, 47%, and 59%, respectively. Thus, both PHB and GL storage are likely required for normal growth, as well as for the maximal production of proteins and photosynthetic pigments upon growth recovery under nitrogen repletion. The results demonstrated that the cyanobacterial production of GL, PHB, H2, NAD(P)H, and proteins can be affected by the disruption of metabolically connected biosynthetic pathway(s).
 
Bioactivities of phlorotannins
Phlorotannin Extraction methods
Article
Phlorotannins, a seaweed based class of polyphenolic compounds, have proven to possess potential bioactivities such as antioxidant, antimicrobial, anti-allergic, anti-diabetic, anti-inflammatory, anti-cancerous, neuroprotection etc. These bioactivities have further increased demand globally and sustainable techniques such as supercritical fluid extraction, microwave assisted extraction, enzyme assisted extraction, extraction using deep eutectic solvents etc. are being explored currently for production of phlorotannin-rich extracts. In spite of such well documented bioactivities, very few phlorotannin-based nutraceuticals are available commercially which highlights the significance of generating consumer awareness about their physiological benefits. However, for industry level commercialization accurate quantification of phlorotannins with respect to the different classes is vital requiring sophisticated analytical techniques such as mass spectrometry, ¹H-NMR spectroscopy etc. owing to the wide structural diversity. This review summarizes the extraction and bioactivities of phlorotannins based on the findings of in vivo and in vitro studies.
 
ATR-FTIR spectra of the dried algal powders from Sargassumhorneri (A) and Ulvapertusa (B). The terms Sh and Up indicate the profile using dried powders; ShE and UpE indicate aqueous extracts; ShEt and UpEt indicate ethanolic extracts
DPPH radical scavenging (A), O2⁻ radical scavenging (B), Fe-reducing power (C), and antiglycation activity in the BSA-fructose model (D), and the BSA-methylglyoxal model (E) using 2% aqueous extract solutions of Sh and Up. Values indicate the mean ± SEM (n = 3).
Principal component analysis (PCA; A), PCA biplot based on ASV level (B), enrichment at phylum (C), family (E), and genus (F) levels in caecal microbiota of mice fed a high-sucrose and low-fibre diet containing no fibre (NF), 5% (w/w) dried Sargassumhorneri (Sh) and Ulvapertusa (Up). (D) The Firmicutes/Bacteroidota ratio (F/B). Significant differences relative to the NF group using Dunnett’s test (↑↓ p < 0.05). *Significant different relative to the NF group using Dunnett’s test (p < 0.05)
Based on the ASV level of caecum bacteria communities, Linear discriminant analysis (LDA) effect size taxonomic cladogram (A), and heat map analysis of the top 30 selected abundant ASVs (B) in caecal microbiota of mice fed a high-sucrose and low-fibre diet containing no fibre (NF), 5% (w/w) dried Sargassumhorneri (Sh) and Ulvapertusa (Up) are shown. a−c Values with different alphabet letters indicate significant differences identified using Tukey’s test at p < 0.05. Significant difference relative to the NF group using Dunnett’s test (↑↓, p < 0.05)
Differences in the pathway profiles using Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis
modified by LEfSe (p < 0.01) for caecal microbiota in mice fed a high sucrose-containing diet with no fibre (n = 5) and 5% (w/w) Sargassumhorneri (n = 5)
Article
Outbreaks of algal blooms for Sargassumhorneri and Ulva spp., called golden and green tides on the South Korean coast, severely damage the local coastal environment and marine ecological system. However, these edible algae are natural resources of beneficial bioactive components, such as dietary fibres, phenolic compounds, and minerals. In this study, the antioxidant and anti-glycation properties of 2% aqueous extract solution (AES) in vitro from S.horneri (Sh) and Ulvapertusa (Up), and the effects of dried S.horneri and Up on the caecal microbiota of mice fed a high-sucrose and low-fiber diet were investigated. Total phenolic content, antioxidant activity (DPPH radical scavenging and Fe-reducing power), and anti-glycation activity in the BSA-fructose model were higher in Sh-AES than in Up-AES groups. Male Institute of Cancer Research (ICR) mice fed a 5% (w/w) S.horneri diet for 14 days showed a reduced increase in body weight. 16S rDNA (V4) amplicon sequencing results showed that the ratio of Firmicutes/Bacteroidota was reduced after S.horneri and U.pertusa intake. Faecalibaculumrodentium-, Akkermansiamuciniphila-, and Roseburiaintestinalis-like bacteria were enriched in the S.horneri group. Phocaeicolavulgatus-like bacteria were abundant in both the S.horneri and U.pertusa groups. In contrast, the prevalence of Clostridiumdisporicum-like bacteria was low in mice fed the S.horneri diet. Among the bacteria enriched after S.horneri and U.pertusa administration, P.vulgatus was found to be prevalent. From these results, S.horneri from golden tides may be useful as a functional food.
 
Specific Growth Rate (A) and biomass yield (B) of Ulva spp. cultivated in the six experimental treatments. For treatment description, see Table 1, and for a description of the hypotheses tested and the statistical results, see Table 2. Dark grey bars represent nitrate-based treatments, and light grey bars represent ammonium-based treatments. Bars represent mean values (n = 3 tanks treatment⁻¹), and error bars represent standard deviations. Due to degradation of the Ulva spp. in treatment D, we were unable to derive valid measurements, resulting in no bar shown for treatment D
Tissue content (tissue nitrogen and phosphorus, % of dry matter, and tissue N:P and C:N molar ratio) of Ulva spp. cultivated in the six experimental treatments. For treatment description, see Table 1, and for a description of the hypotheses tested and the statistical results, see Table 2. Dark grey bars represent nitrate-based treatments, and light grey bars represent ammonium-based treatments. Bars represent mean values (n = 3 tanks treatment⁻¹), and error bars represent standard deviations. Due to degradation of the Ulva spp. in treatment D, we were unable to derive valid measurements, resulting in no bar shown for treatment D
Nitrogen (A) and Phosphorus (B) removal rate (µmol g⁻¹ dry matter day⁻¹) of Ulva spp. cultivated in the six experimental treatments. For treatment description, see Table 1, and for a description of the hypotheses tested and the statistical results, see Table 2. Dark grey bars represent nitrate-based treatments, and light grey bars represent ammonium-based treatments. Bars represent mean values (n = 3 tanks treatment⁻¹), and error bars represent standard deviations. Due to degradation of the Ulva spp. in treatment D, we were unable to derive valid measurements, resulting in no bar shown for treatment D.
Phosphorus surge uptake (µmol g⁻¹ fresh weight hour⁻¹) for Ulva spp. exposed to either high (5 mmol L⁻¹) or moderate (0.5 mmol L⁻¹) nitrate concentration. Bars represent mean values (n = 4 tanks treatment⁻¹) and error bars standard deviations. Treatments did not differ significantly (p < 0.05).
Article
The growth, tissue content and nutrient removal rates of Ulva spp., when exposed to moderate to high nitrogen (0.5–5 mmol L ⁻¹ ) and phosphorus (0.01–0.9 mmol L ⁻¹ ) concentrations, were examined to get a better understanding of recirculating IMTA (Integrated Multi-Trophic Aquaculture) systems with fish and seaweed. It was hypothesized that fish waste effluents might lead to unfavorable nutrient stoichiometry and/or toxic conditions, which might harm seaweeds and, specifically for the present study, reduce Ulva spp. performance. Results demonstrate that: (I) the unfavorable N:P stoichiometry (N:P ≠ Atkinson atomic ratio of 30:1) did not restrict Ulva spp. growth nor tissue content; this indicates that supply of both nutrients exceeded the minimum requirements; (II) a high orthophosphate concentration (0.9 mmol L ⁻¹ ) was toxic to Ulva spp. , whereas (III) a high nitrate concentration (5 mmol L ⁻¹ ) did not inhibit phosphorus uptake; (IV) Ulva ’s growth was not enhanced when nitrate was exchanged for similarly high ammonium concentrations. However, tissue nitrogen content was 1.4 times higher when exposed to ammonium than nitrate, suggesting that the former N-form was stored faster in the seaweed’s tissue. Therefore, other factors must have limited growth with the high ammonium concentrations. This study also highlights the importance of relatively long acclimatization periods (one week) when maintenance uptake (V m ) is evaluated, as surge uptake (V s ) may result in considerably different and more variable rates. Results of this study contribute to a better understanding of the application of Ulva spp. as extractive component in closed IMTA systems, thus advancing sustainable and circular production techniques.
 
Nitrogen-fixing cyanobacterial isotope ¹⁵N labeling device diagram. The experimental device mainly included a gas storage bag used to balance the air pressure of the system; a glass incubator box was used for the closed culture of nitrogen-fixing cyanobacteria; and a photosynthetic respirator was mainly used to determine the CO2 concentration in the system
Changes in total nitrogen (TN), available phosphorus (AP) and soil organic carbon (SOC) contents of soil from different treatments. The columns with different colors represent different treatment groups. CK: no ¹⁵N-labeled NFC; C5: half application of ¹⁵N-labeled fresh NFC = 7.5 g NFC pot⁻¹; C10: full application of ¹⁵N-labeled fresh NFC = 15 g NFC pot⁻¹; HC10: full application of high temperature inactivated ¹⁵N-labeled NFC = 15 g NFC pot⁻¹. The error bars represent the standard deviation from four replicates. Different lowercase letters above the columns indicate significant (p < 0.05) differences between treatments
Distribution of ¹⁵N content in rice tissues. The columns with different colors represent different treatment groups. CK: no ¹⁵N-labeled NFC; C5: half application of ¹⁵N-labeled fresh NFC = 7.5 g NFC pot⁻¹; C10: full application of ¹⁵N-labeled fresh NFC = 15 g NFC pot⁻¹; HC10: full application of high temperature inactivated ¹⁵N-labeled NFC = 15 g NFC pot⁻¹. The error bars represent the standard deviation from four replicates. Different lowercase letters above the columns indicate significant (p < 0.05) differences between treatments
Distribution of ¹⁵N content in soil at different depths. The columns with different colors represent different treatment groups. CK: no ¹⁵ N-labeled NFC; C5: half application of ¹⁵N-labeled fresh NFC = 7.5 g NFC pot⁻¹; C10: full application of ¹⁵N-labeled fresh NFC = 15 g NFC pot⁻¹; HC10: full application of high temperature inactivated ¹⁵N-labeled NFC = 15 g NFC pot⁻¹. The error bars represent the standard deviation from four replicates. Different lowercase letters above the columns indicate significant (p < 0.05) differences between treatments
Proportion of nitrogen from nitrogen-fixing cyanobacteria (NFC-N) in plant uptake, soil retention and losses in different treatments. The colors in the columns represent the different distributions of ¹⁵N from nitrogen-fixing cyanobacteria in the rice field
Article
Nitrogen-fixing cyanobacteria (NFC) play an important role in maintaining the N pool of paddy fields, but few studies have been conducted on the N fate of NFC, especially during the vegetative growth period of rice. Revealing the fate of N from NFC (NFC-N) is of great significance for the application of NFC in rice fields. A pot experiment with ¹⁵N-labeled NFC was carried out to determine the ¹⁵N contents in rice plants and soil under different NFC application patterns. Four treatments were set up in the experiment: 1) CK: no ¹⁵N-labeled NFC applied; 2) C5: half application of ¹⁵N-labeled fresh NFC = 7.5 g NFC pot⁻¹; 3) C10: full application of ¹⁵N-labeled fresh NFC = 15 g NFC pot⁻¹; 4) HC10: full application of high temperature inactivated ¹⁵N-labeled NFC = 15 g NFC pot⁻¹. The results showed that NFC-N was detected in the roots, stems, and leaves of rice in the C5, C10 and HC10 treatments, but the amount of NFC-N absorbed by rice plants in these treatments was much less than the total N accumulated in the rice plants (including N absorbed from soil and irrigation water, etc.) during the vegetative growth period. Soil nutrients were mainly retained in topsoil due to the slow-release effect of NFC, accounting for 57–71% of the NFC-N application. A total of 17–32% of NFC-N was lost from the rice pot system, and the loss of NFC-N in the HC10 treatment was significantly higher than that in the C10 treatment. Therefore, this study suggested that NFC as biofertilizer should be combined with chemical N fertilizer to achieve a more optimized management effect of nitrogen fertilizers. Fresh NFC should be applied when conditions permit, which would be more beneficial to improve soil nutrient contents.
 
The cell dry weight (CDW) of A. platensis NIES-39 cultivated under different concentrations of (a) ASP and (b) MSG after 12 cultivation days. Note. ASP: Aspartic acid; MSG: Monosodium glutamate; Medium: Zarrouk, pH: 9; Temperature: 28 ± 2 °C; Continuous illumination of 300 μmol photons m⁻² s⁻¹ white LED. The points are shown as the mean ± standard deviation (n = 3)
The contents of (a) phycocyanin and (b) carotenoids of A. platensis NIES-39 were cultivated under different concentrations of ASP and MSG on 12 days of cultivation. Note. ASP: Aspartic acid; MSG: Monosodium glutamate; Medium: Zarrouk; pH: 9; Temperature: 28 ± 2 °C; Continuous illumination of 300 μmol photons m⁻² s⁻¹ white LED. The points are represented as the mean ± standard deviation (n = 3)
Integrated pathway map of the quantitative regulation of amino acids, fatty acids, phycocyanin, carotenoids, and chlorophyll in the medium supplemented with different (a) ASP and (b) MSG concentrations visualized by VANTED. Note. ASP: Aspartic acid; MSG: Monosodium glutamate; VANRED: Visualization and analysis of networks containing experimental data; Glc: Glucose; G-6-P: Glucose 6-phosphate; R-5-P: Ribose 5-phosphate; G-3-P: Glyceraldehyde 3-phosphate; PEP: Phosphoenolpyruvate; Crm: Chorismate; Prpn: Prephenate; Arn: Anthranilate; Pyr: Pyruvate; ATCoA: Acetyl Coenzyme A; SFA: Saturated fatty acids; MUFA: Monounsaturated fatty acids; PUFA: Polyunsaturated fatty acids; UFA: Unsaturated fatty acids; OAA: Oxaloacetate; α-Keto: α-Ketoglutarate; Succ: Succinate; ALA: δ-Aminolevulinic acid. Data are represented as the mean ± standard deviation (n = 3)
Correlation-based networks of amino acids and fatty acids indicate the metabolite-metabolite correlation in the medium supplemented with different concentrations of (a) ASP and (b) MSG, respectively. Note. ASP: Aspartic acid; MSG: Monosodium glutamate. Pearson’s correlation was used to estimate correlation coefficients, followed by applying threshold tests for correlation coefficients (R) and p-values to detect significant correlations. In addition, thresholds were set for p ≤ 0.05. Further, positive and negative correlations are illustrated as blue and red edges, respectively
Schematic summary of the TCA cycle and its variants in cyanobacteria and its relation to other cellular metabolite production pathways. Note. TCA: Tricarboxylic acid; (1) The closing reaction (without the glyoxylate shunt) of the incomplete cyanobacterial TCA cycle (AspAT shunt) – pink broken arrows. (2) the GABA shunt – broken green arrows; (3) The citrate-malate shunt – orange broken arrows; (4) Cyanobacterial complete TCA cycle shunt – broken violet arrows; TCA cycle intermediates are colored blue. In addition, the cross colored in red depicts the lack of OGDH in cyanobacteria. OGDH: 2-oxoglutarate dehydrogenase; AspAT: Aspartate aminotransferase; AlaAT: Alanine aminotransferase; GABA-T: GABA aminotransferase; GAD: Glutamate decarboxylase; CL: Citrate lyase; OADC: Oxaloacetate decarboxylase; OGDC: 2-oxoglutarate decarboxylase; SSADH: Succinic semialdehyde dehydrogenase; ALA: δ-aminolevulinic acid
Article
The suitable conditions for hyperaccumulation of high-value compounds are the considerably challenging approach for more heightened productivity in Arthrospira platensis. The current study was designed to explore the co-production of pigments and high-value metabolites with varying concentrations of metabolic stressors in A. platensis. The maximum biomass production was attained in the medium supplemented with 0.25% monosodium glutamate (MSG) and 2% aspartate (ASP) increases of 65.12% and 49.41%, respectively, compared to control on the 12th day cultivation. Supplementing media with 0.50% MSG and 2% ASP increased phycocyanin productivity by 80.51% and 55.34%, while 0.50% MSG and 2% ASP boosted chlorophyll content by 101.63% and 119.24%, respectively, compared to the control. Nevertheless, 1.50% MSG and 0.50% ASP increased carotenoids content by 178.70% and 128.50%, respectively. In addition, 1.50% ASP and 0.25% MSG stimulated the accumulation of unsaturated fatty acid, especially oleic acid, by 193.99% and biosynthesis of essential amino acid by 1120.14% compared to control, respectively. These adaptations may be due to an increase in microalgae growth or the improvement in the de novo synthesis metabolite. Network correlation analysis pointed an active trade-off to proteins or fatty acid biosynthesis suggesting the distinct metabolite abundance and metabolic networks linked to pigments production in A. platensis. These findings provide important data for future metabolic engineering in A. platensis.
 
Algal response to tolerate high salt stress
Conceptual diagram that shows the clustering of C. reinhardtii cells (Palmelloid stage) upon salt stress
Schematic diagram showing miRNA regulation under UV stress in Chlamydomonas
Role of phytohormones in abiotic stress conditions
Two-stage cultivation of algae to enhance pigment and lipid production
Article
High salinity, nutrient deficiency, heavy metals, desiccation, temperature fluctuations, and ultraviolet radiations are major abiotic stress factors considered inhospitable to algal growth and development in natural and artificial environments. All these stressful conditions cause effects on algal physiology and thus biochemical functioning. For instance, long-term exposure to hyper/hypo salinity conditions inhibits cell differentiation and reduces growth. Photosynthesis is completely blocked in algae's dehydrated state, resulting in photoinhibition or photodamage. The limitation of nutrients in aquatic environments inhibits primary production via regulating phytoplankton community development and structure. Hence, in response to these stressful conditions, algae develop plenty of cellular, physiological, and morphological defences to survive and thrive. The conserved and generalized defence responses in algae include the production of secondary metabolites, desaturation of membrane lipids, activation of reactive species scavengers, and accumulation of compatible solutes. Moreover, a well-coordinated and timely response to such stresses involves signal perception and transduction mainly via phytohormones that could sustain algae growth under abiotic stress conditions. In addition, the combination of abiotic stresses and plant hormones could further elevate the biosynthesis of metabolites and enhance the ability of algae to tolerate abiotic stresses. This review aims to present different kinds of stressful conditions confronted by algae and their physiological and biochemical responses, the role of phytohormones in combatting these conditions, and, last, the future transgenic approaches for improving abiotic stress tolerance in algae.
 
Relative expression of genes related to the immune system (pen, px, propo, tgase) in L. vannamei hemocytes fed with feed supplemented with different strains of S. elongatus PCC 7942. CON: shrimp fed only commercial feed; PCC7942: shrimp fed commercial feed with S. elongatus PCC 7942; AMBGL17: shrimp fed commercial feed with S. elongatus AMBGL17. Data are expressed as mean ± standard error from four independent replicates. Different letters represent statistically significant differences (p < 0.05)
Relative expression of genes related to antioxidant defense system (gpx and sod) in L. vannamei muscle fed with feed supplemented with different strains of S. elongatus PCC 7942. CON: shrimp fed only commercial feed; PCC7942: shrimp fed commercial feed with S. elongatus PCC 7942; AMBGL17: shrimp fed commercial feed with S. elongatus AMBGL17. Data are expressed as mean ± standard error from four independent replicates. Different letters represent statistically significant differences (p < 0.05)
Relative expression of genes related to digestion (amy, chymo, tryp, cathB and lip) in L. vannamei hepatopancreas fed with feed supplemented with different strains of S. elongatus PCC 7942. CON: shrimp fed only commercial feed; PCC7942: shrimp fed commercial feed with S. elongatus PCC 7942; AMBGL17: shrimp fed commercial feed with S. elongatus AMBGL17. Data are expressed as mean ± standard error from four independent replicates. Different letters represent statistically significant differences (p < 0.05)
Relative expression of genes related to amino acid metabolism (gdh and gs) in L. vannamei hepatopancreas fed with feed supplemented with different strains of S. elongatus PCC7942. CON: shrimp fed only commercial feed; PCC7942: shrimp fed commercial feed with S. elongatus PCC7942; AMBGL17: shrimp fed commercial feed with S. elongatus AMBGL17. Data are expressed as mean ± standard error from four independent replicates. Different letters represent statistically significant differences (p < 0.05)
Lipid vacuoles count in L. vannamei hepatopancreas. CON: shrimp fed only commercial feed; PCC7942: shrimp fed commercial feed with S. elongatus PCC7942; AMBGL17: shrimp fed commercial feed with S. elongatus AMBGL17. Data are expressed as mean ± standard error from four independent replicates. Different letters represent statistically significant differences (p < 0.05)
Article
Cyanobacteria are a rich source of nutrients in addition to producing bioactive compounds capable of stimulating the immune system of hosts. Also, they can be manipulated with relative ease to produce heterologous proteins. In the present study, a strain of Synechococcus elongatus (PCC7942) was manipulated to produce a prokaryotic β-glucosidase. This strain was added to the diet of Pacific white shrimp Litopenaeus vannamei for 45 days and parameters such as growth performance, proximate composition of muscle tissue and expression of genes related to digestion, amino acid metabolism, immune system and antioxidant defenses were evaluated. Histology of shrimp hepatopancreas was also performed. Transgenic cyanobacteria did not produce negative effects on shrimp growth performance. Regarding proximate composition, an increase in lipid and phosphorus deposition was observed in the muscle of shrimp, as well as lipid in hepatopancreas. Furthermore, an increase in expression of genes related to the immune system (tgase) as well as carbohydrate metabolism and amino acid metabolism (gdh) was observed. It was observed also that both strains of cyanobacteria (wild and transgenic) produced effects on carbohydrate metabolism (increased amy expression) and digestive system (decreased cathB expression). It is possible that cyanobacteria in the diet may be serving as a source of carbohydrates, reducing the use of proteins as a source of energy. It can be concluded that transgenic cyanobacteria had a beneficial effect on shrimp by increasing lipid deposition in muscle and hepatopancreas as well as phosphorus absorption from feed, which can minimize the environmental impact of shrimp farms.
 
Scheme of the vegetative structures of Vertebrata thallus (on the example of V. fucoides). AC, apical cell; AS, axial segment; CC, central cell; N, nucleus; PC, pericentral cell; T, trichoblast; V, vacuole
Scheme of the reproductive structures and life history of Vertebrata (on the example of V. fucoides). CB, carpogonial branch; CC, cystocarp; CS, carpospore; CSR, carposporangium; FG, female gametophyte; MG, male gametophyte; P, procarp; S, spermatium; SS, spermatangium sorus; T, tetrasporophyte; TR, trichogyne; TS, tetraspore; TSR, tetrasporangium
Distribution of Vertebrata lanosa and V. fucoides (based on the online resources: https://www.algaebase.org, https://www.marinespecies.org, https://obis.org). For the findings of V. lanosa in the Red Sea, the Persian Gulf, and along the Indian coast, see comments in the text
Abundant growth of Vertebrata lanosa on the thalli of Ascophyllum nodosum (photo by E. Tarakhovskaya). Scale 10 cm
Secondary metabolites of Vertebrata: bromophenolic compounds, mycosporine-like amino acids, and organosulfur compounds (Wickberg 1957; Glombitza and Stoffelen 1972; Chevolot-Magueur et al. 1976; Glombitza et al. 1985; Scholz et al. 2016; Lalegerie et al. 2019; Lever et al. 2019; Hofer et al. 2019)
Article
The red algal genus Vertebrata (Ceramiales, Rhodophyta) comprises 30 species of rather small filamentous algae, differing in morphology, distribution, and ecological preferences. In this review we focus on the two most studied Vertebrata species, V. lanosa and V. fucoides. These occur predominantly in cold and temperate waters on the North Atlantic coasts. Both species have recently gained attention due to their specific secondary metabolites, having considerable pharmaceutical potential and also due to their high capacity to accumulate heavy metals and radionuclides. The review summarizes the data on taxonomy, anatomy, cytology, genetics, ecology, distribution, and potential practical application of Vertebrata species. Special emphasis is on the biochemical composition of V. lanosa and V. fucoides, including their specific metabolites, such as bromophenols, organosulfur compounds, and mycosporine-like amino acids. In addition, the biochemistry and ecology of V. lanosa is discussed in the context of its increasing popularity as a spice (“sea truffle”) in several world cuisines.
 
Article
Photoacclimation of two Chlorella cultures – strain g-120 characterised by a reduced size of light-harvesting antenna complex (LHC) and strain R-117 with full antenna size was studied during 5-day outdoor trials. The aim was to correlate the functional and structural changes in the photosynthetic apparatus to culture growth, photochemical activity and thylakoid composition of chlorophyll (Chl)-protein complexes and corresponding polypeptides. Chlorella g-120 was characterized by a low Chl/biomass ratio (< 0.5% of dry weight), about four times lower compared to Chlorella R-117. The important observation was that the high molecular mass Chl-binding protein supercomplexes, i.e. Photosystem II (PSII) and Photosystem I (PSI) cores associated with LHCs were physically missing or negligible in Chlorella g-120. However, there were no visible changes in Chl-protein composition in the g-120 strain during its acclimation to phototrophic conditions. Measurement of the effective absorption cross-section of PSII centres confirmed a markedly reduced functional antenna size in Chlorella g-120 as compared to R-117 which coincided with the absence of the PSII-LHC supercomplexes. We demonstrated that Chlorella g-120 represents a typical reduced antenna-size strain due to its Chl-protein composition. As compared to the full-antenna Chlorella R-117 strain, the outdoor cultures of Chlorella g-120 showed significantly lower oxygen production and electron transport rate measured in-situ. On the contrary, Chlorella g-120 revealed increased futile energy dissipation via non-photochemical quenching and higher respiration compared to Chlorella R-117. Consequently, the potential use of microalgae strains with reduced LHCII for outdoor mass cultivation may not be as straightforward as anticipated from laboratory experiments.
 
Article
Endophytic bacteria associated with medicinal plants from Himalayan mountains possess great biotechnological potential. However, the influence of these Himalayan bacterial endophytes (HBE) on microalgal-promotion and metabolite production is still largely unknown. In this study, the interactions between two endophytic bacterial isolates of an endangered Himalayan medicinal plant and long-chain fatty acids accumulating green alga Micractinium sp. GA001 are characterized in synthetic co-culture systems. The endophytes Staphylococcus pasteuri PPE11 and Yersinia enterocolitica PPE118 significantly enhance microalgal cell numbers with 56% and 49% increase in total chlorophyll content, respectively. Co-culturing microalgae with these endophytes demonstrated distinct responses toward photosynthesis at different temperatures. Endophytes were metabolically active for an extended time (more than 28 days) in co-culturing. The findings were further complemented with genomics studies of endophytes which were subjected to multiple sequencing approaches to assemble and annotate their genomes, resulting in key genes involved in PGP activities, metabolites production and transportation being identified. This study expands the benefits and bioprocessing potential of endophytes of Himalayan medicinal plants.
 
Averaged oxygen production rates at different sulfide concentrations, (A) Set A of experiments (in 2019) and (B) Set B of experiments (in 2020)
Performance comparison of the empirical kinetic model (Eq. 12) with the model Michaelis–Menten-like enhancement-inhibition function (Eq. 4)
Article
A new empirical model for the net oxygen production rate of an alkaliphilic microalgae consortium (AMC) with prominent members of Picochlorum sp. and Pseudoanabaena sp was developed as a function of sulfide at concentrations up to 1.50 mM. The kinetic model consists of a non-continuous function with two domains for sulfide concentration, which describes the enhancement and the inhibition of net photosynthetic oxygen roduction. Small doses of sulfide can foster the photosynthetic activity evaluated by a Gaussian type of kinetic model; while, at a total sulfide concentration higher than 1.00 mM, the photosynthetic activity was inhibited following a linear inverse response. This study shows that small sulfide concentrations around 0.60 mM improved the photosynthetic activity by up to 90% compared to assays without sulfide. Moreover, the sulfide influence on the oxygenic photosynthetic activity of the AMC was confirmed after one year, suggesting that the kinetic model could be helpful for the design and operation of photobioreactors to improve the performance of microalgae cells exposed to hydrogen sulfide.
 
Effect of ECPs on viability and NO production by LPS-induced RAW264.7 macrophages. Cells were exposed to ECPs for 24 h followed by LPS stimulation for 24 h. (A) Cell viability was determined using the MTT assay, with the data expressed as the percentage viability relative to LPS group (100%). (B) NO production was determined by measuring nitrite using the Griess assay, with the results expressed as the percentage nitrite release as compared to the nitrite produced by cells stimulated by LPS only. (C) NO production by unstimulated cells versus that by LPS stimulated cells. Results are presented as mean ± SEM (n = 3). #p < 0.05 for the LPS group versus the control group; *p < 0.05 for the experimental groups versus the LPS group. (Abbreviations: ECPs, polyphenol-enriched ethyl acetate fraction of U. clathrata; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide; NO, nitric oxide; LPS, lipopolysaccharide)
Effect of U. clathrata derived polyphenols ROS production by LPS-induced RAW264.7 macrophages. Cells were exposed to ECPs or the individual constituents for 24 h, followed by LPS stimulation for 30 min. Intracellular ROS level was monitored by measuring the fluorescence intensity of DCFH-DA with fluorescence microscopy (A), and flow cytometry (B). The results were expressed as the percentage fluorescence intensity as compared to the fluorescence intensity of non-exposed and unstimulated cells. Data are shown as mean ± SEM (n = 3). #p < 0.05 for the positive control (cells stimulated by LPS only) and experimental groups versus the negative control (non-exposed and unstimulated cells); *p < 0.05 for the experimental groups versus the positive control. (Abbreviations: ROS, reactive oxygen species; LPS, lipopolysaccharide; ECPs, polyphenol-enriched ethyl acetate fraction of U. clathrata; HQ, hydroquinone; GA, gallic acid; EGC, (-)-epigallocatechin; EC, (-)-epicatechin; EGCG, (-)-epigallocatechin-3-O-gallate; ECG, epicatechin-3-O-gallate)
Effect of U. clathrata derived polyphenols on anti-oxidant enzyme activity and MDA levels in LPS-induced RAW264.7 macrophages. Cells were exposed to ECPs or the individual polyphenols for 24 h, followed by LPS stimulation for 12 h. Activities of CAT (A), GSH-Px (B) and MDA levels (C) were determined using commercial kits. Data are shown as mean ± SEM (n = 3). #p < 0.05 for the positive control (cells stimulated by LPS only) and experimental groups versus the negative control (non-exposed and unstimulated cells); *p < 0.05 for the experimental groups versus the positive control. (Abbreviations: LPS: lipopolysaccharide; ECPs, polyphenol-enriched ethyl acetate fraction of U. clathrata; EC, (-)-epicatechin; EGCG, (-)-epigallocatechin-3-O-gallate; ECG, epicatechin-3-O-gallate; CAT, catalase; GSH-Px, glutathione peroxidase; MDA, malondialdehyde)
Effect of U. clathrata derived polyphenols on gene expression of oxidative stress related indicators in LPS-treated RAW264.7 macrophages. Cells were exposed to ECPs or the individual polyphenols for 24 h, followed by LPS stimulation for 0, 3, 6, 12, 24 h. Gene expression of Nrf2 (A) and HO-1 (B) was analyzed by qPCR using the ddCT method. Data are expressed as relative quantification (RQ) values for the experimental groups normalized against the RQ values of non-exposed cells. Data are shown as mean ± SEM (n = 3). #p < 0.05 for the positive control (cells stimulated by LPS only) versus the negative control (non-exposed and unstimulated cells); *p < 0.05 for the experimental groups versus the positive control. (Abbreviations: LPS: lipopolysaccharide; ECPs, polyphenol-enriched ethyl acetate fraction of U. clathrata; EC, (-)-epicatechin; EGCG, (-)-epigallocatechin-3-O-gallate; ECG, epicatechin-3-O-gallate; HO-1, hemeoxygenase-1; Nrf2, nuclear factor-like erythroid 2-related factor 2)
Effect of U. clathrata derived polyphenols on HO-1 expression and nuclear translocation of Nrf2 in LPS-induced RAW264.7 macrophages. Cells were exposed to ECPs or the individual polyphenols for 24 h, followed by LPS stimulation for 12 h. The expression of Nrf2 and HO-1 in cytoplasm and the expression of Nrf2 protein in nucleus were detected by Western blot. (Abbreviations: LPS: lipopolysaccharide; ECPs, polyphenol-enriched ethyl acetate fraction of U. clathrata; EC, (-)-epicatechin; EGCG, (-)-epigallocatechin-3-O-gallate; ECG, epicatechin-3-O-gallate; Nrf2, nuclear factor-like erythroid 2-related factor 2, HO-1: hemeoxygenase-1)
Article
Ulva clathrata is a common edible seaweed along the southeast coast of China and has been widely considered beneficial for human health. In the present study we extracted polyphenols from U. clathrata, to investigate their antioxidant activity using both chemical methods and the cell-based bioassays. The results showed that polyphenol-enriched ethyl acetate fraction of U. clathrata (ECPs) and each of the six separated individual polyphenols had potent scavenging capacity for 2,2-diphenyl-1-picrylhydrazyl (DPPH) and 2,2’-azinobis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) free radicals, as well as ferric reducing capacity, in comparison with vitamin C. The antioxidant ability of the polyphenols with the same number of benzene was positively proportional to the number of phenolic hydroxyl groups. The cell-based bioassays demonstrated that exposure to lipopolysaccharide (LPS) induced excess production of oxidative stress-related molecules, including reactive oxygen species (ROS), nitric oxide (NO) and malondialdehyde (MDA), which was significantly attenuated by the pretreatment of ECPs and three individual polyphenols, i.e., (-)-epicatechin (EC), epigallocatechin-3-O-gallate (EGCG) and (-)-epicatechin-3-O-gallate (ECG). These protective effects were shown to be achieved via activation of nuclear factor erythroid-2 related factor (Nrf2)-mediated signaling pathway, and subsequent up-regulated production and/or activity of antioxidant enzymes including heme oxygenase 1 (HO-1), catalase (CAT) and glutathione peroxidase (GSH-Px). The findings of this study suggest the potential of U. clathrata as a promising natural source of antioxidant polyphenols, and also provide a theoretical basis for their application in diverse fields related to antioxidant functions.
 
Top-cited authors
Michael A Borowitzka
  • Murdoch University
René H Wijffels
  • Wageningen University & Research
Siew-Moi Phang
  • University of Malaya
Alison G Smith
  • University of Cambridge
Susan Brawley
  • University of Maine