BMC Genetics

Published by BioMed Central
Publications
Primers and Fluorgenic Probes for -102C>T MnSOD Allelic Discrimination
Fluorescence ratios of FAM-labeled/VIC-labeled fluorogenic probes specific for -102C>T polymorphism in MnSOD. Each bar represents mean 
 standard error for determinations in DNA from 3 human subjects. Open bar represents DNA samples homozygous for -102C. Solid bars represent DNA samples homozygous for -102T. Crossed bars represent DNA samples heterozygous for the SNP. The fluorescence ratios differed significantly (p < 0.05) among homozygous and heterozygous genotypes.
Manganese superoxide dismutase (MnSOD) plays a critical role in the detoxification of mitochondrial reactive oxygen species constituting a major cellular defense mechanism against agents that induce oxidative stress. The MnSOD promoter contains an activator protein-2 (AP-2) binding site that modifies transcription of MnSOD. Mutations have been identified in the proximal region of the promoter in human tumor cell lines. One of these mutations (-102C>T) has been shown to change the binding pattern of AP-2 leading to a reduction in transcriptional activity. The aim of our study was to develop a method to identify and determine the frequency of this (-102C>T) polymorphism in human tissues. A new TaqMan allelic discrimination genotype method was successfully applied to genomic DNA samples derived from blood, buccal swabs, snap frozen tissue and paraffin blocks. The polymorphism was shown to be in Hardy-Weinberg Equilibrium in an evaluation of 130 Caucasians from Warsaw, Poland: 44 (33.8%) were heterozygous and 6 (4.6%) were homozygous for -102T. This report represents the first description of the MnSOD -102C>T polymorphism in human subjects by a novel Taqman allelic discrimination assay. This method should enable molecular epidemiological studies to evaluate possible associations of this polymorphism with malignancies and other diseases related to reactive oxygen species.
 
Cognitive Ageing Candidate Genes (expressed in the brain).
Score on Raven's Matrices by APP rs2830102 genotype, sex and cohort (LBC1921 or ABC1936): A) raw data; B) estimated marginal means from general linear model, adjusted for age 11 MHT score.
Non-pathological cognitive ageing is a distressing condition affecting an increasing number of people in our 'ageing society'. Oxidative stress is hypothesised to have a major role in cellular ageing, including brain ageing. Associations between cognitive ageing and 325 single nucleotide polymorphisms (SNPs), located in 109 genes implicated in oxidative stress and/or cognition, were examined in a unique cohort of relatively healthy older people, on whom we have cognitive ability scores at ages 11 and 79 years (LBC1921). SNPs showing a significant positive association were then genotyped in a second cohort for whom we have cognitive ability scores at the ages of 11 and 64 years (ABC1936). An intronic SNP in the APP gene (rs2830102) was significantly associated with cognitive ageing in both LBC1921 and a combined LBC1921/ABC1936 analysis (p < 0.01), but not in ABC1936 alone. This study suggests a possible role for APP in normal cognitive ageing, in addition to its role in Alzheimer's disease.
 
Association analysis in the extended T1D family set.
Association analysis in the 1,693 T1D patients and 1,805 controls from the UK.
The PAPD1-MAP3K8 gene region on chromosome 10. Tracks indicate (from top to bottom): position in the human genome chromosome 10, NCBI build 34; annotated genes; regions where resequencing of the amplified fragments has been attempted; sequenced BAC clones; SNPs identified in the clone overlaps; polymorphisms genotyped in up to 765 UK and USA families with two affected offspring; SNP rs or ss numbers; a plot showing -log(P-value) for association in up to 765 families with red line at 1.3 corresponding to P = 0.05; linkage disequilibrium (LD) plots for SNPs with minor allele frequency > 0.1 showing pairwise LD by colour ranging from red (high D') or dark green (high r2), indicating strong LD, to white, indicating weak or no LD between SNPs. LD plots have been generated using Haploview [27].
In an effort to locate susceptibility genes for type 1 diabetes (T1D) several genome-wide linkage scans have been undertaken. A chromosomal region designated IDDM10 retained genome-wide significance in a combined analysis of the main linkage scans. Here, we studied sequence polymorphisms in 23 Mb on chromosome 10p12-q11, including the putative IDDM10 region, to identify genes associated with T1D. Initially, we resequenced the functional candidate genes, CREM and SDF1, located in this region, genotyped 13 tag single nucleotide polymorphisms (SNPs) and found no association with T1D. We then undertook analysis of the whole 23 Mb region. We constructed and sequenced a contig tile path from two bacterial artificial clone libraries. By comparison with a clone library from an unrelated person used in the Human Genome Project, we identified 12,058 SNPs. We genotyped 303 SNPs and 25 polymorphic microsatellite markers in 765 multiplex T1D families and followed up 22 associated polymorphisms in up to 2,857 families. We found nominal evidence of association in six loci (P = 0.05 - 0.0026), located near the PAPD1 gene. Therefore, we resequenced 38.8 kb in this region, found 147 SNPs and genotyped 84 of them in the T1D families. We also tested 13 polymorphisms in the PAPD1 gene and in five other loci in 1,612 T1D patients and 1,828 controls from the UK. Overall, only the D10S193 microsatellite marker located 28 kb downstream of PAPD1 showed nominal evidence of association in both T1D families and in the case-control sample (P = 0.037 and 0.03, respectively). We conclude that polymorphisms in the CREM and SDF1 genes have no major effect on T1D. The weak T1D association that we detected in the association scan near the PAPD1 gene may be either false or due to a small genuine effect, and cannot explain linkage at the IDDM10 region.
 
Technological advances have lead to the rapid increase in availability of single nucleotide polymorphisms (SNPs) in a range of organisms, and there is a general optimism that SNPs will become the marker of choice for a range of evolutionary applications. Here, comparisons between 300 polymorphic SNPs and 14 short tandem repeats (STRs) were conducted on a data set consisting of approximately 500 Atlantic salmon arranged in 10 samples/populations. Global FST ranged from 0.033-0.115 and -0.002-0.316 for the 14 STR and 300 SNP loci respectively. Global FST was similar among 28 linkage groups when averaging data from mapped SNPs. With the exception of selecting a panel of SNPs taking the locus displaying the highest global FST for each of the 28 linkage groups, which inflated estimation of genetic differentiation among the samples, inferred genetic relationships were highly similar between SNP and STR data sets and variants thereof. The best 15 SNPs (30 alleles) gave a similar level of self-assignment to the best 4 STR loci (83 alleles), however, addition of further STR loci did not lead to a notable increase assignment whereas addition of up to 100 SNP loci increased assignment. Whilst the optimal combinations of SNPs identified in this study are linked to the samples from which they were selected, this study demonstrates that identification of highly informative SNP loci from larger panels will provide researchers with a powerful approach to delineate genetic relationships at the individual and population levels.
 
Infestations on cattle by the ectoparasite Boophilus (Rhipicephalus) microplus (cattle tick) impact negatively on animal production systems. Host resistance to tick infestation has a low to moderate heritability in the range 0.13 - 0.64 in Australia. Previous studies identified a QTL on bovine chromosome 10 (BTA10) linked to tick burden in cattle. To confirm these associations, we collected genotypes of 17 SNP from BTA10, including three obtained by sequencing part of the ITGA11 (Integrin alpha 11) gene. Initially, we genotyped 1,055 dairy cattle for the 17 SNP, and then genotyped 557 Brahman and 216 Tropical Composite beef cattle for 11 of the 17 SNP. In total, 7 of the SNP were significantly (P < 0.05) associated with tick burden tested in any of the samples. One SNP, ss161109814, was significantly (P < 0.05) associated with tick burden in both the taurine and the Brahman sample, but the favourable allele was different. Haplotypes for three and for 10 SNP were more significantly (P < 0.001) associated with tick burden than SNP analysed individually. Some of the common haplotypes with the largest sample sizes explained between 1.3% and 1.5% of the residual variance in tick burden. These analyses confirm the location of a QTL affecting tick burden on BTA10 and position it close to the ITGA11 gene. The presence of a significant association in such widely divergent animals suggests that further SNP discovery in this region to detect causal mutations would be warranted.
 
Region of conserved synteny of human Chr2-13-14 and mouse prox Chr11 Orthologous genes of human and mouse and their positions on the respective physical map are shown except for Kiaa0570 and Kiaa0729, which could not be mapped with radiation hybrids. Mouse orthologs for ELP and PX19 are not located within the investigated region. Gene order of HCC8 and UGP2 is based on our STS/EST mapping and sequence analysis. Gene order between human and mouse is conserved in three sections; the proximal and distal sections show the same orientation whereas the central section is inverted between the two species. The central part of the figure including the inverted section is shown slightly enlarged. For orientation, positions of microsatellites D2S2225 and D2S147 (human) and D11Mit19, D11Mit294 and D11Mit343 (mouse) are indicated. Blue arrows show orientation and relative genomic sizes of genes, the arrowhead points to the 3' end. Yellow bars represent chromosomal regions covered by YAC or BAC contigs. Red overlays show sequenced sections (human: public draft sequence, mouse: BACs sequenced by our group, AC091422, AC091423, AC091424, AC091428, AC091419, AC091420, AC091421). Green bars indicate the genomic clones (YAC ymWIBR100H6, *; BAC 135B4, §), which cover Kiaa0903 and Hspc159. Approximate distances are given in Kb for human Chr2p13-14, in cM for mouse prox Chr11.
To support the positional cloning of the mouse mutation wobbler (wr) the corresponding regions on human Chr2p13-14 and mouse Chr11 were analyzed in detail and compared with respect to gene content, order, and orientation. The gene content of the investigated regions was highly conserved between the two species: 20 orthologous genes were identified on our BAC/YAC contig comprising 4.5 Mb between REL/Rel and RAB1A/Rab1a. Exceptions were pseudogenes ELP and PX19 whose mouse counterparts were not located within the analyzed region. Two independently isolated genomic clones indicate an inversion between man and mouse with the inverted segment being identical to the wobbler critical interval. We investigated the wobbler critical region by extensive STS/EST mapping and genomic sequencing. Additionally, the full-length cDNA sequences of four newly mapped genes as well as the previously mapped gene Otx1 were established and subjected to mutation analysis. Our data indicate that all genes in the wr critical region have been identified. Unexpectedly, neither mutation analysis of cDNAs nor levels of mRNAs indicated which of the candidate genes might be affected by the wr mutation. The possibility arises that there might be hitherto unknown effects of mutations, in addition to structural changes of the mRNA or regulatory abnormalities.
 
The Alaskan sled dog offers a rare opportunity to investigate the development of a dog breed based solely on performance, rather than appearance, thus setting the breed apart from most others. Several established breeds, many of which are recognized by the American Kennel Club (AKC), have been introduced into the sled dog population to enhance racing performance. We have used molecular methods to ascertain the constitutive breeds used to develop successful sled dog lines, and in doing so, determined the breed origins of specific performance-related behaviors.One hundred and ninety-nine Alaskan sled dogs were genotyped using 96 microsatellite markers that span the canine genome. These data were compared to that from 141 similarly genotyped purebred dog breeds. Sled dogs were evaluated for breed composition based on a variety of performance phenotypes including speed, endurance and work ethic, and the data stratified based on population structure. We observe that the Alaskan sled dog has a unique molecular signature and that the genetic profile is sufficient for identifying dogs bred for sprint versus distance. When evaluating contributions of existing breeds we find that the Alaskan Malamute and Siberian Husky contributions are associated with enhanced endurance; Pointer and Saluki are associated with enhanced speed and the Anatolian Shepherd demonstrates a positive influence on work ethic. We have established a genetic breed profile for the Alaskan sled dog, identified profile variance between sprint and distance dogs, and established breeds associated with enhanced performance attributes. These data set the stage for mapping studies aimed at finding genes that are associated with athletic attributes integral to the high performing Alaskan sled dog.
 
Two-point linkage analysis for the Heavy Drinking (HD) category under the dominant and the recessive model (HLOD) and model-free analysis (MALOD)
Two-point linkage analysis for the RDC alcoholism (RDCA) category under the dominant and the recessive model (HLOD) and model-free analysis (MALOD)
In order to confirm a previous finding of linkage to alcoholism on chromosome 1 we have carried out a genetic linkage study. DNA from eighteen families, densely affected by alcoholism, was used to genotype a set of polymorphic microsatellite markers at loci approximately 10 centimorgans apart spanning the short arm and part of the long arm of chromosome 1. Linkage analyses were performed using the classical lod score and a model-free method. Three different definitions of affection status were defined, these were 1. Heavy Drinking (HD) where affected subjects drank more than the Royal College of Psychiatrists recommended weekly amount. 2. The Research Diagnostic Criteria for alcoholism (RDCA) 3. Alcohol Dependence Syndrome (ADS) as defined by Edwards and Gross (1976) and now incorporated into ICD10 and DSMIV. Linkage analyses with the markers D1S1588, D1S2134, D1S1675 covering the cytogenetic region 1p22.1-11.2 all gave positive two point and multipoint lods with a maximum lod of 1.8 at D1S1588 (1p22.1) for the RDCA definition of alcoholism. Another lod of 1.8 was found with D1S1653 in the region 1q21.3-24.2 using the HD affection model. These results both support the presence of linkage in the 1p22.1-11.2 region which was previously implicated by the USA Collaborative Study of the Genetics of Alcoholism (COGA) study and also suggest the presence of another susceptibility locus at 1q21.3-24.2.
 
PCR primers used in PCR-SSCP analysis to identify heterozygosity in genomic DNA samples from abortuses.
Genomic imprinting of the SLC22A1LS gene: A) diagrammatic representation of SLC22A1L and SLC22A1LS genes; positions of the primer set 22F-22R are marked by arrow heads. B) PCR-SSCP analysis of genomic DNA samples from 17 abortuses (no. 2 to no. 18) with the primer set 22F-22R; two abortuses, no. 2 and no. 9 are heterozygous for a nucleotide change. C) Direct sequence analysis of the PCR product with the primer 22F from the abortus no. 2 showing a G>A change at nucleotide position 473 (c.473G>A) marked by an arrow. D) PCR-SSCP analysis of genomic DNA samples from a control individual (N), abortus no. 2 (2), mother of the abortus no. 2 (M), and cDNA samples from lungs (L), liver (Li), brain (B), kidneys (K) and placenta (P). Note, only one allele 473G is expressed in five tissues analyzed. Since the abortus is heterozygous and the mother is homozygous, the imprinted allele 476A in the abortus should have come from its father. E) PCR-SSCP analysis of genomic DNA samples from a control individual (N), abortus no. 9 (9), mother of the abortus no. 9 (M), and cDNA samples from lungs (L), liver (Li), brain (B), and kidneys (K). Note, only one allele 473G is expressed in all four tissues analyzed, corroborating the finding from the abortus no. 2. Since both the mother and the abortus are heterozygous, it is not possible to determine the parental origin of the expressed allele.
Genomic imprinting is an epigenetic chromosomal modification in the gametes or zygotes that results in a non-random monoallelic expression of specific autosomal genes depending upon their parent of origin. Approximately 44 human genes have been reported to be imprinted. A majority of them are clustered, including some on chromosome segment 11p15.5. We report here the imprinting status of the SLC22A1LS gene from the human chromosome segment 11p15.5 In order to test for allele specific expression patterns, PCR primer sets from the SLC22A1LS gene were used to look for heterozygosity in DNA samples from 17 spontaneous abortuses using PCR-SSCP and DNA sequence analyses. cDNA samples from different tissues of spontaneous abortuses showing heterozygosity were subjected to PCR-SSCP analysis to determine the allele specific expression pattern. PCR-SSCP analysis revealed heterozygosity in two of the 17 abortuses examined. DNA sequence analysis showed that the heterozygosity is caused by a G>A change at nucleotide position 473 (c.473G>A) in exon 4 of the SLC22A1LS gene. PCR-SSCP analysis suggested that this gene is paternally imprinted in five fetal tissues examined. This study reports the imprinting status of the SLC22A1LS gene for the first time. The results suggest imprinting of the paternal allele of this gene in five fetal tissues: brain, liver, placenta, kidneys and lungs.
 
Summary of single SNP results from case-control-and family-based tests.
Graphical Assessment of sliding p-values for all tests performed on SNPs 1–303 in the family-based data with prioritized regions of association signal (labelled A-C).
Graphical Assessment of sliding p-values for all tests performed on SNPs 304–609 in the family-based data with prioritized regions of association signal (labelled D-E).
Detailed overview of the first three regions with strongest association signals (regions A-C in Figure 1) for case-control- and family-based tests along with SNP and known gene locations. Color coding of p-values are as presented in Figure 1.
Detailed overview of the final two regions with strongest association signals (regions D-E in Figure 2) for case-control- and family-based tests along with SNP and known gene locations. Color coding of p-values are as presented in Figure 1.
Past work on asthmatic African American families revealed a strong linkage peak with modest evidence of association on chromosome 11q. Here, we perform tests of association for asthma and a panel of 609 SNPs in African American subjects using a sliding window approach. While efficient in screening a region of dense genotyping, this approach does create some problems: high numbers of tests, assimilating thousands of results, and questions about setting priorities on regions with association signals. We present a newly developed tool, Graphical Assessment of Sliding P-values or GrASP, which uses color display to indicate the width of the sliding windows, significance of individual tests, density of SNP coverage and location of known genes that simplifies some of these issues, and use it to identify regions of interest in these data. We demonstrate that GrASP makes it easier to visualize, summarize and prioritize regions of interest from sliding window haplotype analysis, based jointly on the p-value from all the tests from these windows and the building of haplotypes of significance in the region. Using this approach, five regions yielded strong evidence for linkage and association with asthma, including the prior peak linkage region.
 
DGAT2 is a promising candidate gene for obesity because of its function as a key enzyme in fat metabolism and because of its localization on chromosome 11q13, a linkage region for extreme early onset obesity detected in our sample. We performed a mutation screen in 93 extremely obese children and adolescents and 94 healthy underweight controls. Association studies were performed in samples of up to 361 extremely obese children and adolescents and 445 healthy underweight and normal weight controls. Additionally, we tested for linkage and performed family based association studies at four common variants in the 165 families of our initial genome scan. The mutation screen revealed 15 DNA variants, four of which were coding non-synonymous exchanges: p.Val82Ala, p.Arg297Gln, p.Gly318Ser and p.Leu385Val. Ten variants were synonymous: c.-9447A > G, c.-584C > G, c.-140C > T, c.-30C > T, IVS2-3C > G, c.812A > G, c.920T > C, IVS7+23C > T, IVS7+73C > T and *22C > T. Additionally, the small biallelic trinucleotide repeat rs3841596 was identified. None of the case control and family based association studies showed an association of investigated variants or haplotypes in the genomic region of DGAT2. In conclusion, our results do not support the hypothesis of an important role of common genetic variation in DGAT2 for the development of obesity in our sample. Anyhow, if there is an influence of genetic variation in DGAT2 on body weight regulation, it might either be conferred by the less common variants (MAF < 0.1) or the detected, rare non-synonymous variants.
 
Summary of clinical data on deafness in five Chinese pedigrees carrying a heteroplasmic A1555G mutation
Summary of genetic and molecular data for 5 Chinese families carrying the heteroplasmy A1555G mutation
Five Chinese pedigrees with aminoglycoside-induced and non-syndromic hearing impairment. Hearing-impaired individuals are indicated by filled symbols. Arrow denotes probands. The heteroplasmy level is marked below the identifiers.
Air conduction audiogram of 5 affected probands with the A1555G mutation and one Chinese control. Symbols: X—left ear, O—right ear.
Direct sequencing analysis of the A1555G. Peaks arrow denoted represented wild-type allele and mutation-type allele at 1555 loci with different heteroplasmy level. The heteroplasmy level were marked aside the arrow.
Mitochondrial cytopathies are characterized by a large variability of clinical phenotypes and severity. The amount of mutant mitochondrial DNA (mtDNA) in a cell, called the heteroplasmy level, is an important determinant of the degree of mitochondrial dysfunction and therefore disease severity. Understanding the distribution of heteroplasmy levels across a group of offspring is an important step in understanding the inheritance of diseases. Recently, the mtDNA A1555G mutation was found to be associated with non-syndromic and drug-induced hearing loss. Here, we report five pedigrees with multiple members having the A1555G mutation and showing diverse clinical manifestations and different heteroplasmy levels. Clinical evaluations revealed that the hearing impairment phenotypes varied with respect to the severity of hearing loss, age of onset of hearing loss, and pattern of audiometric configuration. These five Chinese pedigrees had different penetrance of hearing loss, ranging from 10-52%. A molecular study showed that the average heteroplasmy rates of the five pedigrees were 31.98% (0-91.35%), 78.28% (32.8-96.08%), 87.99% (82.32-94.65%), 93.34% (91.02-95.05%), and 93.57% (91.38-94.24%). There was no gradual tendency of heteroplasmy to increase or decrease along with transmission. A study of the relationship between clinical features and genetic background found that the percentage of deafness was 0 when the heteroplasmy level was less than 50%, 25% when the heteroplasmy level was 50-80%, 47.06% when the heteroplasmy level was 80-90%, and 57.58% when the heteroplasmy level exceeded 90%. The risk of deafness rose with the heteroplasmy level. The results suggest that there are large random shifts in the heteroplasmy level between mothers and offspring with the A1555G mutation; heteroplasmy could disappear randomly when the heteroplasmy level of the pedigree was low enough, and no regular pattern was found. The heteroplasmy level may be one of the factors influencing the penetrance of deafness caused by the mtDNA A1555G mutation.
 
Waved with open eyelids 2 (woe2) is a novel autosomal recessive mouse mutation that arose spontaneously in our animal facility. Upon initial evaluation, mutant mice exhibited eyelids open at birth (EOB) and wavy fur phenotypes. The goals of this study were to phenotypically characterize the woe2 mice and to identify the gene harboring the mutation responsible for the woe2 phenotype. Histological analysis of woe2 embryos identified the failure of embryonic eyelid closure. Clinical and histological analysis of woe2 adult eyes identified severe corneal opacities, abnormalities of the anterior segment of the eye, and the absence of meibomian glands. Abnormalities in the fur texture and the absence of meibomian glands prompted us to evaluate other epidermal appendages: skin, teeth, and nails--as well as lacrimal, mammary, salivary, sebaceous and sweat glands. No obvious morphological differences between WT and woe2 mice were identified in these tissues. However, the analysis of woe2 identified cardiac abnormalities. Positional cloning of the woe2 locus identified a 1308 bp deletion in the Ppp1r13l gene. The deletion resulted in an aberrant Ppp1r13lΔexon9-11 transcript that lacks exons 9, 10 and 11 resulting in a premature stop and a loss of 223 amino acids from the C-terminal end of the putative mutant PPP1R13L protein. Immunohistological analysis during eye development identified expression of PPP1R13L in the palpebral epidermis, palpebral and bulbar conjunctiva, corneal epithelium and meibomian glands. The woe2 mouse harbors a novel deletion within the Ppp1r13l gene, likely resulting in a complete loss of PPP1R13L function. Results from this study provide evidence that PPP1R13L has an essential role in embryonic eyelid closure as well in development of meibomian glands and the anterior segment of the eye. The woe2 mice are a useful model for investigation of the role of PPP1R13L, especially during ocular and eyelid development.
 
Results (-log p-value) for unified Haseman-Elston analysis of derived baseline and slope phenotypes.
Results (-log p-value) for new simulated data. Rows 1 and 2 correspond to data simulated under model (1) and rows 3 and 4 to data simulated under model (2). Derived baseline and slope phenotypes were analyzed using four different regression methods.
A variety of Haseman-Elston type regression procedures were used to perform a genome scan across five chromosomes, using replicates 1-5 of the Genetic Analysis Workshop 13 simulated data. The traits of interest were variables corresponding to 'baseline' and 'slope' effects derived from the fasting glucose phenotypes. Performance in terms of detecting the locations of known trait loci was poor for all methods, even when all five replicates were combined to produce a large data set (9230 sib pairs). All methods performed well, however, when applied to new simulated data in which the true genetic effects were allowed to explain a greater proportion of the overall variance.
 
Molecular and cytogenetic markers are of great use for to fish characterization, identification, phylogenetics and evolution. Multigene families have proven to be good markers for a better understanding of the variability, organization and evolution of fish species. Three different tandemly-repeated gene families (45S rDNA, 5S rDNA and U2 snDNA) have been studied in Plectorhinchus mediterraneus (Teleostei: Haemulidae), at both molecular and cytogenetic level, to elucidate the taxonomy and evolution of these multigene families, as well as for comparative purposes with other species of the family. Four different types of 5S rDNA were obtained; two of them showed a high homology with that of Raja asterias, and the putative implication of a horizontal transfer event and its consequences for the organization and evolution of the 5S rDNA have been discussed. The other two types do not resemble any other species, but in one of them a putative tRNA-derived SINE was observed for the first time, which could have implications in the evolution of the 5S rDNA. The ITS-1 sequence was more related to a species of another different genus than to that of the same genus, therefore a revision of the Hamulidae family systematic has been proposed. In the analysis of the U2 snDNA, we were able to corroborate that U2 snDNA and U5 snDNA were linked in the same tandem array, and this has interest for tracing evolutionary lines. The karyotype of the species was composed of 2n = 48 acrocentric chromosomes, and each of the three multigene families were located in different chromosome pairs, thus providing three different chromosomal markers. Novel data can be extracted from the results: a putative event of horizontal transfer, a possible tRNA-derived SINE linked to one of the four 5S rDNA types characterized, and a linkage between U2 and U5 snDNA. In addition, a revision of the taxonomy of the Haemulidae family has been suggested, and three cytogenetic markers have been obtained. Some of these results have not been described before in any other fish species. New clues about the genome organization and evolution of the multigene families are offered in this study.
 
Parameter estimates for quantitative trait segregation analyses of sex-adjusted height
Discrete (qualitative) data segregation analysis may be performed assuming the liability model, which involves an underlying normally distributed quantitative phenotype. The appropriateness of the liability model for complex traits is unclear. The Genetic Analysis Workshop 13 simulated data provides measures on systolic blood pressure, a highly complex trait, which may be dichotomized into a discrete trait (hypertension). We perform segregation analysis under the liability model of hypertensive status as a qualitative trait and compare this with results using systolic blood pressure as a quantitative trait (without prior knowledge at that stage of the true underlying simulation model) using 1050 pedigrees ascertained from four replicates on the basis of at least one affected member. Both analyses identify models with major genes and polygenic components to explain the family aggregation of systolic blood pressure. Neither of the methods estimates the true parameters well (as the true model is considerably more complicated than those considered for the analysis), but both identified the most complicated model evaluated as the preferred model. Segregation analysis of complex diseases using relatively simple models is unlikely to provide accurate parameter estimates but is able to indicate major gene and/or polygenic components in familial aggregation of complex diseases.
 
The data for Problem 1 come from the Framingham Heart Study, centered in Framingham, Massachusetts. Originating in 1948, the Framingham Heart Study is an ongoing prospective study of risk factors for cardiovascular disease. Two cohorts have been recruited into the Study and a third cohort is currently being recruited. The Genetic Analysis Workshop 13 data set consists of genotyping information from a 10-cM genome scan along with phenotypic information on a number of phenotypes collected from the first 21 examinations of the original cohort and the first 5 examinations of the offspring cohort.
 
Distribution and heritability of SBP slope for Framingham data
Multipoint LOD score profiles for chromosome 21 in the complete and missing simulated data sets, using Method 1 and Method 2
Systolic blood pressure (SBP) is an age-dependent complex trait for which both environmental and genetic factors may play a role in explaining variability among individuals. We performed a genome-wide scan of the rate of change in SBP over time on the Framingham Heart Study data and one randomly selected replicate of the simulated data from the Genetic Analysis Workshop 13. We used a variance-component model to carry out linkage analysis and a Markov chain Monte Carlo-based multiple imputation approach to recover missing information. Furthermore, we adopted two selection strategies along with the multiple imputation to deal with subjects taking antihypertensive treatment. The simulated data were used to compare these two strategies, to explore the effectiveness of the multiple imputation in recovering varying degrees of missing information, and its impact on linkage analysis results. For the Framingham data, the marker with the highest LOD score for SBP slope was found on chromosome 7. Interestingly, we found that SBP slopes were not heritable in males but were for females; the marker with the highest LOD score was found on chromosome 18. Using the simulated data, we found that handling treated subjects using the multiple imputation improved the linkage results. We conclude that multiple imputation is a promising approach in recovering missing information in longitudinal genetic studies and hence in improving subsequent linkage analyses.
 
Results of RFLP-PCR with Mbo- II digestion in G6PD deficient subjects. Lane 1: 100 bp size marker; lanes: 5, 9–13, 15–20: 563C-T mutation.
Results of RFLP-PCR with Bcl-I digestion in G6PD deficient individuals. Lane 1:100 bp size marker; lane2, 7: 1311T polymorphism.
Nucleotide 1311 polymorphism at exon 11 of G6PD gene is widely prevalent in various populations of the world. The aim of the study was to evaluate 1311 polymorphism in subjects carrying G6PD Mediterranean gene and in general population living in Pakistan. Patients already known to be G6PD deficient were tested for 563C-T (G6PD Mediterranean) and 1311 C-T mutation through RFLP based PCR and gene sequencing. A control group not known to be G6PD deficient was tested for 1311C/T only.C-T transition at nt 1311 was detected in 60/234 X-chromosomes with 563 C-T mutation (gene frequency of 0.26) while in 130 of normal 402 X-chromosomes (gene frequency of 0.32). We conclude that 1311 T is a frequent polymorphism both in general populations and in subjects with G6PD Mediterranean gene in Pakistan. The prevalence is higher compared to most of the populations of the world. The present study will help in understanding genetic basis of G6PD deficiency in Pakistani population and in developing ancestral links of its various ethnic groups.
 
Graphical representation of expression levels of PHPHL in tumor tissues by genotype. Del/del = homozygous for deletion variant, del/ins = heterozygous, ins/ins = homozygous for insertion variant.
PCR detection of deletion or insertion of PSPHL gene. The forward primer that detects the deletion allele spans the deletion breakpoint on chromosome 7p and the primer pair amplifies a 793 bp fragment. The primers that detect the insertion product amplify a 208 bp fragment from exon 1 of PSPHL. Genotypes shown here are A = del/del, B = del/del, C = ins/del, D = ins/ins, and E = ins/del. Primers used are (all in 5′-3′ direction - insertion forward: AGGCTCCCTGGCTGGC, insertion reverse: CAGGCTCAGGTGAGGCG, deletion forward: AAGCCAGTGCGTCTACAGGTG, deletion reverse: GTGCCAGAAGAACCACACAGTC.
between retention or absence of 30 Kb region of chromosome 7p and clinicopathological factors by ethnic group
Phophoserine phosphatase-like (PSPHL) is expressed at significantly higher levels in breast tumors from African American women (AAW) compared to Caucasian women (CW). How overexpression of PSPHL contributes to outcome disparities is unclear, thus, molecular mechanisms driving expression differences between populations were evaluated. PCR was used to detect deletion of 30-Kb of chromosome 7p11 including the first three exons of PSPHL using genomic DNA from AAW (199 with invasive breast cancer, 360 controls) and CW (invasive breast cancer =589, 364 controls). Gene expression levels were evaluated by qRT-PCR using RNA isolated from tumor tissue and blood. Data were analyzed using chi-square analysis and Mann-Whitney U-tests; P < 0.05 was used to define significance. Gene expression levels correlated with deletion status: patients homozygous for the deletion had no detectable expression of PSPHL, while heterozygous had expression levels 2.1-fold lower than those homozygous for retention of PSPHL. Homozygous deletion of PSPHL was detected in 61% of CW compared to 6% of AAW with invasive breast cancer (P < 0.0001); genotype frequencies did not differ significantly between AAW with and without breast cancer (P = 0.211). Thus, deletion of 7p11, which prevents expression of PSPHL, is significantly higher in CW compared to AAW, suggesting that this 30-kb deletion and subsequent disruption of PSPHL may be a derived trait in Caucasians. The similar frequency of the deletion allele in AAW with and without invasive breast cancer suggests that this difference represent population stratification, and does not contribute to cancer disparities.
 
Characteristics of the 79T > C MIR133A2 variant. (A) Sequence electropherograms with arrows indicating normal 79T allele (top panel) and variant 79C allele (lower panel). (B) Family KB pedigree. Phenotypes are indicated as: AF (solid symbols), no AF (open symbols). The presence (+) or absence (−) of the 79T > C MIR133A2 variant is shown and the family proband is indicated by an arrow. (C) Stem-loop region of precursor miR-133a-2 transcript depicting the most abundant human isomiRs for miR-133a-3p (green) and miR-133a-5p (blue) with seed regions indicated (bold). The 79T > C variant (red) is located at the 3′end of miR-133a-3p directly adjacent to the Drosha cleavage site. (D) Northern blot probed with miR-133a-3p (top panel) and miR-133a-5p (lower panel) showing expression levels of 79T and 79C alleles. Mean data for triplicates of each sample are indicated on bar graphs with 79C values expressed relative to 79T values. *P <0.05 when compared to 79T.
Abundance of miR-133a 5′ isomiRs in atrial tissue. MiR-133a-3p (green) and miR-133a-5p (blue) isomiRs were evaluated by deep sequencing of human (A) and murine (B) atrial tissues. 5′ isomiRs affect the seed sequences and are considered functionally more important than 3′ isomiRs. The most abundant 5′ isomiRs, with the most frequently-occurring 3′variant for each of these, are shown. MirBase-annotated miR-133a-3p and 5p sequences are shown in black with ‘seed’ regions (nt 2–8) underlined. Note that there is no miRBase annotation for human miR-133a-5p. (C) Venn diagram showing numbers of human target mRNAs predicted by TargetScan with the seed regions of the 2 most abundant human miR-133a-3p isomiRs and the single abundant miR-133a-5p isomiR used as inputs. (D) (Left panel) Murine target mRNAs predicted by TargetScan with seed regions of the 2 abundant murine miR-133a-3p isomiRs and single abundant miR-133a-5p isomiRs as inputs. (Right panel) Venn diagram showing numbers of putative miR-133a-3p and miR-133a-5p target mRNAs determined by cross-referencing predicted murine targets with genes demonstrated to be differentially regulated in the hearts of miR-133a knockout mice
[22].
Functional analysis of human miR-133a-3p and miR-133a-5p targets. Significant associations were found in the Ingenuity Knowledge Base between predicted human target mRNAs of miR-133a-3p and miR-133a-5p and a range of cardiac and extra-cardiac biological functions and/or disease states. Parameters that achieved statistical significance (P < 0.05) are shown for miR-133a-3p (left) and miR-133a-5p (right), with the relative proportions determined on the basis of the negative logarithm of the P values.
MicroRNAs (miRNAs) are small non-coding RNAs that post-transcriptionally regulate gene expression. Sequential cleavage of miRNA precursors results in a ~22 nucleotide duplex of which one strand, the mature miRNA, is typically loaded into the RNA-induced silencing complex (RISC) while the passenger strand is degraded. Very little is known about how genetic variation might affect miRNA biogenesis and function. We re-sequenced the MIR1-1, MIR1-2, MIR133A1, MIR133A2, and MIR133B genes, that encode the cardiac-enriched miRNAs, miR-1 and miR-133, in 120 individuals with familial atrial fibrillation and identified 10 variants, including a novel 79T > C MIR133A2 substitution. This variant lies within the duplex at the 3' end of the mature strand, miR-133a-3p, and is predicted to prevent base-pairing and weaken thermostability at this site, favoring incorporation of the passenger strand, miR-133a-5p, into RISC. Genomic DNA fragments containing miR-133a-2 precursor sequences with 79T and 79C alleles were transfected into HeLa cells. On Northern blotting the 79T allele showed strong expression of miR-133a-3p with weak expression of miR-133a-5p. In contrast, the 79C allele had no effect on miR-133a-3p but there was a significant increase (mean 3.6-fold) in miR-133a-5p levels. Deep sequencing of small RNA libraries prepared from normal human and murine atria confirmed that nearly all the mature miR-133a was comprised of miR-133a-3p and that levels of miR-133a-5p were very low. A number of isomiRs with variations at 5' and 3' ends were identified for both miR-133a-3p and miR-133a-5p, with 2 predominant miR-133a-3p isomiRs and one predominant miR-133a-5p isomiR. Bioinformatics analyses indicate that the major miR-133a-3p and 5p isomiRs have numerous predicted target mRNAs, only a few of which are in common. Multiple miR-133a isomiRs with potential different mRNA target profiles are present in the atrium in humans and mice. We identified a human 79T > C MIR133A2 variant that alters miRNA processing and results in accumulation of the miR-133a-5p strand that is usually degraded.
 
Linkage disequilibrium (LD) maps can provide a wealth of information on specific marker-phenotype relationships, especially in areas of the genome where positional candidate genes with similar functions are located. A recently published high resolution radiation hybrid map of bovine chromosome 14 (BTA14) together with the bovine physical map have enabled the creation of more accurate LD maps for BTA14 in both dairy and beef cattle. Over 500 Single Nucleotide Polymorphism (SNP) markers from both Angus and Holstein animals had their phased haplotypes estimated using GENOPROB and their pairwise r2 values compared. For both breeds, results showed that average LD extends at moderate levels up to 100 kilo base pairs (kbp) and falls to background levels after 500 kbp. Haplotype block structure analysis using HAPLOVIEW under the four gamete rule identified 122 haplotype blocks for both Angus and Holstein. In addition, SNP tagging analysis identified 410 SNPs and 420 SNPs in Holstein and Angus, respectively, for future whole genome association studies on BTA14. Correlation analysis for marker pairs common to these two breeds confirmed that there are no substantial correlations between r-values at distances over 10 kbp. Comparison of extended haplotype homozygosity (EHH), which calculates the LD decay away from a core haplotype, shows that in Holstein there is long range LD decay away from the DGAT1 region consistent with the selection for milk fat % in this population. Comparison of EHH values for Angus in the same region shows very little long range LD. Overall, the results presented here can be applied in future single or haplotype association analysis for both populations, aiding in confirming or excluding potential polymorphisms as causative mutations, especially around Quantitative Trait Loci regions. In addition, knowledge of specific LD information among markers will aid the research community in selecting appropriate markers for whole genome association studies.
 
p-Values obtained from chi-square tests for independence, plotted as -log10(p-value). Value equivalent to p = 0.001 is indicated by bold red line. Case 1–6 reflects study populations selected as defined in the text. Case 1–3: 50 cases, 100 controls; Case 4: 250 cases, 500 controls; Case 5: 250 cases (original affection), 500 controls; Case 6: 250 cases (cases selected by MERLIN select function), 500 controls. Black arrow indicates marker documented to be linked to the disease locus.
Degree of linkage disequilibrium present within region of interest. Output obtained from HAPLOVIEW assessing the degree of LD present within region. The four SNPs that showed the most significant association (B03T3056, B03T3057, B03T3058, and C03R0281) with the trait are outlined by a black rectangle. Each square represents a pair-wise comparison and the number within the square indicates the D' value. Significant LD is indicated by a red square.
Although current methods in genetic epidemiology have been extremely successful in identifying genetic loci responsible for Mendelian traits, most common diseases do not follow simple Mendelian modes of inheritance. It is important to consider how our current methodologies function in the realm of complex diseases. The aim of this study was to determine the ability of conventional association methods to fine map a locus of interest. Six study populations were selected from 10 replicates (New York) from the Genetic Analysis Workshop 14 simulated dataset and analyzed for association between the disease trait and locus D2. Genotypes from 45 single-nucleotide polymorphisms in the telomeric region of chromosome 3 were analyzed by Pearson's chi-square tests for independence to test for association with the disease trait of interest. A significant association was detected within the region; however, it was found 3 cM from the documented location of the D2 disease locus. This result was most likely due to the method used for data simulation. In general, this study showed that conventional case-control association methods could detect disease loci responsible for the development of complex traits.
 
Many native Atlantic salmon populations have been invaded by domesticated escapees for three decades or longer. However, thus far, the cumulative level of gene-flow that has occurred from farmed to wild salmon has not been reported for any native Atlantic salmon population. The aim of the present study was to investigate temporal genetic stability in native populations, and, quantify gene-flow from farmed salmon that caused genetic changes where they were observed. This was achieved by genotyping historical and contemporary samples from 20 populations covering all of Norway with recently identified single nucleotide polymorphism markers that are collectively diagnostic for farmed and wild salmon. These analyses were combined with analysis of farmed salmon and implementation of Approximate Bayesian computation based simulations. Five of the populations displayed statistically significant temporal genetic changes. All five of these populations became more similar to a pool of farmed fish with time, strongly suggesting introgression of farmed fish as the primary cause. The remaining 15 populations displayed weak or non-significant temporal genetic changes. Estimated introgression of farmed fish ranged from 2-47% per population using approximate Bayesian computation. Thus, some populations exhibited high degrees of farmed salmon introgression while others were more or less unaffected. The observed frequency of escapees in each population was moderately correlated with estimated introgression per population R2 = 0.47 P < 0.001. Genetic isolation by distance existed within the historical and contemporary data sets, however, the among-population level of divergence decreased with time. This is the first study to quantify cumulative introgression of farmed salmon in any native Atlantic salmon population. The estimations demonstrate that the level of introgression has been population-specific, and that the level of introgression is not solely predicted by the frequency of escapees observed in the population. However, some populations have been strongly admixed with farmed salmon, and these data provide policy makers with unique information to address this situation.
 
Power of methods for Loci D2 and D4. The power for each window is plotted at the midpoint of the window in terms of marker number within the region. The gap in the lines for D2 is for windows overlapping the end of the chromosome.
We recently described a method for linkage disequilibrium (LD) mapping, using cladistic analysis of phased single-nucleotide polymorphism (SNP) haplotypes in a logistic regression framework. However, haplotypes are often not available and cannot be deduced with certainty from the unphased genotypes. One possible two-stage approach is to infer the phase of multilocus genotype data and analyze the resulting haplotypes as if known. Here, haplotypes are inferred using the expectation-maximization (EM) algorithm and the best-guess phase assignment for each individual analyzed. However, inferring haplotypes from phase-unknown data is prone to error and this should be taken into account in the subsequent analysis. An alternative approach is to analyze the phase-unknown multilocus genotypes themselves. Here we present a generalization of the method for phase-known haplotype data to the case of unphased SNP genotypes. Our approach is designed for high-density SNP data, so we opted to analyze the simulated dataset. The marker spacing in the initial screen was too large for our method to be effective, so we used the answers provided to request further data in regions around the disease loci and in null regions. Power to detect the disease loci, accuracy in localizing the true site of the locus, and false-positive error rates are reported for the inferred-haplotype and unphased genotype methods. For this data, analyzing inferred haplotypes outperforms analysis of genotypes. As expected, our results suggest that when there is little or no LD between a disease locus and the flanking region, there will be no chance of detecting it unless the disease variant itself is genotyped.
 
Genetic model parameters
Location of disease-related loci
Genotype-phenotype relationships for subclinical traits
Graphical representation of the genetic model used in the simulation. D1-D4 are disease-causing loci. D5 and D6 influence disease expression if the disease genotype is present. P1-P3 are different phenotypes caused by the disease loci to which they are connected by the lines. The "a" and "b" after the phenotype designation indicate identical phenotypes but caused by different genotypes. D5 changes phenotype P2a into P1 when allele 1 is present. D6 changes the penetrance of P2b when allele 1 is present.
The Genetic Analysis Workshop 14 simulated dataset was designed 1) To test the ability to find genes related to a complex disease (such as alcoholism). Such a disease may be given a variety of definitions by different investigators, have associated endophenotypes that are common in the general population, and is likely to be not one disease but a heterogeneous collection of clinically similar, but genetically distinct, entities. 2) To observe the effect on genetic analysis and gene discovery of a complex set of gene x gene interactions. 3) To allow comparison of microsatellite vs. large-scale single-nucleotide polymorphism (SNP) data. 4) To allow testing of association to identify the disease gene and the effect of moderate marker x marker linkage disequilibrium. 5) To observe the effect of different ascertainment/disease definition schemes on the analysis. Data was distributed in two forms. Data distributed to participants contained about 1,000 SNPs and 400 microsatellite markers. Internet-obtainable data consisted of a finer 10,000 SNP map, which also contained data on controls. While disease characteristics and parameters were constant, four "studies" used varying ascertainment schemes based on differing beliefs about disease characteristics. One of the studies contained multiplex two- and three-generation pedigrees with at least four affected members. The simulated disease was a psychiatric condition with many associated behaviors (endophenotypes), almost all of which were genetic in origin. The underlying disease model contained four major genes and two modifier genes. The four major genes interacted with each other to produce three different phenotypes, which were themselves heterogeneous. The population parameters were calibrated so that the major genes could be discovered by linkage analysis in most datasets. The association evidence was more difficult to calibrate but was designed to find statistically significant association in 50% of datasets. We also simulated some marker x marker linkage disequilibrium around some of the genes and also in areas without disease genes. We tried two different methods to simulate the linkage disequilibrium.
 
Apolipoprotein E, a component of the plasma lipoproteins, plays an important role in the transport and metabolism of cholesterol and other lipids. Three single nucleotide polymorphisms (SNPs) -491A>T, -219T>G and +113G>C in the regulatory region of human apolipoprotein E gene (APOE) change the promoter activity and are associated with a wide variety of disorders including Alzheimer disease (AD). Functional SNPs in porcine APOE gene 5' regulatory region have not been explored. We examined SNPs within this region (from -831 to +855), and the analysis revealed that the T>A SNP at position -155 among these three polymorphism sites (-440, -155, +501) was found to exert a marked influence on the transcription of the porcine APOE gene. Electrophoretic mobility shift assays showed that the binding affinity of oligonucletides containing the -155A to transcription factor(s) was stronger than that of the -155T. Transient transfection assays and quantitative real-time PCR results revealed that the -155T>A variant enhanced the activity of the APOE promoter and was associated with increased APOE mRNA levels in vivo. These data suggest that the -155T>A mutation in the promoter region of the porcine APOE gene is an important functional variant. The results provided new insights into aspects of pig genetics and might also facilitate the application of pigs in biomedical studies addressing important human diseases.
 
Characteristics of the study population
Association between phenotype of high myopia and genetic variants at 15q14 and 15q25 in the Han Chinese Population
Integrated maps: genomic context and SNPs information of the rs8027411.
Refractive errors and high myopia are the most common ocular disorders, and both of them are leading causes of blindness in the world. Recently, genetic association studies in European and Japanese population identified that common genetic variations located in 15q14 and 15q25 were associated with high myopia. To validate whether the same variations conferred risk to high myopia in the Han Chinese population, we genotyped 1,461 individuals (940 controls and 521 cases samples) recruited of Han Chinese origin.Result: We found rs8027411 in 15q25 (P = 0.012 after correction, OR = 0.78) was significantly associated with high myopia but rs634990 in 15q14 (P = 0.54 after correction), OR = 0.88) was not. Our findings supported that 15q25 is a susceptibility locus for high myopia, and gene RASGRF1 was possible to play a role in the pathology of high myopia.
 
Multipoint lod scores for chromosome 16. The baseline score for 45 multiplex families (2+ sampled relatives affected with late AMD, grade 4 and 5) and scores for OSA subsets defined by IOP, SBP and BMI (ordered from highest to lowest family average, see text and Table 2) are shown.
Multipoint lod scores for chromosome 14. The baseline score for 62 multiplex families (2+ sampled relatives affected with early or late AMD, grade 3, 4 and 5) and the score for the OSA subset defined by IOP (ordered from lowest to highest family average, see text) are shown.
Multipoint lod scores for chromosome 6. The baseline score for 62 multiplex families (2+ sampled relatives affected with early or late AMD, grade 3, 4 and 5) and the score for the OSA subset defined by BMI (ordered from highest to lowest family average, see text) are shown.
Age-related macular degeneration (AMD) is a complex disorder that is responsible for the majority of central vision loss in older adults living in developed countries. Phenotypic and genetic heterogeneity complicate the analysis of genome-wide scans for AMD susceptibility loci. The ordered subset analysis (OSA) method is an approach for reducing heterogeneity, increasing statistical power for detecting linkage, and helping to define the most informative data set for follow-up analysis. OSA assesses the linkage evidence in subsets of potentially more homogeneous families by rank-ordering family-specific lod scores with respect to trait-associated covariates or phenotypic features. Here, we present results of incorporating five continuous covariates into our genome-wide linkage analysis of 389 microsatellite markers in 62 multiplex families: Body mass index (BMI), systolic (SBP) and diastolic (DBP) blood pressure, intraocular pressure (IOP), and pack-years of cigarette smoking. Chromosome-wide significance of increases in nonparametric multipoint lod scores in covariate-defined subsets relative to the overall sample was assessed by permutation. Using a correction for testing multiple covariates, statistically significant lod score increases were observed for two chromosomal regions: 14q13 with a lod score of 3.2 in 28 families with average IOP </= 15.5 (p = 0.002), and 6q14 with a lod score of 1.6 in eight families with average BMI >/= 30.1 (p = 0.0004). On chromosome 16p12, nominally significant lod score increases (p </= 0.05), up to a lod score of 2.9 in 32 families, were observed with several covariate orderings. While less significant, this was the only region where linkage evidence was associated with multiple clinically meaningful covariates and the only nominally significant finding when analysis was restricted to advanced forms of AMD. Families with linkage to 16p12 had higher averages of SBP, IOP and BMI and were primarily affected with neovascular AMD. For all three regions, linkage signals at or very near the peak marker have previously been reported. Our results suggest that a susceptibility gene on chromosome 16p12 may predispose to AMD, particularly to the neovascular form, and that further research into the previously suggested association of neovascular AMD and systemic hypertension is warranted.
 
Background The ZFHX3 gene, located in Chromosome 16q22.3, codes for a transcription factor which is widely expressed in human tissues. Genome-wide studies have identified associations between variants within the gene and Kawasaki disease and atrial fibrillation. ZFHX3 has two main transcripts that utilise different transcription start sites. We examined the association between genetic variants in the 16q22.3 region and expression of ZFHX3 to identify variants that regulate gene expression.ResultsWe genotyped 65 single-nucleotide polymorphisms to tag genetic variation at the ZFHX3 locus in two cohorts, 451 British individuals recruited in the North East of England and 310 mixed-ancestry individuals recruited in South Africa. Allelic expression analysis revealed that the minor (A) allele of rs8060701, a variant in the first intron of ZFHX3, was associated with a 1.16-fold decrease in allelic expression of both transcripts together, (p¿=¿4.87e-06). The minor (C) allele of a transcribed variant, rs10852515, in the second exon of ZFHX3 isoform A was independently associated with a 1.36-fold decrease in allelic expression of ZFHX3 A (p¿=¿7.06e-31), but not overall ZFHX3 expression. However, analysis of total gene expression of ZFHX3 failed to detect an association with genotype at any variant. Differences in linkage disequilibrium between the two populations allowed fine-mapping of the locus to a 7 kb region overlapping exon 2 of ZFHX3 A. We did not find any association between ZFHX3 expression and any of the variants identified by genome wide association studies.Conclusions ZFHX3 transcript levels are regulated in a transcript-specific fashion by independent cis-acting transcribed polymorphisms. Our results demonstrate the power of allelic expression analysis and trans-ethnic fine mapping to identify transcript-specific cis-acting regulatory elements .
 
Graphical summary of DN in single-SNP association analysis under additive-effect disease model.
Demographic and clinical characteristics of study samples
Pairwise linkage disequilibrium (LD) among the 11 SNPs located at 16q22.1 region. Pairwise LD was measured by the r 2 statistic. An r 2 value of 1 indicates a complete LD between two SNPs, and an r 2 value of 0 indicates a perfect equilibrium. Lower r 2 value shows a lower degree of LD. Pairwise D' values along with LOD scores were displayed in different colors. White indicates D' <1 and LOD <2; blue indicate D' = 1 and LOD <2; bright red indicate D' = 1 and LOD ≥2; shades of pink/red indicate D' <1 and LOD ≥2.
Single-SNP association analysis for DN at the 16q22.1-16q22.2 regions under the additive model a
Background Diabetic nephropathy (DN) has become one of the most common causes of end-stage renal disease (ESRD) in many countries, such as 44.5% in Taiwan. Previous studies have shown that there is a genetic component to ESRD. Studies attempting to determine which genetic variants are related to DN in Han Chinese are limited.ResultsWe included 574 unrelated type 2 diabetes patients (217 DN cases and 357 controls), who were genotyped using Illumina HumanHap550-Duo BeadChip. In single-SNP association tests, the SNPs rs11647932, rs11645214, and rs6499323 located at 16q22.1 under the additive-effect disease model were significantly associated with an approximately 2-fold increased risk of DN. In haplotype association tests, identified haplotypes located in the chromosome 16q22.1 region (containing ST3GAL2, COG4, SF3B3, and IL34 genes) raised DN risk. The strongest association was found with haplotype rs2288491-rs4985534-rs11645214 (C-C-G) (adjusted odds ratio [AOR] 1.93, 95% confidence interval [CI] 1.83-2.03, p =6.25¿×¿10¿7), followed by haplotype rs8052125-rs2288491-rs4985534-rs11645214 (G-C-C-G) (AOR 1.92, 95% CI 1.82-2.02, p =6.56¿×¿10¿7), and haplotype rs2303792-rs8052125-rs2288491-rs4985534-rs11645214 (A-G-C-C-G) (AOR 1.91, 95% CI 1.81-2.01, p =1.15¿×¿10¿6).Conclusions Our results demonstrate that the novel SNPs and haplotypes located at the 16q22.1 region may involve in the biological pathways of DN in Han Chinese patients with type 2 diabetes. This study can provide new insights into the etiology of DN.
 
Results of validation study of species-specific heminested PCR assays
Schematic diagram of the mitochondrial 16s rRNA gene and species-specific amplicons with species – specific primers.
Species-specific profiles of designed heminested PCR assay. M indicates 100 bp ladders. Higher molecular weight amplicons were amplified for all the species with universal 16s rRNA primers. In 2nd PCR only target species have generated species-species amplicons with specific primers. Lane 14 of both the gel contains negative controls.
Species-specific profiles with 5 pg and 5 ng template DNA concentration of designed heminested PCR assay. M indicates 100 bp ladders. All the species have shown positive result at 1st and 2nd PCR.
Characterization of molecular markers and the development of better assays for precise and rapid detection of wildlife species are always in demand. This study describes a set of seven novel heminested PCR assays using specific primers designed based on species-specific polymorphism at the mitochondrial 16S rRNA gene for identification of Blackbuck, Goral, Nilgai, Hog deer, Chital, Sambar and Thamin deer. The designed heminested PCR assays are two consecutive amplifications of the mitochondrial 16S rRNA gene. In the first stage, approximately 550 bp region of the 16S rRNA gene was amplified by PCR using template DNA and universal primers. In the second stage, a species-specific internal region of the 16S rRNA gene was amplified by PCR using the amplicon of the first PCR along with one universal primer and another species-specific primer as the reverse or forward primer. The amplicon generated after two consecutive amplifications was highly unique to target species. These assays were successfully validated for sensitivity, specificity, and ruggedness under a wide range of conditions. The validation experiments confirm that the designed heminested PCR assays for identification of the seven species are highly specific, sensitive, reliable and provide a reproducible method allowing analysis of low copy number DNA recovered from decomposed or highly processed tissues. The assays for identification of other species could be devised by extrapolating the principle of designed heminested PCR.
 
Three multipoint LOD scores plots using longitudinal variance components approach on chromosome 17 for pair-wise time points: at 5 years apart (A), at 10 years apart (B), and at least 15 years apart (C).
Two multipoint LOD scores plots using the residuals approach on chromosome 17 for three different analyses: using all 21 time points from Cohort 1 and all 5 time points from Cohort 2, only the concordant five time points from Cohorts 1 and 2, and the average SBP over all measurements for each subject: with age restriction from 25 to 75 (A), and using all ages (B).
We compare two methods to detect genetic linkage by using serial observations of systolic blood pressure in pedigree data from the Framingham Heart Study focusing on chromosome 17. The first method is a variance components (VC) approach that incorporates longitudinal pedigree data, and the second method is a regression-based approach that summarizes all longitudinal measures in one single measure. No evidence of linkage was found either using the VC longitudinal approach or the regression-based approach, except when all time points were used from Cohorts 1 and 2 and only subjects aged 25 and 75 years were included.
 
Haplotype block characteristics according to different definition methods, applied to the total group of 137 SNPs.
a; The distribution of minor allele frequencies for the 137 SNPs used in this study. The bias toward common alleles is inherent to the sampling of markers from publicly available databases. b; The distribution of physical gaps between the 137 SNPs used in this study (median spacing 15.5 kb).
Running average values of LD measures for sliding windows of 2 SNPs for the 137 markers studied. a; Variability of r2. Patterns of decay of LD in this dataset correlate well with observations in different regions of the human genome. b; Variability of D'.
Snapshot of haplotype block organisation on 17q. Blocks identified by each of the 5 Definitions for the first 3 Mb of the region are depicted. SNPs are shown as triangles according to their relative spacing. Genes in the region are shown in pink (circles denote the start and end points of genes). Haplotype blocks are colour-coded according to the Definition used to characterise them: Definition 1 [16] is in purple; Definition 2 (modification of [16]) is in orange; Definition 3 [24] is in red; Definition 4 (n+1 method) is in blue; Definition 5 (D' high threshold method) is in green. Squares represent the SNPs that fall within the defined blocks and lines extend across each haplotype block. Adjacent and overlapping blocks are depicted in consecutive rows.
Number of SNPs that need to be genotyped, in order to capture the majority of variation in the region, according to the different haplotype block definition methods. a; In the total group of 137 SNPs. b; In the subset of 100 common SNPs (minor allele frequency >0.2). The number of htSNPs falling within haplotype blocks is denoted by black, while the number of SNPs that need to be typed but are not included in blocks, is depicted in grey.
The selection of markers in association studies can be informed through the use of haplotype blocks. Recent reports have determined the genomic architecture of chromosomal segments through different haplotype block definitions based on linkage disequilibrium (LD) measures or haplotype diversity criteria. The relative applicability of distinct block definitions to association studies, however, remains unclear. We compared different block definitions in 6.1 Mb of chromosome 17q in 189 unrelated healthy individuals. Using 137 single nucleotide polymorphisms (SNPs), at a median spacing of 15.5 kb, we constructed haplotype block maps using published methods and additional methods we have developed. Haplotype tagging SNPs (htSNPs) were identified for each map. Blocks were found to be shorter and coverage of the region limited with methods based on LD measures, compared to the method based on haplotype diversity. Although the distribution of blocks was highly variable, the number of SNPs that needed to be typed in order to capture the maximum number of haplotypes was consistent. For the marker spacing used in this study, choice of block definition is not important when used as an initial screen of the region to identify htSNPs. However, choice of block definition has consequences for the downstream interpretation of association study results.
 
Association analyses of marker genotypes with SCS in six German Holstein halfsib families
Association analyses of maternally inherited two-marker-haplotypes with SCS
LALD Profile. Restricted Log Likelihood Ratio (RLRT) profile of a combined linkage and linkage disequilibrium analysis testing for a putative QTL affecting SCS on BTA18. The profile is plotted for putative QTL positions located at the midpoint of each marker interval. QTL positions are indicated by black dots. Thick black lines indicate confidence interval for the first maximum at interval 9 (upper line) and the second maximum at interval 12 (lower line). Dashed lines indicate genome- and chromosome-wide significance thresholds.
Box-whisker plot for estimated effects of maternally inherited two-marker-interval gametes in interval 9. Two-locus-interval (A) and single locus (B) gametes of the two-marker-interval flanking the putative QTL in interval 9 are written on the X-axis. The boxes contain 50% of all values, where (+) represents the mean, and the horizontal line within the box (-) represents the median. The first and third quartiles are represented by the lower and upper edge of the box and the whiskers extend to the highest and lowest values.
Box-whisker plot for estimated effects of maternally inherited two-marker-interval gametes in interval 12-13. Two-locus-interval (A) and single locus (B) gametes of the two-marker-interval BB710 (interval 12) and PVRL2_c.392G>A (interval 13) are written on the X-axis. Estimates are for the putative QTL position in interval 12. The boxes contain 50% of all values where (+) represents the mean and the horizontal line within the box (-) represents the median. The first and third quartiles are represented by the lower and upper edge of the box and the whiskers extend to the highest and lowest values.
The somatic cell score (SCS) is implemented in routine sire evaluations in many countries as an indicator trait for udder health. Somatic cell score is highly correlated with clinical mastitis, and in the German Holstein population quantitative trait loci (QTL) for SCS have been repeatedly mapped on Bos taurus autosome 18 (BTA18). In the present study, we report a refined analysis of previously detected QTL regions on BTA18 with the aim of identifying marker and marker haplotypes in linkage disequilibrium with SCS. A combined linkage and linkage disequilibrium approach was implemented, and association analyses of marker genotypes and maternally inherited two-marker-haplotypes were conducted to identify marker and haplotypes in linkage disequilibrium with a locus affecting SCS in the German Holstein population. We detected a genome-wide significant QTL within marker interval 9 (HAMP_c.366+109G>A--BMS833) in the middle to telomeric region on BTA18 and a second putative QTL in marker interval 12-13 (BB710-PVRL2_c.392G>A). Association analyses with genotypes of markers flanking the most likely QTL positions revealed the microsatellite marker BMS833 (interval 9) to be associated with a locus affecting SCS within the families investigated. A further analysis of maternally inherited two-marker haplotypes and effects of maternally inherited two-marker-interval gametes indicated haplotype 249-G in marker interval 12-13 (BB710-PVRL2_c.392G>A) to be associated with SCS in the German Holstein population. Our results confirmed previous QTL mapping results for SCS and support the hypothesis that more than one locus presumably affects udder health in the middle to telomeric region of BTA18. However, a subsequent investigation of the reported QTL regions is necessary to verify the two-QTL hypothesis and confirm the association of two-marker-haplotype 249-G in marker interval 12-13 (BB710-PVRL2_c.392G>A) with SCS. For this purpose, higher marker density and multiple-trait and multiple-QTL models are required to narrow down the position of the causal mutation or mutations affecting SCS in German Holstein cattle.
 
The numbers of parents used to found each strain and generation
Biological characteristics for the F2 hybrid strains
Overall design of the breeding experiment. The flow from the parental Atlantic and Pacific generations the F2 hybrid generations is illustrated schematically. For details refer to the main text.
Molecular Phylogeny of cytochrome oxidase subunit I (COI). The evolutionary history of 245 nucleotide partial COI sequences was inferred by using the Maximum Likelihood method. The tree with the highest log likelihood (-11199) is shown. The analysis reveals two distinct phylogenetic clades with 100% bootstrap support corresponding to the Atlantic and Pacific samples respectively. The Pacific and Atlantic entries from the present study are highlighted in yellow and red. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The Ls COI Pac sequence [GenBank:KF278676] was derived from the holotype speciemen (ZMUB91335). The Ls COI ATL sequence [GenBank:KF278677] was derived from a random female from the LsAtl strain.
Molecular Phylogeny of 16S ribosomal RNA. The evolutionary history of 249 nucleotide partial 16S rRNA sequences was inferred by using the Maximum Likelihood method. The tree with the highest log likelihood (-2387) is shown. The analysis reveals two distinct clades with 100% bootstrap support corresponding to the Atlantic and Pacific samples respectively. The Pacific and Atlantic entries from the present study are highlighted in yellow and red. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The Ls 16S Pac sequence [GenBank:KF278676] was derived from the holotype speciemen (ZMUB91335). The Ls 16S ATL sequence [GenBank:KF278677] was derived from a random female from the LsAtl strain.
The salmon louse Lepeophtheirus salmonis is a parasitic copepod that infects salmonids in the Pacific and Atlantic oceans. Although considered as a single species, morphological and biological differences have been reported between lice from the two oceans. Likewise, studies based on nucleotide sequencing have demonstrated that sequence differences between Atlantic and Pacific L. salmonis are highly significant, albeit smaller than the divergence observed between congeneric copepod species. We demonstrated reproductive compatibility between L. salmonis from the two oceans and successfully established F2 hybrid strains using separate maternal lines from both the Pacific and Atlantic. The infection success for the F2 hybrid strains were similar to results typically observed for non hybrid lice strains in the rearing facility used. Lepeophtheirus salmonis COI and 16S sequences divergence between individuals from the Pacific and the Atlantic oceans was high compared to what may be expected within a copepod species and phylogenetic analysis showed that they consistently formed monophyletic clades representing their origin from the Pacific or Atlantic oceans. Lepeophtheirus salmonis from the Pacific and Atlantic oceans are reproductively compatible at least until adults at the F2 hybrid stage, and should not be regarded as separate species based on reproductive segregation or sequence divergence levels. Reported biological and genetic differences in L. salmonis seen in conjunction with the reported genetic diversity commonly observed between and within species demonstrate that Atlantic and Pacific L. salmonis should be regarded as two subspecies: Lepeophtheirus salmonis salmonis and L. salmonis oncorhynchi subsp. nov.
 
Background The karyotypes of Leptodactylus species usually consist of 22 bi-armed chromosomes, but morphological variations in some chromosomes and even differences in the 2n have been reported. To better understand the mechanisms responsible for these differences, eight species were analysed using classical and molecular cytogenetic techniques, including replication banding with BrdU incorporation. Results Distinct chromosome numbers were found: 2n = 22 in Leptodactylus chaquensis, L. labyrinthicus, L. pentadactylus, L. petersii, L. podicipinus, and L. rhodomystax; 2n = 20 in Leptodactylus sp. (aff. podicipinus); and 2n = 24 in L. marmoratus. Among the species with 2n = 22, only three had the same basic karyotype. Leptodactylus pentadactylus presented multiple translocations, L. petersii displayed chromosome morphological discrepancy, and L. podicipinus had four pairs of telocentric chromosomes. Replication banding was crucial for characterising this variability and for explaining the reduced 2n in Leptodactylus sp. (aff. podicipinus). Leptodactylus marmoratus had few chromosomes with a similar banding patterns to the 2n = 22 karyotypes. The majority of the species presented a single NOR-bearing pair, which was confirmed using Ag-impregnation and FISH with an rDNA probe. In general, the NOR-bearing chromosomes corresponded to chromosome 8, but NORs were found on chromosome 3 or 4 in some species. Leptodactylus marmoratus had NORs on chromosome pairs 6 and 8. The data from C-banding, fluorochrome staining, and FISH using the telomeric probe helped in characterising the repetitive sequences. Even though hybridisation did occur on the chromosome ends, telomere-like repetitive sequences outside of the telomere region were identified. Metaphase I cells from L. pentadactylus confirmed its complex karyotype constitution because 12 chromosomes appeared as ring-shaped chain in addition to five bivalents. Conclusions Species of Leptodactylus exhibited both major and minor karyotypic differences which were identified by classical and molecular cytogenetic techniques. Replication banding, which is a unique procedure that has been used to obtain longitudinal multiple band patterns in amphibian chromosomes, allowed us to outline the general mechanisms responsible for these karyotype differences. The findings also suggested that L. marmoratus, which was formerly included in the genus Adenomera, may have undergone great chromosomal repatterning.
 
The genus Micronycteris is a diverse group of phyllostomid bats currently comprising 11 species, with diploid number (2n) ranging from 26 to 40 chromosomes. The karyotypic relationships within Micronycteris and between Micronycteris and other phyllostomids remain poorly understood. The karyotype of Micronycteris hirsuta is of particular interest: three different diploid numbers were reported for this species in South and Central Americas with 2n = 26, 28 and 30 chromosomes. Although current evidence suggests some geographic differentiation among populations of M. hirsuta based on chromosomal, morphological, and nuclear and mitochondrial DNA markers, the recognition of new species or subspecies has been avoided due to the need for additional data, mainly chromosomal data. We describe two new cytotypes for Micronycteris hirsuta (MHI) (2n = 26 and 25, NF = 32), whose differences in diploid number are interpreted as the products of Robertsonian rearrangements. C-banding revealed a small amount of constitutive heterochromatin at the centromere and the NOR was located in the interstitial portion of the short arm of a second pair, confirmed by FISH. Telomeric probes hybridized to the centromeric regions and weakly to telomeric regions of most chromosomes. The G-banding analysis and chromosome painting with whole chromosome probes from Carollia brevicauda (CBR) and Phyllostomus hastatus (PHA) enabled the establishment of genome-wide homologies between MHI, CBR and PHA. The karyotypes of Brazilian specimens of Micronycteris hirsuta described here are new to Micronycteris and reinforce that M. hirsuta does not represent a monotypic taxon. Our results corroborate the hypothesis of karyotypic megaevolution within Micronycteris, and strong evidence for this is that the entire chromosome complement of M. hirsuta was shown to be derivative with respect to species compared in this study.
 
Karyotypes of H. obliquidens without B chromosomes (a), with one extra chromosome (b) and with two extra chromosomes (c). The meta-submetacentric (m/sm) and subtelo-acrocentric (st/a), and the B chromosomes (1B and 2B) are indicated. Scale bar indicates 5 μm.
B chromosome distribution in the analyzed H. obliquidens stock.
Metaphasic spreads of H. obliquidens after silver staining (a), C-banding (b and c), and in situ hybridization with 5S rDNA (d), 18S rDNA (e), BAC-C4E09 (f), BAC-C5E01 (g), SATA satellite DNA (h) and telomeric (GGGTTA)n DNA (i). (a) and (b) are sequential metaphases. Arrows indicate the B-type chromosomes and arrowheads indicate the chromosome pair 1. Scale bar indicates 5 μm.
Meiotic diakinetic spreads from H. obliquidens testis cells: Giemsa stained (a), C-banded (b), and probed with 18S rDNA (d). Arrows indicate the B-type chromosomes and (d) partially associated B chromosomes. Scale bar indicates 5 μm.
Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s) occurring in 39.6% of the analyzed individuals (both male and female) were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH) was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs) enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement.
 
Specimens of Astatotilapia latifasciata. M, male; F, female. Scale bar, 3 cm.
Correction After the publication of our work [1], we detected that the species focus of the study, Astatotilapia latifasciata (Figure 1), was erroneously identified as Haplochromis obliquidens. This species was described as Haplochromis latifasciatus [2] and later ascribed to the genus Astatoti-lapia [3]. Our mistake comes from the fact that this species is also frequently listed as Haplochromis "zebra obliquidens" in the aquarium trade. Astatotilapia latifas-ciata has been reported to occur in Lake Nawampasa a small satellite lake of the much larger Lake Kyoga, and in Lake Kyoga located north of Lake Victoria in Uganda [3].
 
Scarabaeinae beetles show a high level of macro-chromosomal variability, although the karyotypic organization of heterochromatin and multigene families (rDNAs and histone genes) is poorly understood in this group. To better understand the chromosomal organization and evolution in this group, we analyzed the karyotypes, heterochromatin distribution and chromosomal locations of the rRNAs and histone H3 genes in beetles belonging to eight tribes from the Scarabaeinae subfamily (Coleoptera, Scarabaeidae). The number of 18S rRNA gene (a member of the 45S rDNA unit) sites varied from one to 16 and were located on the autosomes, sex chromosomes or both, although two clusters were most common. Comparison of the 45S rDNA cluster number and the diploid numbers revealed a low correlation value. However, a comparison between the number of 45S rDNA sites per genome and the quantity of heterochromatin revealed (i) species presenting heterochromatin restricted to the centromeric/pericentromeric region that contained few rDNA sites and (ii) species with a high quantity of heterochromatin and a higher number of rDNA sites. In contrast to the high variability for heterochromatin and 45S rDNA cluster, the presence of two clusters (one bivalent cluster) co-located on autosomal chromosomes with the 5S rRNA and histone H3 genes was highly conserved. Our results indicate that the variability of the 45S rDNA chromosomal clusters is not associated with macro-chromosomal rearrangements but are instead related to the spread of heterochromatin. The data obtained also indicate that both heterochromatin and the 45S rDNA loci could be constrained by similar evolutionary forces regulating spreading in the distinct Scarabaeinae subfamily lineages. For the 5S rRNA and the histone H3 genes, a similar chromosomal organization could be attributed to their association/co-localization in the Scarabaeinae karyotypes. These data provide evidence that different evolutionary forces act at the heterochromatin and the 45S rDNA loci compared to the 5S rRNA and histone H3 genes during the evolution of the Scarabainae karyotypes.
 
Natural polyploidy has played an important role during the speciation and evolution of vertebrates, including anurans, with more than 55 described cases. The species of the Phyllomedusa burmeisteri group are mostly characterized by having 26 chromosomes, but a karyotype with 52 chromosomes was described in P. tetraploidea. This species was found in sintopy with P. distincta in two localities of Sao Paulo State (Brazil), where triploid animals also occur, as consequence of natural hybridisation. We analyse the chromosomes of P. distincta, P. tetraploidea, and their triploid hybrids, to enlighten the origin of polyploidy and to obtain some evidence on diploidisation of tetraploid karyotype. Phyllomedusa distincta was 2n = 2x = 26, whereas P. tetraploidea was 2n = 4x = 52, and the hybrid individuals was 2n = 3x = 39. In meiotic phases, bivalents were observed in the diploid males, whereas both bivalents and tetravalents were observed in the tetraploid males. Univalents, bivalents or trivalents; metaphase II cells carrying variable number of chromosomes; and spermatids were detected in the testis preparations of the triploid males, indicating that the triploids were not completely sterile. In natural and experimental conditions, the triploids cross with the parental species, producing abnormal egg clutches and tadpoles with malformations. The embryos and tadpoles exhibited intraindividual karyotype variability and all of the metaphases contained abnormal constitutions. Multiple NORs, detected by Ag-impregnation and FISH with an rDNA probe, were observed on chromosome 1 in the three karyotypic forms; and, additionally, on chromosome 9 in the diploids, mostly on chromosome 8 in the tetraploids, and on both chromosome 8 and 9 in the triploids. Nevertheless, NOR-bearing chromosome 9 was detected in the tetraploids, and chromosome 9 carried active or inactive NORs in the triploids. C-banding, base-specific fluorochrome stainings with CMA3 and DAPI, FISH with a telomeric probe, and BrdU incorporation in DNA showed nearly equivalent patterns in the karyotypes of P. distincta, P. tetraploidea, and the triploid hybrids. All the used cytogenetic techniques have provided strong evidence that the process of diploidisation, an essential step for stabilising the selective advantages produced by polyploidisation, is under way in distinct quartets of the tetraploid karyotype.
 
Posterior distribution for functional mutation in first 6 replicates for phenotype e. The figure shows the posterior distribution for the location of the functional mutation related to trait e in a phase-unknown analysis of each of the first 6 replicates of the packet 153 data.
Power study for Genetic Analysis Workshop data
There is great interest in the use of computationally intensive methods for fine mapping of marker data. In this paper we develop methods based upon ideas originally proposed 100 years ago in the context of spatial clustering. We use spatial clustering of haplotypes as a low-dimensional surrogate for the unobserved genealogy underlying a set of genotype data. In doing so we hope to avoid the computational complexity inherent in explicitly modelling details of the ancestry of the sample, while at the same time capturing the key correlations induced by that ancestry at a much lower computational cost. We benchmark our methods using the simulated Genetic Analysis Workshop 14 data, using 100 replicates of 4 phenotypes to indicate the power of our method. When a functional mutation relating to a trait is actually present, we find evidence for that mutation in 97 out of 100 replicates, on average. Our results show that our method has the ability to accurately infer the location of functional mutations from unphased genotype data.
 
Primer design for PCR analysis of MSTN candidate gene in Atlantic salmon 
Genotype and allele frequencies of SNPs 
Genotype means with standard error, additive effect and dominance effects for the SNP that showed a significant trait association 
Frequencies of common haplotypes and diplotypes 
Means with standard errors for haplotypes that show significant associations with biometrical traits 
Myostatin (MSTN) belongs to the transforming growth factor-beta superfamily and is a potent negative regulator of skeletal muscle development and growth in mammals. Most teleost fish possess two MSTN paralogues. However, as a consequence of a recent whole genome-duplication event, salmonids have four: MSTN-1 (-1a and -1b) and MSTN-2 (-2a and -2b). Evidence suggests that teleost MSTN plays a role in the regulation of muscle growth. In the current study, the MSTN-1b gene was re-sequenced and screened for SNP markers in a commercial population of Atlantic salmon. After genotyping 4,800 progeny for the discovered SNPs, we investigated their association with eight harvest traits - four body-weight traits, two ratios of weight traits, flesh colour and fat percentage - using a mixed model association analysis. Three novel SNPs were discovered in the MSTN-1b gene of Atlantic salmon. One of the SNPs, located within the 5[prime] flanking region (g.1086C > T), had a significant association with harvest traits (p < 0.05), specifically for: Harvest Weight (kg), Gutted Weight (kg), Deheaded Weight (kg) and Fillet Weight (kg). The haplotype-based association analysis was consistent with this result because the two haplotypes that showed a significant association with body-weight traits, hap4 and hap5 (p < 0.05 and p < 0.01, respectively), differ by a single substitution at the g.1086C > T locus. The alleles at g.1086C > T act in an additive manner and explain a small percentage of the genetic variation of these phenotypes. The association analysis revealed that g.1086C > T had a significant association with all body-weight traits under study. Although the SNP explains a small percentage of the variance, our results indicate that a variation in the 5[prime] flanking region of the myostatin gene is associated with the genetic regulation of growth in Atlantic salmon.
 
Background Several studies on the association of TNF-alpha (¿308 G/A), IL-6 (¿174 G/C) and IL-1beta (¿511 C/T) polymorphisms with polycystic ovary syndrome (PCOS) risk have reported conflicting results. The aim of the present study was to assess these associations by meta-analysis.ResultsA total of 14 eligible articles (1665 cases/1687 controls) were included in this meta-analysis. The results suggested that there was no obvious association between the TNF-alpha (¿308 G/A) polymorphism and PCOS in the overall population or subgroup analysis by ethnicity, Hardy¿Weinberg equilibrium (HWE) in controls, genotyping method, PCOS diagnosis criteria, and study sample size. Also, no obvious association was found between the TNF-alpha (¿308 G/A) polymorphism and obesity in patients with PCOS (body mass index [BMI]¿¿¿25 kg/m2 vs. BMI¿<¿25 kg/m2). Regarding the IL-6 (¿174 G/C) polymorphism, also no association was found in the overall population in heterozygote comparison, dominant model, and recessive model. Even though an allelic model (odds ratio [OR]¿=¿0.63, 95% confidence interval [CI]¿=¿0.41¿0.96) and a homozygote comparison (OR¿=¿0.52, 95% CI¿=¿0.30¿0.93) showed that the IL-6 (¿174 G/C) polymorphism was marginally associated with PCOS. Further subgroup analysis suggested that the effect size was not significant among HWE in controls (sample size¿¿¿200) and genotyping method of pyrosequencing under all genetic models. Similarly, there was no association between the IL-1beta (¿511 C/T) polymorphism and PCOS in the overall population or subgroup analysis under all genetic models. Furthermore, no significant association was found between the IL-1beta (¿511 C/T) polymorphism and several clinical and biochemical parameters in patients with PCOS.Conclusions The results of this meta-analysis suggest that the TNF-alpha (¿308 G/A), IL-6 (¿174 G/C), and IL-1beta (¿511 C/T) polymorphisms may not be associated with PCOS risk. However, further case¿control studies with larger sample sizes are needed to confirm our results.
 
Comparison of allele frequency estimated in Shanghai and four HapMap samples
Comparison of r2 of adjacent SNPs in Shanghai and four HapMap populations
Performance of tSNP sets selected from the four HapMap populations.
Comparison of |D'| in Shanghai and four HapMap populations
Comparison of haplotype frequencies in Shanghai and CHB
The HapMap project aimed to catalog millions of common single nucleotide polymorphisms (SNPs) in the human genome in four major populations, in order to facilitate association studies of complex diseases. To examine the transferability of Han Chinese in Beijing HapMap data to the Southern Han Chinese in Shanghai, we performed comparative analyses between genotypes from over 4,500 SNPs in a 21 Mb region on chromosome 1q21-q25 in 80 unrelated Shanghai Chinese and 45 HapMap Chinese data. Three thousand and forty-two SNPs were analyzed after removal of SNPs that failed quality control and those not in the HapMap panel. We compared the allele frequency distributions, linkage disequilibrium patterns, haplotype frequency distributions and tagging SNP sets transferability between the HapMap population and Shanghai Chinese population. Among the four HapMap populations, Beijing Chinese showed the best correlation with Shanghai population on allele frequencies, linkage disequilibrium and haplotype frequencies. Tagging SNP sets selected from four HapMap populations at different thresholds were evaluated in the Shanghai sample. Under the threshold of r2 equal to 0.8 or 0.5, both HapMap Chinese and Japanese data showed better coverage and tagging efficiency than Caucasian and African data. Our study supported the applicability of HapMap Beijing Chinese SNP data to the study of complex diseases among southern Chinese population.
 
Photographs of FISH assays. FISH with specific red probe (N25) in patient B on the metaphase (A) and interphase (B) chromosomes. FISH image of the father of patient B on interphase (C) and metaphase (D). (E) Interphase and metaphase FISH image with red probe in the mother of patient B. (F) Metaphase FISH image revealed in patient D.
Summary of the screening of the 22q11.2 region in CHD patients and their parents
Graphics of array-CGH assays representing 2.5 Mb deletion within the 22q11.2 region of patient A (A) and patient D (B).
Representative array-CGH profiles for (A) 22q11.2 triplication of 3 Mb in patient B, and for (B) 22q11.2 duplication of 2.5 Mb in patient B’s father.
Analysis of 22q11.2 duplication of 2.5 Mb in patient C.
Background The rearrangements in the 22q11.2 chromosomal region, responsible for the 22q11.2 deletion and microduplication syndromes, are frequently associated with congenital heart disease (CHD). The present work aimed to identify the genetic basis of CHD in 87 patients from the São Miguel Island, Azores, through the detection of copy number variants (CNVs) in the 22q11.2 region. These structural variants were searched using multiplex ligation-dependent probe amplification (MLPA). In patients with CNVs, we additionally performed fluorescent in situ hybridization (FISH) for the assessment of the exact number of 22q11.2 copies among each chromosome, and array comparative genomic hybridization (array-CGH) for the determination of the exact length of CNVs.ResultsWe found that four patients (4.6%; A to D) carried CNVs. Patients A and D, both affected with a ventricular septal defect, carried a de novo 2.5 Mb deletion of the 22q11.2 region, which was probably originated by inter-chromosomal (inter-chromatid) non-allelic homologous recombination (NAHR) events in the regions containing low-copy repeats (LCRs). Patient C, with an atrial septal defect, carried a de novo 2.5 Mb duplication of 22q11.2 region, which could have been probably generated during gametogenesis by NAHR or by unequal crossing-over; additionally, this patient presented a benign 288 Kb duplication, which included the TOP3B gene inherited from her healthy mother. Finally, patient B showed a 3 Mb triplication associated with dysmorphic facial features, cognitive deficit and heart defects, a clinical feature not reported in the only case described so far in the literature. The evaluation of patient B¿s parents revealed a 2.5 Mb duplication in her father, suggesting a paternal inheritance with an extra copy.Conclusions This report allowed the identification of rare deletion and microduplication syndromes in Azorean CHD patients. Moreover, we report the second patient with a 22q11.2 triplication, and we suggest that patients with triplications of chromosome 22q11.2, although they share some characteristic features with the deletion and microduplication syndromes, present a more severe phenotype probably due to the major dosage of implicated genes.
 
Clinical characteristics of affected individuals
Tested and excluded known FS and GEFS+ loci
Consanguineous Tunisian GEFS+family pedigree. Legend: A. Haplotype reconstruction for markers on chromosome 22q13.31, which are ordered from centromere to telomere. Markers from the Illumina array are in italic. The IBD haplotype shared by family members is shown in solid lines. Recombinaison events are shown by solid drawbar. Maternal and paternal chromosomes are designated by M and P, respectively. Each phenotype is describing by different colors. B. List of markers used for haplotype reconstruction with physical position. Markers from the Illumina array are in italic.
Structure of the TBC1D22A gene according to Ensembl (http://www.ensembl.org/index.html) with localization of markers within and flanking the 527 Kb IBD linked locus.
Genetic epilepsy with febrile seizures plus (GEFS+) is a familial epilepsy syndrome with extremely variable expressivity. The aim of our study was to identify the responsible locus for GEFS+ syndrome in a consanguineous Tunisian family showing three affected members, by carrying out a genome-wide single nucleotide polymorphisms (SNPs) genotyping followed by a whole-exome sequencing. We hypothesized an autosomal recessive (AR) mode of inheritance. Parametric linkage analysis and haplotype reconstruction identified a new unique identical by descent (IBD) interval of 527 kb, flanking by two microsatellite markers, 18GTchr22 and 15ACchr22b, on human chromosome 22q13.31 with a maximum multipoint LOD score of 2.51. Our analysis was refined by the use of a set of microsatellite markers. We showed that one of them was homozygous for the same allele in all affected individuals and heterozygous in healthy members of this family. This microsatellite marker, we called 17ACchr22, is located in an intronic region of TBC1D22A gene, which encodes a GTPase activator activity. Whole-exome sequencing did not reveal any mutation on chromosome 22q13.31 at the genome wide level. Our findings suggest that TBC1D22A is a new locus for GEFS+.
 
The human dopamine D4 receptor (DRD4) is a candidate gene of great interest in molecular studies of human personality and psychiatric disorders. This gene is unique in having an exceptionally high amount of polymorphic sites both in the coding and in the promoter region. We report the identification of a new 27 bp deletion starting 524 bp upstream of the initiation codon (27 bp del) of the dopamine D4 receptor (DRD4) gene, in the close vicinity of the -521C>T SNP. The presence of the 27 bp deletion leads to the misgenotyping of the -616C>G SNP by the Sau96 I RFLP method, thus the genotype determination of the mutation is of additional importance. The frequency of this novel sequence variation is considerably low (allele frequency is = 0.16%), as no homozygotes, and only 3 heterozygote carriers were found in a healthy, unrelated Caucasian sample (N = 955). Remarkably, the deleted region contains consensus sequences of binding sites for several known transcription factors, suggesting that the different alleles may affect the transcriptional regulation of the gene. A comparison of methods and results for the allelic variations of the DRD4 gene in various ethnic groups is also discussed, which has a high impact in psychiatric genetic studies.
 
Top-cited authors
Francois Balloux
  • University College London
Sébastien Devillard
  • Claude Bernard University Lyon 1
Arvind Kumar
  • International Rice Research Institute
Ma. Teresa Gerpacio Sta. Cruz
  • Consultative Group on International Agricultural Research
Shalabh Dixit
  • International Rice Research Institute