Table 3 - uploaded by Fortino Solórzano-Santos
Content may be subject to copyright.
Source publication
Biofilm production has been established as a virulence factor which allows Staphylococcus to adhere and persist in medical devices. The objective was to determine whether therapeutic failure in patients infected with Staphylococcus spp. is linked to biofilm production, the presence of the ica operon, and the bacterial insertion sequence element IS2...
Context in source publication
Citations
... Furthermore, both icaA and icaD genes are integrated to S. epidermidis biofilm formation, encoding enzymes required for the synthesis of polysaccharide intercellular adhesin (PIA) critical for biofilm architecture and bacterial 13 persistence on surfaces [34]. The identification of the icaA/D genes along with IS256 sequence elements correlates strongly with incidences of therapeutic failure associated with coagulasenegative staphylococci infections [70]. ...
Staphylococcus epidermidis, a coagulase-negative staphylococcus, is a prevalent skin commensal that has increasingly been recognized as a significant pathogen, particularly in hospital environments, where it is associated with device-related infections. The emergence of multidrug resistance (MDR) and its ability to form biofilms complicate the clinical management of infections caused by this organism, posing a growing public health concern. This study aimed to investigate the nasal carriage of S. epidermidis among healthy young individuals and to analyze its antibiotic resistance patterns, resistance genes, and biofilm formation capabilities. Nasal swabs were collected from 40 undergraduate students at Mahasarakham University, Thailand, aged between 20 and 22 years. A total of 38 isolates were confirmed as S. epidermidis through both phenotypic and molecular characterization. Antibiotic susceptibility testing demonstrated resistance to various classes of antimicrobials, including beta-lactams, macrolides, and tetracyclines. Notably, five isolates exhibited methicillin resistance (MRSE). Resistance genes such as mecA, ermA, tetM, tetL, and tetK were identified across the isolates, contributing to the observed resistance profiles. Biofilm formation assays revealed that most isolates displayed weak to moderate biofilm formation, with only one isolate demonstrating strong biofilm-forming capacity. Genetic analysis indicated a significant correlation between biofilm formation and the presence of the icaA gene, which is crucial for biofilm production. This study suggests the necessity for ongoing surveillance of nasal carriage of S. epidermidis to enhance understanding of its role in the dissemination of antimicrobial resistance and biofilm-associated infections, particularly within healthcare settings.
... DNA integrity was determined by 2% agarose gel electrophoresis (1× TBE buffer at 150 V for 30 min), and purity was determined using Nanodrop equipment (Thermo Scientific, Waltham, MA, USA) through the relationship of absorbances at 260/280 nm. S. aureus ATCC 43300 was used as a positive control of the mecA gene, S. aureus ATCC 25923 was used as a negative control, and S. epidermidis ATCC 12228 was used as a positive control for the detection of icaADBC+ genes [34]. S. aureus ATCC 29247 was used as a negative control [37]. ...
Methicillin-resistant (MR) Staphylococcus aureus (SA) and others, except for Staphylococcus aureus (SOSA), are common in healthcare-associated infections. SOSA encompass largely coagulase-negative staphylococci, including coagulase-positive staphylococcal species. Biofilm formation is encoded by the icaADBC operon and is involved in virulence. mecA encodes an additional penicillin-binding protein (PBP), PBP2a, that avoids the arrival of β-lactams at the target, found in the staphylococcal cassette chromosome mec (SCCmec). This work aims to detect mecA, the bap gene, the icaADBC operon, and types of SCCmec associated to biofilm in MRSA and SOSA strains. A total of 46% (37/80) of the strains were S. aureus, 44% (35/80) S. epidermidis, 5% (4/80) S. haemolyticus, 2.5% (2/80) S. hominis, 1.25% (1/80) S. intermedius, and 1.25% (1/80) S. saprophyticus. A total of 85% were MR, of which 95.5% showed mecA and 86.7% β-lactamase producers; thus, Staphylococcus may have more than one resistance mechanism. Healthcare-associated infection strains codified type I-III genes of SCCmec; types IV and V were associated to community-acquired strains (CA). Type II prevailed in MRSA mecA strains and type II and III in MRSOSA (methicillin-resistant staphylococci other than Staphylococcus aureus). The operon icaADBC was found in 24% of SA and 14% of SOSA; probably the arrangement of the operon, fork formation, and mutations influenced the variation. Methicillin resistance was mainly mediated by the mecA gene; however, there may be other mechanisms that also participate, since biofilm production is related to genes of the icaADBC operon and methicillin resistance was not associated with biofilm production. Therefore, it is necessary to strengthen surveillance to prevent the spread of these outbreaks both in the nosocomial environment and in the community.
... Furthermore, several previous studies have even reported 100% presence rates for these genes [25,26]. It is well known that the product of icaADBC plays important roles in the synthesis of PIA, also known as poly-N-acetylglucosamine (PNAG) which is a key component of the biofilm matrix, allows S. aureus cells to adhere to surfaces and form cohesive structure of biofilm [30]. ...
... Indeed, the high prevalence rate of the icaADBC operon genes in S. aureus isolates is noteworthy due to their major impacts on bacterial biofilm formation and pathogenicity [30]; therefore these data could be applicable for novel therapeutic strategies targeting S. aureus bacteria specifically for biofilm-related infections. ...
... Although this enzyme shows limited activity, the co-expression of the icaD enhances its activity. This suggests that the icaD product somehow facilitates or enhances the function of the enzyme [30]. Additionally, from MSCRAMMs, fnbA-fnbB has received special attention in previous studies due to their unique roles. ...
Staphylococcus aureus is a versatile pathogen capable of causing a wide range of infections, from minor skin infections to life-threatening invasive diseases. The pathogenicity of S. aureus is attributed to its ability to produce various virulence factors, including adhesion and biofilm-related proteins. Understanding the prevalence and distribution of these genes among S. aureus isolates from different sources is crucial for devising effective strategies to combat biofilm-associated contamination. In this study, we conducted a comprehensive network meta-analysis to assess the prevalence of adhesion and biofilm-related genes in S. aureus isolates and investigate the impact of the isolate source on their occurrence. A systematic search of multiple databases was performed, and a total of 53 relevant studies were included. The prevalence of adhesion and biofilm-related genes in S. aureus isolates was determined, with the highest prevalence observed for clfB (p-estimate = 85.4, 95% confidence interval [CI] 78-90.6), followed by eno (p-estimate = 81.1, 95% CI 61.7-91.9), and icaD (p-estimate = 77, 95% CI 68.6-83.6). Conversely, bap and bbp genes exhibited the lowest prevalence rates (p-estimate = 6.7 and 18.7, respectively). The network meta-analysis allowed us to examine the pairwise co-study of adhesion and biofilm-related genes in S. aureus isolates. The most frequently co-studied gene pairs were icaA-icaD (30 times) and fnbA-fnbB (25 times). Subgroup analysis showed that the occurrence of icaC and icaB genes was significantly lower in animal isolates compared to human and food isolates (p < 0.05). It is worth noting that there was limited data available for the analysis of sasG, bbp, bap, eno, and fib genes. In conclusion, the study revealed varying prevalence rates of adhesion and biofilm-related genes in S. aureus isolates. Genes such as clfB, eno, and icaD were found to be highly prevalent, while bap and bbp were less common. Limited existing data on the prevalence of genes like sasG, bbp, bap, eno, and fib highlights the need for further research to determine their exact prevalence rates. Our results contribute to a better understanding of S. aureus pathogenesis and can facilitate the development of effective strategies for the prevention and treatment of S. aureus infections.
... Intercellular polysaccharide (PIA) plays a key role in biofilm formation (Nguyen et al., 2020). The ica operon of S. aureus encodes five proteins: icaR, icaA, icaD, icaB, and icaC (de Silva et al., 2002;Diemond-Hernandez et al., 2010). The above five proteins control the synthesis of PIA. ...
Antibiotic-resistant S. aureus infections can be life-threatening. Linezolid is known to hinder S. aureus biofilm formation, but the underlying molecular mechanism remains unclear. Molecular docking revealed that linezolid can bind to icaA, and this was confirmed by thermal drift assays. Linezolid demonstrated a dose-dependent inhibition of icaA enzyme activity. Mutating Trp267, a key residue identified through molecular docking, significantly decreased linezolid binding and inhibitory effects on mutant icaA activity. However, the mutant icaA Trp267Ala showed only slight activity reduction compared to icaA. Linezolid had minimal impact on icaB's thermal stability and activity. The 50S ribosomal L3ΔSer145 mutant S. aureus exhibited similar growth and biofilm formation to the wild-type strain. Linezolid effectively suppressed the growth and biofilm formation of wildtype S. aureus. Although linezolid lost its ability to inhibit the growth of the mutant strain, it still effectively hindered its biofilm formation. Linezolid exhibited weaker attenuation of sepsis-induced lung injury caused by 50S ribosomal L3ΔSer145 mutant S. aureus compared to wild-type S. aureus. These findings indicate that linezolid hampers S. aureus biofilm formation by directly inhibiting icaA activity, independently of its impact on bacterial growth.
... Furthermore several previous studies have even reported 100% presence rates for these genes [23,24]. It well known that the product of icaADBC plays important roles in the synthesis of PIA, also known as poly-N-acetylglucosamine (PNAG) which is a key component of the bio lm matrix, allows S. aureus cells to adhere to surfaces and form cohesive structure of bio lm [29]. Indeed, the high prevalence rate of the icaADBC operon genes in S. aureus isolates is noteworthy due to their major impacts on bacterial bio lm formation and pathogenicity [29]; therefore these data could be applicable for novel therapeutic strategies targeting S. aureus bacteria specially for bio lm-related infections. ...
... It well known that the product of icaADBC plays important roles in the synthesis of PIA, also known as poly-N-acetylglucosamine (PNAG) which is a key component of the bio lm matrix, allows S. aureus cells to adhere to surfaces and form cohesive structure of bio lm [29]. Indeed, the high prevalence rate of the icaADBC operon genes in S. aureus isolates is noteworthy due to their major impacts on bacterial bio lm formation and pathogenicity [29]; therefore these data could be applicable for novel therapeutic strategies targeting S. aureus bacteria specially for bio lm-related infections. ...
... Although this enzyme shows limited activity, the co-expression of the icaD enhances its activity. This suggests that the icaD product somehow facilitates or enhances the function of the enzyme [29]. Additionally, from MSCRAMMs, fnbA-fnbB has received special attention in previous studies due to their unique roles. ...
Background: Staphylococcus aureus is a versatile pathogen capable of causing a wide range of infections, from minor skin infections to life-threatening invasive diseases. The pathogenicity of S. aureus is attributed to its ability to produce various virulence factors, including adhesion and biofilm-related proteins.
Methods: In this study, we conducted a comprehensive network meta-analysis to assess the prevalence of adhesion and biofilm-related genes in S. aureus isolates and investigate the impact of the isolate source on their occurrence.
Results: A total of 53 relevant studies were included. The highest prevalence were observed for clfB (p-estimate = 85.4), followed by eno (p-estimate = 81.1) and icaD (p-estimate = 77). Conversely, bap and bbp exhibited the lowest prevalence (p-estimate = 6.7 and 18.7, respectively). The most frequently co-studied gene pairs were icaA-icaD(30 times) and fnbA-fnbB (25 times). Based on subgroup analysis the occurrence of icaC and icaB was significantly lower in animal isolates compared to human and food.
Conclusion: The study revealed varying prevalence rates of adhesion and biofilm-related genes in S. aureus isolates. Our results contribute to a better understanding of S. aureus pathogenesis and can facilitate the development of effective strategies for the prevention and treatment of S. aureus infections.
... The genes esxA, icaC, and hld were present in 14, 30, and 25 genomes, respectively (Fig. 3e). The icaC gene is part of the ica operon which plays an essential role in mediating the formation of biofilm and has been implicated in therapeutic failure of staphylococcal device-related infections 25 Lineage shapes the accessory genomes of CoNS. We carried out a network analysis based on the Jaccard similarity of accessory gene content to determine if similarity in accessory gene content between any two genomes is influenced by the genetic background (i.e., higher similarity of accessory genomes within each Staphylococcus species regardless of animal source) or by animal host (i.e., higher similarity of accessory genomes within each animal host regardless of Staphylococcus species) ( Supplementary Fig. 5). ...
Coagulase-negative Staphylococcus (CoNS) are opportunistic pathogens implicated in many human and animal infections. The evolutionary history of CoNS remains obscure because of the historical lack of recognition for their clinical importance and poor taxonomic sampling. Here, we sequenced the genomes of 191 CoNS isolates representing 15 species sampled from diseased animals diagnosed in a veterinary diagnostic laboratory. We found that CoNS are important reservoirs of diverse phages, plasmids and mobilizable genes encoding antimicrobial resistance, heavy metal resistance, and virulence. Frequent exchange of DNA between certain donor-recipient partners suggests that specific lineages act as hubs of gene sharing. We also detected frequent recombination between CoNS regardless of their animal host species, indicating that ecological barriers to horizontal gene transfer can be surmounted in co-circulating lineages. Our findings reveal frequent but structured patterns of transfer that exist within and between CoNS species, which are driven by their overlapping ecology and geographical proximity.
... Biofilm aggregates are very difficult to penetrate being composed mainly of slime like substances as polysaccharide intercellular adhesions (PIA) encoded by icaA operon in S. aureus [37,38]. All LR-MRSA isolates showed biofilm formation ability and icaA gene was detected in six isolates of them, icaA gene is responsible for production of N-acetylglucosamyl transferase enzyme, which contributes to PIA formation [45]. A statistical significant correlation was observed between linezolid MIC values and the mean biofilm formation. ...
Background
Methicillin-Resistant Staphylococcus aureus (MRSA) causes life-threatening infections, with narrow therapeutic options including: vancomycin and linezolid. Accordingly, this study aimed to characterize phenotypically and genotypically, the most relevant means of linezolid resistance among some MRSA clinical isolates.
Methods
A total of 159 methicillin-resistant clinical isolates were collected, of which 146 were indentified microscopically and biochemically as MRSA. Both biofilm formation and efflux pump activity were assessed for linezolid-resistant MRSA (LR-MRSA) using the microtiter plate and carbonyl cyanide 3-chlorophenylhydrazone (CCCP) methods, respectively. Linezolid resistance was further characterized by polymerase chain reaction (PCR) amplification and sequencing of domain V of 23 S rRNA; rplC; rplD;and rplV genes. Meanwhile, some resistance genes were investigated: cfr; cfr(B); optrA; msrA;mecA; and vanA genes. To combat LR-MRSA, the effect of combining linezolid with each of 6 different antimicrobials was investigated using the checkerboard assay.
Results
Out of the collected MRSA isolates (n = 146), 5.48% (n = 8) were LR-MRSA and 18.49% (n = 27) were vancomycin-resistant (VRSA). It is worth noting that all LR-MRSA isolates were also vancomycin-resistant. All LR-MRSA isolates were biofilm producers (r = 0.915, p = 0.001), while efflux pumps upregulation showed no significant contribution to development of resistance (t = 1.374, p = 0.212). Both mecA and vanA genes were detected in 92.45% (n = 147) and 6.92% (n = 11) of methicillin-resistant isolates, respectively. In LR-MRSA isolates, some 23 S rRNA domain V mutations were observed: A2338T and C2610G (in 5 isolates); T2504C and G2528C (in 2 isolates); and G2576T (in 1 isolate). Amino acids substitutions were detected: in L3 protein (rplC gene) of (3 isolates) and in L4 protein (rplD gene) of (4 isolates). In addition, cfr(B) gene was detected (in 3 isolates). In 5 isolates, synergism was recorded when linezolid was combined with chloramphenicol, erythromycin, or ciprofloxacin. Reversal of linezolid resistance was observed in some LR-MRSA isolates when linezolid was combined with gentamicin or vancomycin.
Conclusions
LR-MRSA biofilm producers’ phenotypes evolved in the clinical settings in Egypt. Various antibiotic combinations with linezolid were evaluated in vitro and showed synergistic effects.
... icaA GAC CTC GAA GTC AAT AGA GGT CCC AGT ATA ACG TTG GAT ACC 814 [22] icaB AGAATCGTGAAGTATAGAAAATT TCTAATCTTTTTCATGGAATCCGT 880 [23] icaC CTTGGGTATTTGCACGCATT GCAATATCATGCCGACACCT 209 [18] icaD ACCCAACGCTAAAATCATCG GCGAAAATGCCCATAGTTTC 211 [18] fnbB ACGCTCAAGGCGACGGCAAAG ACCTTCTGCATGACCTTCTG-CACCT 197 [18] clfB AACTCCAGGGCCGCCGGTTG CCTGAGTCGCTGTCTGAGCCTGAG 159 [18] ...
Biofilms are assemblages of bacteria encased in an extracellular matrix, as well as proteins, exopolysaccharides and macromolecules such as DNA. Bacterial biofilms are thought to play a substantial influence in over 80% of bacterial illnesses. Biofilm buildup on medical implants is responsible for about 60% of hospital-acquired infections. In this study, 150 clinical samples (wound, urine and sputum) were collected from patients admitted to surgical wards of Azadi teaching hospital/Kirkuk during the period from February to October 2018. Of these, 98 (65.3%) were females and 52 (34.7%) were males. Congo Red Agar was used to test the potential of S. aureus isolates to produce biofilms. The relationship between S. aureus biofilm producer isolates and ica ABCD operon genes was studied by using PCR. Out of all samples, S. aureus isolates were identified in 29 (19.3%) of clinical samples, and most isolates were from wound infections (n=19, 65.5%) followed by urine (n=10, 43.5%). Whereas, no S. aureus isolate was detected in sputum samples. Moreover, S. aureus biofilm producing isolates were detected in 9 (24.1%) samples and were represented as black colonies on Congo Red Agar. The results of this study indicated the icaA, icaB, icaC and icaD genes harbored in 4 (44.4%) of S. aureus biofilm forming isolates while icaA, icaC, and icaD genes were detected in 6 (66.7%) of isolates. On the other hand, all S. aureus isolates were negative for both clfB and fnbB genes.
... In our study, icaA and icaB were found in 33% and 53% of selected isolates, respectively, while Al-Mtory et al. (2016) demonstrated that the prevalence of icaA and icaB was 95.8% and 91.6%, respectively [33]. The study of Diemond-Hernández et al. (2010) detected icaA in 10.3% but did not detect the icaB gene [34]. Our study did not identify all tested ica operon genes in the tested strains, in agreement with previous reports [34,35]. ...
... The study of Diemond-Hernández et al. (2010) detected icaA in 10.3% but did not detect the icaB gene [34]. Our study did not identify all tested ica operon genes in the tested strains, in agreement with previous reports [34,35]. ...
Sixty-six (66) Staphylococcus bacterial isolates were withdrawn from separate clinical samples of hospitalized patients with various clinical infections. Conventional bacteriological tests identified the species of all isolates, and standard microbiological techniques differentiated them into CoPS or CoNS. Their biofilm development was followed by an analysis via the MTP (microtiter tissue culture plates) technique, and we then investigated the presence/absence of icaA and icaB, which were qualified in the top-30 potent biofilm-forming isolates. Thirteen isolates (46.7%) showed the presence of one gene, six (20%) isolates exhibited the two genes, while ten (33.3%) had neither of them. The formation of staphylococci biofilms in the absence of ica genes may be related to the presence of other biofilm formation ica-independent mechanisms. CoPS was the most abundant species among the total population. S. aureus was the sole representative of CoPS, while S. epidermidis was the most abundant form of CoNS. Antibiotic resistance was developing against the most frequently used antimicrobial drugs, while vancomycin was the least-resisted drug. The totality of the strong and medium-strength film-forming isolates represented the majority proportion (80%) of the total investigated clinical samples. The biochemical pattern CoPS is associated with antibiotic resistance and biofilm formation and can be an alarming indicator of potential antibiotic resistance.
... Staphylococci possess a wide range of surface adhesins, including the previously described MSCRAMM proteins that are covalently linked to peptidoglycan subunits thanks to SrtA activity; nevertheless, polysaccharide intercellular adhesin (PIA), being a homopolymer of partially deacetylated β-1,6-linked N-acetyl-glucosamine (PNAG), plays a pivotal role in cell-to-cell interactions, leading to the accumulation of staphylococcal biomass. PIA/PNAG is encoded by the intercellular adhesion operon ica, which contains icaADBC genes [12,54,66,67]. Thus, the inhibition of SrtA activity limiting the expression of surface adhesive proteins by V. opulus extracts demonstrated in this study may not be as strongly reflected in biofilm formation by staphylococci, as expected. ...
... Moreover, S. aureus strains that do not possess the ica operon are also able to form a biofilm. It has been revealed that some components or products of staphylococcal cells, such as teichoic acids, adhesive proteins (mainly SasG and Bap), extracellular DNA (eDNA), β-hemolysin, or even bacterial metabolites may participate in bacterial adhesion, forming a framework that stabilizes staphylococcal biofilm and also replace PIA/PNAG in its role as a mediator of intercellular interactions [12,54,66,68,69]. Thus, V. opulus fruit and bark extracts may limit biofilm formation by staphylococci, but the effect is strongly strain-dependent. ...
Staphylococcus aureus is still one of the leading causes of both hospital- and community-acquired infections. Due to the very high percentage of drug-resistant strains, the participation of drug-tolerant biofilms in pathological changes, and thus the limited number of effective antibiotics, there is an urgent need to search for alternative methods of prevention or treatment for S. aureus infections. In the present study, biochemically characterized (HPLC/UPLC–QTOF–MS) acetonic, ethanolic, and water extracts from fruits and bark of Viburnum opulus L. were tested in vitro as diet additives that potentially prevent staphylococcal infections. The impacts of V. opulus extracts on sortase A (SrtA) activity (Fluorimetric Assay), staphylococcal protein A (SpA) expression (FITC-labelled specific antibodies), the lipid composition of bacterial cell membranes (LC-MS/MS, GC/MS), and biofilm formation (LIVE/DEAD BacLight) were assessed. The cytotoxicity of V. opulus extracts to the human fibroblast line HFF-1 was also tested (MTT reduction). V. opulus extracts strongly inhibited SrtA activity and SpA expression, caused modifications of S. aureus cell membrane, limited biofilm formation by staphylococci, and were non-cytotoxic. Therefore, they have pro-health potential. Nevertheless, their usefulness as diet supplements that are beneficial for the prevention of staphylococcal infections should be confirmed in animal models in the future.
