Figure 1 - uploaded by Jonathan Kirk Harris
Content may be subject to copyright.
(a) A Hamming code to transmit one bit of information (k=1, n=3). Consider a hypersphere centered at 000 (blue): any single-bit error (010, 001, and 100) falls within a radius of 1 and thus can be corrected. Likewise with the hypersphere centered at 111 (red). (b) Regions of a codeword of length 16 (or longer) checked by parity bits at positions 0, 1, 2, and 4: bits that are checked by each position are marked with 1. (c) Example of decoding a "received" codeword containing the binary value of 3 (0011) (n=7, k=4): the first case contains no errors; the second contains a single-bit error at position 6 that is detected and corrected.
Source publication
We constructed error-correcting DNA barcodes that allow one run of a massively parallel pyrosequencer to process up to 1,544 samples simultaneously. Using these barcodes we processed bacterial 16S rRNA gene sequences representing microbial communities in 286 environmental samples, corrected 92% of sample assignment errors, and thus characterized ne...
Citations
... The second PCR experiment entailed the addition of the Illumina P5/P7 adapter and an 8× base index sequence (Hamady et al., 2008) to the obtained DNA, together with 1× KAPA HiFi HotStart ReadyMix, 0.3 μM each of forward and reverse primers, and 1 μL of the first PCR product per sample, resulting in a final volume of 12 μL. ...
Hyporheic zones play a crucial role in ecological processes primarily orchestrated by hyporheic organisms, known as hyporheos. Our understanding of riverine biodiversity, encompassing hyporheic zones, remains limited. Therefore, the development of a method for the facile and accurate detection of hyporheic communities is imperative. Thus, we evaluated the applicability of environmental DNA (eDNA) metabarcoding surveys in the hyporheic zone in a small stream in Japan. We conducted simultaneous direct sampling and eDNA surveys at two different locations (head and tail of a rapid and a bar) and during two different seasons (less and more disturbed periods). Subsequently, we compared the outcomes of these sampling methods, locations, and seasons. Through eDNA metabarcoding targeting the cytochrome‐c oxidase subunit I (COI) regions, we successfully identified a diverse array of hyporheic and benthic taxa in all samples. Remarkably, the performance of eDNA metabarcoding was comparable to the identification of directly sampled benthos and hyporheos. We observed a 62%–78% concordance between direct sampling and eDNA metabarcoding. Notably, eDNA metabarcoding revealed a higher number of hyporheic taxa compared to direct sampling. Moreover, the relative detectability of hyporheos by eDNA metabarcoding differed between the seasons, unlike direct sampling. Our findings underscore the importance of conducting both eDNA surveys and direct sampling to comprehensively assess the composition of the stream community while accounting for seasonal variations. This study demonstrates the utility of eDNA metabarcoding as a non‐destructive approach for investigating the hyporheic zone, enabling a more effective assessment of riverine biodiversity.
... We amplified the chloroplast trnL P6 loop region using the universal primer pair g and h designed by Taberlet et al. (2007) (Table S2). To identify the sequences obtained from each sample, the forward primer was tagged with a multiplex identifier (MID) (Hamady et al., 2008) ( Table S3). Since we had 300 MID tags, two individuals shared the same tag sequences. ...
Anthropogenic noise is ubiquitous globally. However, we know little about how the impacts of noise alter fundamental ecosystem properties, such as resource consumption by invertebrate consumers. Using experimental noise manipulation and faecal DNA metabarcoding, we assessed how the direct and cross‐trophic indirect effects of noise altered the dietary richness and specializations of omnivorous grasshoppers in a grassland ecosystem. We found that the experimental noise treatment expanded grasshoppers' dietary richness and resulted in dietary generalizations in both noise‐exposed and adjacent relatively quieter areas. Unexpectedly, however, these dietary changes were primarily explained by the direct effect of noise not only in the noise‐exposed areas but also in the adjacent quieter areas and were relaxed by indirect effects of noise such as reduced birds and predation risk and increased grasshoppers. Our work suggests that noise pollution can be key in explaining the variation of invertebrate consumers' diets across a gradient of noise‐exposed environments.
... Given these previous studies, the difference we observed between the 27F/338R primer set and the 27F-RYM/338R-WWW primer set, used in other studies, was unexpected. Thus, it is necessary to highlight that, although this degenerate primer set has been extensively used for bacteria in field studies for a long time, it may fail to find the major groups in coastal seawater (Hamady et al., 2008;Fortunato et al., 2012;Wear et al., 2018;McNichol et al., 2021). The different results obtained from the degenerate and nondegenerate primer sets may be due to differences in the binding and amplification efficiency of the PCR primers (Wagner et al., 1994;Polz and Cavanaugh, 1998;Lanzeń et al., 2011). ...
Next-generation sequencing (NGS), especially metabarcoding, is commonly used to study the diversity and distribution of microbes in diverse ecosystems. The choice of primer set is critical, given the drawbacks of short amplicons and amplicon sequencing bias inherent to metabarcoding. However, comparative analyses of primer sets have rarely been conducted using field samples. In this study, we compared eight commonly used primer sets, all targeting hypervariable regions in the bacterial 16S rRNA gene: 27F/338R (V1–V2), V2f/V3r (V2–V3), PRK341F/PRK806R (V3–V4), 341F/785R (V3–V4), 515F/806RB (V4), 515F/806R (V4), 515F-Y/926R (V4–V5), and B969F/BA1406R (V6–V8). We conducted NGS in triplicate, with >0.8 billion bases in total using coastal seawater samples. The representation of bacterial community composition varied significantly across the eight primer sets, despite being from the same sample. The 27F/338R primer set showed the highest number of operational taxonomic units (OTUs) and read counts, and accounted for 68% of all the order-level taxa found. Remarkably, a novel complementary combination of two primer sets, 27F/338R and 515F/806RB, covered 89% of all the orders that were present. Compared to other primer sets, this combination detected more OTUs of the orders Pelagibacterales and Rhodobacterales , which are ubiquitous in the oceans. As such, use of this combination in future studies may help to reduce diversity bias in ocean-derived samples, in particular temperate coastal samples.
... mdpi.com/article/10.3390/jcm12186078/s1, Figure S1: Environmental climate reporting during study period; Figure S2: Location of skin evaluations; Figure S3: Set-up of the D-SKIN Cell®apparatus. Figure S4: Comparison of skin trans epidermal water loss between the moisturizers/NT; Figure S5: Maximum likelihood phylogenetic tree based on 16S rRNA V1-V2 region sequences of 53 Staphylococ-cus type strains downloaded from the EzBioCloud 16S database; Figure S6: Maximum likelihood phylogenetic tree based on 16S rRNA V1-V2 region sequences of 110 Streptococcus type strains downloaded from the EzBioCloud 16S database; Figure S7: Hierarchical-clustering heat map of 23 major bacterial genera according to 40 groups based on skin sites, sampling times, and occupations; Figure S8: The change ratio of the relative abundance of bacterial genera showed significance at 4 and 8 weeks after using (A) Moisturizer C (water gel) and (B) Moisturizer L (extra dry emulsion); Table S1: Comparison of Moisturizer formulations; Table S2: The proportion (Mean ± SD, %) of major Staphylococcus species (groups) in the total staphylococcal reads for each involved skin site at three sampling times; Table S3: The proportion (Mean ± SD) of major Streptococcus species (groups) in the total streptococcal reads for each involved skin site at three sampling times; Table S4: Bacterial and fungal alpha diversity indices for different sites at the baseline; Table S5: Details of bacterial and fungal PERMANOVA results for 291 upper chest samples grouped by different factorsa; Table S6: Changing trends in bacterial and fungal alpha diversity indices at different sampling times among 291 upper chest samples; Table S7: The relative abundance of bacterial genera (Mean ± SD) with the significant change ratio (Median, (Q1, Q3)) in the presence of Moisturizer K; Table S8: The relative abundance of major Staphylococcus species (Mean ± SD) and their change ratio in the presence of Moisturizer K (Median, (Q1, Q3)); Table S9: The relative abundance of major Staphylococcus species (Mean ± SD) and their change ratio in the presence of Moisturizer C (Median, (Q1, Q3)); Table S10: The relative abundance of major Staphylococcus species (Mean ± SD) and their change ratio in the presence of Moisturizer L (Median, (Q1, Q3)) [21,[45][46][47][48][49][50][51][52][53][54]. ...
The skin microbiota barrier participates in skin barrier function in addition to the physical, chemical, and immunological protective barriers, and is affected by environmental aggressors and skincare regimens. To better understand the exact effects of real-life environmental conditions on the skin and determine the protective methods, this study investigates the effects of three topical cosmetic moisturizers (water gel moisturizers with/without yeast extract (Moisturizers K and C) and a thick-emulsion cream moisturizer (Moisturizer L)) on clinical and skin microbiome endpoints in the presence of environmental aggressors during an 8-week, randomized controlled, triple-blind clinical trial with 110 participants, and molecular- as well as biomarker-level endpoints on ex vivo skin explants after exposure to simulate urban environmental conditions. The results show that all moisturizers are well-tolerated and improve skin barrier function and surface moisture content from the baseline, and the improvement is maintained at the last analysis point (3 days after trial completion). Compared with the untreated control areas (samples taken from the upper chest), treatment with Moisturizer K prevented a reduction in bacterial and fungal richness, and increased the change ratio of the relative abundance of commensal bacteria, such as Staphylococcus epidermidis and Ralstonia, at the treated sites (samples taken from the forehead). Moreover, Moisturizer K-treated ex vivo skin explants had higher levels of caspase 14 (a marker of skin barrier function), collagen I, and elastin (structure components), and lower levels of aryl hydrocarbon receptor (AHR; activated by air pollutants) and interleukin-6 (IL-6) than those in explants treated with other moisturizers and in the untreated areas of the skin. These results suggest that a skin postbiotic moisturizer with yeast extract supports the regulation of the skin's microbiome balance and may provide a holistic barrier (involving skin microbiome, physical, chemical, and immune barriers) to protect the skin against environmental aggressors.
... To prevent generation of chimaeric sequences, the ramp rate through the thermal cycles was set to 1 °C s −1 (ref.58). Illumina sequencing adaptors were then added to respective samples in the supplemental PCR using the forward fusion primers consisting of the P5 Illumina adaptor, 8-mer indexes for sample identification59 and a partial sequence of the sequencing primer (5′-AAT GAT ACG GCG ACC ACC GAG ATC TAC AC-(8-mer index)-TCG TCG GCA GCG TC-3′) (0.43 μM each) and the reverse fusion primers consisting of the P7 adaptor, 8-mer indexes and a partial sequence of the sequencing primer (5′-CAA GCA GAA GAC GGC ATA CGA GAT-(8-mer index)-GTC TCG TGG GCT CGG-3′) (0.43 μM each) ...
In nature, entangled webs of predator–prey interactions constitute the backbones of ecosystems. Uncovering the network architecture of such trophic interactions has been recognized as the essential step for exploring species with great impacts on ecosystem-level phenomena and functions. However, it has remained a major challenge to reveal how species-rich networks of predator–prey interactions are continually reshaped through time in the wild. Here, we show that dynamics of species-rich predator–prey interactions can be characterized by remarkable network structural changes and alternations of species with greatest impacts on community processes. On the basis of high-throughput detection of prey DNA from 1,556 spider individuals collected in a grassland ecosystem, we reconstructed dynamics of interaction networks involving, in total, 50 spider species and 974 prey species and strains through 8 months. The networks were compartmentalized into modules (groups) of closely interacting predators and prey in each month. Those modules differed in detritus/grazing food chain properties, forming complex fission–fusion dynamics of belowground and aboveground energy channels across the seasons. The substantial shifts of network structure entailed alternations of spider species located at the core positions within the entangled webs of interactions. These results indicate that knowledge of dynamically shifting food webs is crucial for understanding temporally varying roles of ‘core species’ in ecosystem processes.
... The Illumina sequencing adaptors plus the 8 bp identifier indices (Hamady et al. 2008) were added in the subsequent PCR process using a forward and reverse fusion primer (forward, AATGATACGGCGACCACCGAGATCTACAC-index-TCGTCG-GCAGCGTC; reverse, CAAGCAGAAGACGGCATACGAGATindex-GTCTCGTGGGCTCGG). The second step was conducted in a 25 µL reaction mixture and the thermal cycles of the second PCR were as follows: pre-denaturation at 94 °C for 2 min, followed by 8 cycles of denaturation at 98 °C for 10 s, annealing at 55 °C for 30 s, elongation at 68 °C for 1 min, and a final elongation at 68 °C for 7 min. ...
As an ectomycorrhizal fungal genus that contains matsutake and other edible mushrooms, Tricholoma has great economic and ecological significance. However, the phylogenetic relationships within the genus remain unsettled. To clarify the infrageneric relationships of Tricholoma , including the identification of monophyletic subgenera and sections, three phylogenetic analyses were conducted employing single-locus (ITS), five-locus (ITS/ RPB2 / EF-1α / MCM7 /mtSSU) and 50-locus (45 single-copy orthologous genes plus the aforementioned ones) DNA nucleotide sequences. Our data indicated that ITS sequences could serve the species delimitation of Tricholoma in most cases and monophyletic groups recognition in some cases, and the five-locus dataset could resolve a section-level phylogeny of this genus, while the 50-locus dataset could clarify the delimitation of subgenera and settle the relationships among sections within this genus. A fifty-locus dataset was firstly employed to construct a robust phylogeny of Tricholoma . Based on this, a new infrageneric arrangement for the genus Tricholoma , with four subgenera, of which two are in accordance with the previous subgenera Pardinicutis and Sericeicutis , and eleven sections, is suggested. Subgenus Pardinicutis , occupying the basal position, only harbors sect. Pardinicutis , while the subg. Sericeicutis comprises sects. Lasciva and Sericella located at the sub-basal position with good support. Subgenus Terrea is newly erected here and consists of sect. Terrea , sect. Atrosquamosa and two as yet unnamed phylogenetic lineages. Besides an unnamed section-level lineage, subg. Tricholoma consists of sects. Genuina , Muscaria , Rigida , Tricholoma , Fucata and Matsutake , of which the two latter are newly proposed. The previously defined subg. Contextocutis is clustered within subg. Tricholoma and is a synonym of the latter. Tricholoma colossus , T. acerbum and their allies, which used to be allocated in sect. Megatricholoma (or genus Megatricholoma ), are relocated to sect. Genuina since they form a strongly supported monophyletic group and share rusty or black spots on lamellae with other species in this section. Taxonomic descriptions of the new infrageneric taxa and a key to subgenera and sections of the genus Tricholoma are presented.
... The amplicons were cleaned using KAPA Pure Beads (KAPA Biosystems Inc., Wilmington, MA, United States) at a final concentration of 0.8X v/v to remove the solution of primer dimers. Next, a second six-cycle PCR amplification was conducted to add unique 12 basepair barcodes to each cleaned sample amplicon (Hamady et al., 2008) using the forward primer composed of the ...
Steep Cone Geyser is a unique geothermal feature in Yellowstone National Park (YNP), Wyoming, actively gushing silicon-rich fluids along outflow channels possessing living and actively silicifying microbial biomats. To assess the geomicrobial dynamics occurring temporally and spatially at Steep Cone, samples were collected at discrete locations along one of Steep Cone's outflow channels for both microbial community composition and aqueous geochemistry analysis during field campaigns in 2010, 2018, 2019, and 2020. Geochemical analysis characterized Steep Cone as an oligotrophic, surface boiling, silicious, alkaline-chloride thermal feature with consistent dissolved inorganic carbon and total sulfur concentrations down the outflow channel ranging from 4.59 ± 0.11 to 4.26 ± 0.07 mM and 189.7 ± 7.2 to 204.7 ± 3.55 μM, respectively. Furthermore, geochemistry remained relatively stable temporally with consistently detectable analytes displaying a relative standard deviation <32%. A thermal gradient decrease of ~55°C was observed from the sampled hydrothermal source to the end of the sampled outflow transect (90.34°C ± 3.38 to 35.06°C ± 7.24). The thermal gradient led to temperature-driven divergence and stratification of the microbial community along the outflow channel. The hyperthermophile Thermocrinis dominates the hydrothermal source biofilm community, and the thermophiles Meiothermus and Leptococcus dominate along the outflow before finally giving way to more diverse and even microbial communities at the end of the transect. Beyond the hydrothermal source, phototrophic taxa such as Leptococcus, Chloroflexus, and Chloracidobacterium act as primary producers for the system, supporting heterotrophic growth of taxa such as Raineya, Tepidimonas, and Meiothermus. Community dynamics illustrate large changes yearly driven by abundance shifts of the dominant taxa in the system. Results indicate Steep Cone possesses dynamic outflow microbial communities despite stable geochemistry. These findings improve our understanding of thermal geomicrobiological dynamics and inform how we can interpret the silicified rock record.
... Primers specific to 18S rRNA genes of parabasalids with Illumina adaptor sequences at their 5′ ends-nexF-ParaV45F 5′-TCG TCG GCA GCG TCA GAT GTG TAT AAG AGA CAG-3′ and nexF-ParaV45R 5′-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA G-3′-were used for the first PCR (Jasso- Selles et al. 2020;De Martini et al. 2021). Indexing barcodes were attached to both ends of each amplicon during the second PCR (Hamady et al. 2008). Conditions for the first PCR were as follows: 3 min denaturation at 95°C, 30 cycles of 95°C for 30 s, 48°C for 30 s, and 72°C for 50 s, and a final 10 min extension at 72°C. ...
Many host-symbiont relationships are maintained through vertical transmission. While maternal symbiont transmission is common, biparental transmission is relatively rare. Protist-dependent termites are eusocial insects that harbor obligate, cellulolytic protists in their hindguts. Protists are vertically transmitted by winged reproductives (alates), which disperse to biparentally establish new colonies. Vertical transmission in protist-dependent termites is imperfect, as the protist communities of alates are often incomplete. Biparental transmission of protists may make it unnecessary for alates to harbor complete communities, as colonies would acquire symbionts from both founding kings and queens, which together may harbor sufficient inoculums. To investigate this hypothesis, the protist communities of Coptotermes gestroi and C. formosanus alates and colonies were examined using 18S rRNA amplicon sequencing. The complete protist communities of these Coptotermes species are composed of five parabasalid species each. Whereas alates often harbored 1–3 protist species, nearly all colonies harbored 4–5 species, implying biparental transmission. The probability of each protist species being present in at least one founding alate was used to determine expected protist occurrence in colonies. For most protists, expected and observed occurrence did not significantly differ, suggesting that each protist species only needs to be harbored by one founding alate to be acquired by colonies. Our results imply that biparental transmission allows founding reproductives to transmit adequate symbiont communities to colonies despite their individual communities being incomplete. We discuss biparental transmission in protist-dependent termites in the context of other biparentally transmitted symbioses.
... A higher than recommended concentration was used since the primes are 32-64 fold degenerate. For MiSeq sequencing, primers were barcoded using error-detecting barcodes (appended onto the forward primer sequence) and synthesized by IDT (Hamady et al., 2008). For each extraction protocol, we performed three negative controls that instead of biofilm sample contained RT-PCR Grade Water (Ambion ® ), free of any DNAase and RNAse. ...
Viruses are a major component of the human microbiome, yet their diversity, lifestyles, spatiotemporal dynamics, and functional impact are not well understood. Elucidating the ecology of human associated phages may have a major impact on human health due to the potential ability of phages to modulate the abundance and phenotype of commensal bacteria. Analyzing 690 Human Microbiome Project metagenomes from 103 subjects sampled across up to 18 habitats, we found that despite the great interpersonal diversity observed among human viromes, humans harbor distinct phage families characterized by their shared conserved hallmark genes known as large terminase subunit (TerL) genes. Phylogenetic analysis of these phage families revealed that different habitats in the oral cavity and gut have unique phage community structures. Over a ~7-month timescale most of these phage families persisted in the oral cavity and gut, however, presence in certain oral habitats appeared to be transitory, possibly due to host migration within the oral cavity. Interestingly, certain phage families were found to be highly correlated with pathogenic, carriage and disease-related isolates, and may potentially serve as novel biomarkers for disease. Our findings shed new light on the core human virome and offer a metagenomic-independent way to probe the core virome using widely shared conserved phage markers.
... Multiple 50 μl PCR reactions were performed using the universal 16S rRNA bacterial primers 357F (AxxxxxxACT CCT ACG GGA GGC AGC AG) and 785R (B-TACNVGGG TAT CTA ATC C), where A and B represent the adaptors A and AB for pyrosequencing using the Titanium pyrosequencing reaction (GS20, Roche/454 Life Sciences, Branford, CT, USA) ). The xxxxxx represents six nucleotide sequence tags designed for sample identification barcoding (Hamady et al. 2008;Binladen et al. 2007). Control samples for the pyrosequencing reactions were prepared using equal amounts of chromosomal DNA from the bacteria Escherichia coli MG1655 and Bacillus subtilis 128. ...
The Kyzyl-Kum Desert extends over an area of 300,000 Km², in the region bordering Kazakhstan, Uzbekistan and Turkmenistan and is mainly covered by sand dunes. The Kyzyl-Kum desert is also known for its large deposits of minerals of economic interests, the exploitation of which is affecting the local ecosystem and increasing the desertification. We examined the bacterial biodiversity of surface sand samples from several sites from the Kyzyl-Kum desert using pyrosequencing of PCR amplified bacterial 16S rRNA genes from total extracted soil DNA. We also examined several physicochemical parameters of the sand samples to investigate any possible correlations between bacterial community structure and environmental drivers. The predominant bacterial phyla present in the samples were found to belong to members of the Actinobacteria, Proteobacteria and Bacteroidetes. The most abundant genera in our samples were found to belong to the Arthrobacter, Adhaeribacter and Roseomonas genera. We found that the relative abundance of members belonging to the Actinobacteria phylum, commonly found in desertic areas, increase in abundance in sites with higher content of organic matter and sulfur, whereas members of the Proteobacteria and Bacteroidetes phyla seems to diminish in abundance in coarse silt and fine-grained soils and those rich in magnesium, suggesting that those parameters might influence the bacterial community composition in this desertic area. This study is the first to provide new insights into the prokaryotic community composition from this unusual desert site.
