Figure 4 - uploaded by Bart C Weimer
Content may be subject to copyright.
Signature of glycan profiles and how each glycan-degrading enzyme modulates the glycans during infection. (A) Signature of glycan profiles during infection. There is an increase in abundances of highmannose and hybrid glycans. Also the glycans are switched from being highly sialylated to highly fucosylated (the degree of fucosylation increases and the degree of sialylation decreases); (B–E) Glycans that are highly regulated by Salmonella glycan-degrading enzymes during infection. The comparisons between CHPNeu and nanH (Sialidases) and malS and glgX (Amylases) are shown. LSD was used for statistical analysis. Error bars indicate SEM between 3 biological replications. Levels not connected with the same letter are significantly different. Statistical analysis was done within each structure.
Source publication
Complex glycans cover the gut epithelial surface to protect the cell from the environment. Invasive pathogens must breach the glycan layer before initiating infection. While glycan degradation is crucial for infection, this process is inadequately understood. Salmonella contains 47 glycosyl hydrolases (GHs) that may degrade the glycan. We hypothesi...
Contexts in source publication
Context 1
... amylase genes (malS and glgX) are also divergent in their sequence, but both contain the required domains for amylase activity (Supplementary Figure S4). Deletion of malS (STM3664; α -amylase) significantly decreased Salmonella invasion (p < 0.0001), resulting in the same level of invasion as ΔinvA (STM2896; needle complex export protein for T3SS), which is considered non-pathogenic and deficient for adhesion and invasion in vivo 22 . ...
Context 2
... were induced during infection (Fig. 3D). The two sialidases in Salmonella were induced during infection, suggesting that Neu5Ac would be released. The glycans were depleted in Neu5Ac during infection, which may indicate the cooperative activity of the host and the pathogen resulted in a reduction of the degree of sialylation from three to one (Fig. ...
Context 3
... in host glycan biosynthesis. Gene induction is represented as a log ratio (q < 0.05) and displayed in shades of red. the host cell after infection showed similar composition, all of which contained increased mannose content. During infection, the degrees of fucosylation and sialylation also shifted to have higher fucosylation and less sialylation (Fig. 4A). The host cell glycan composition was not expected to be altered during infection with ΔinvA since it contained all the glycan-degrading enzymes found in the WT. However, 11 different structures were observed compared to the WT, while the fucose and Neu5Ac content remained unchanged. The host gly- can composition remained unchanged ...
Context 4
... unchanged when infected with ΔmelA with six glycan differences compared to WT, which may explain the similar invasion phenotype as compared to the WT (Fig. 1B). Further examination of the glycans led to identification of specific structures that uniquely linked to Salmonella GHs, specifically siali- dases and amylases, and regulated infection (Fig. 4B-E). While sialidases are required to initiate glycan degra- dation we also observed that other glycan-degrading enzymes aid to complete the degradation of these glycans to invade. Glycans m/z = 2499.899 (Hex 6 Fig. 4C-E). Upon infection with mutant GHs, the most increase in relative abundance was seen during infection with ΔmalS, ΔmalS, ...
Context 5
... of specific structures that uniquely linked to Salmonella GHs, specifically siali- dases and amylases, and regulated infection (Fig. 4B-E). While sialidases are required to initiate glycan degra- dation we also observed that other glycan-degrading enzymes aid to complete the degradation of these glycans to invade. Glycans m/z = 2499.899 (Hex 6 Fig. 4C-E). Upon infection with mutant GHs, the most increase in relative abundance was seen during infection with ΔmalS, ΔmalS, ΔCHPNeu, ΔmalS, ΔglgX, and ΔmalS, respectively for each of the glycans, which may sug- gest that these GHs targeted and degraded those glycans (Fig. 4C-E (Fig. 4B-D), suggesting Salmonella induces the host to produce ...
Context 6
... the degradation of these glycans to invade. Glycans m/z = 2499.899 (Hex 6 Fig. 4C-E). Upon infection with mutant GHs, the most increase in relative abundance was seen during infection with ΔmalS, ΔmalS, ΔCHPNeu, ΔmalS, ΔglgX, and ΔmalS, respectively for each of the glycans, which may sug- gest that these GHs targeted and degraded those glycans (Fig. 4C-E (Fig. 4B-D), suggesting Salmonella induces the host to produce or increase the relative production of these glycans. Lastly, glycans m/z = 2688.004 (Hex 5 HexNAc 7 Fuc 3 ) and 2483.904 (Hex 5 HexNAc 6 Fuc 1 Neu5Ac 1 ) stayed at similar levels throughout the infection (Fig. 4B,D) suggest- ing that Salmonella does not have the ...
Context 7
... of these glycans to invade. Glycans m/z = 2499.899 (Hex 6 Fig. 4C-E). Upon infection with mutant GHs, the most increase in relative abundance was seen during infection with ΔmalS, ΔmalS, ΔCHPNeu, ΔmalS, ΔglgX, and ΔmalS, respectively for each of the glycans, which may sug- gest that these GHs targeted and degraded those glycans (Fig. 4C-E (Fig. 4B-D), suggesting Salmonella induces the host to produce or increase the relative production of these glycans. Lastly, glycans m/z = 2688.004 (Hex 5 HexNAc 7 Fuc 3 ) and 2483.904 (Hex 5 HexNAc 6 Fuc 1 Neu5Ac 1 ) stayed at similar levels throughout the infection (Fig. 4B,D) suggest- ing that Salmonella does not have the specificity to ...
Context 8
... may sug- gest that these GHs targeted and degraded those glycans (Fig. 4C-E (Fig. 4B-D), suggesting Salmonella induces the host to produce or increase the relative production of these glycans. Lastly, glycans m/z = 2688.004 (Hex 5 HexNAc 7 Fuc 3 ) and 2483.904 (Hex 5 HexNAc 6 Fuc 1 Neu5Ac 1 ) stayed at similar levels throughout the infection (Fig. 4B,D) suggest- ing that Salmonella does not have the specificity to recognize these glycans to degrade. These results suggest that the GHs within a genome contribute to virulence. Perhaps GHs represent a new virulence mechanism that is con- trolled by the host glycan structure and the gene content on the pathogen. This elucidates how ...
Context 9
... that new glycan structures were produced de novo (Fig. 2F) during infection. Hooper et al. and Bry et al. also found in vivo that the host produced new glycans con- taining fucosylation in the ileum that is microbe induced via α 1,2-fucosyltransferase transcripts 6,7 . Refinement of the glycan by the Salmonella during infection was also observed (Fig. 4A). The shift to low Neu5Ac content is supported by these changes in sialidases and sialyltransferases (Fig. 3D,E, Supplementary Table S4). The accu- mulation of fucosylated glycans is supported by the changes in host fucosidases and fucosyltransferases (Fig. 3C) after infection, as previously observed 6,7 . Pickard et al. also observed ...
Similar publications
Streptococcus pneumoniae (S. pneumoniae) is a leading human pathogen, which takes large responsibility for severe otitis media, acute meningitis and septicaemia. It encodes up to three distinct sialidases: NanA, NanB and NanC, which are promising drug targets. Recent experimental studies have shown that these three sialidases might work together up...
Citations
... This enzymatic activity facilitates the pathogen's attachment to the epithelial cell surface, aiding in its colonization and subsequent invasion. 62 Preserving the integrity of the gut barrier and thwarting Salmonella's access to epithelial membranes presents a promising strategy for controlling infections not only in the gut but also across other epithelial surfaces. ...
The human gastrointestinal tract is colonized by a complex microbial ecosystem, the gut microbiota, which is pivotal in maintaining host health and mediating resistance to diseases. This review delineates colonization resistance (CR), a critical defensive mechanism employed by the gut microbiota to safeguard against pathogenic bacterial invasions, notably by Salmonella. We detail the mechanisms through which the gut microbiota impedes Salmonella colonization, including nutrient competition, production of antimicrobial peptides, synthesis of microbial-derived metabolites, and modulation of the host immune response. Additionally, we examine how dietary interventions can influence these mechanisms, thereby augmenting the protective role of the gut microbiota. The review also discusses the sophisticated strategies utilized by Salmonella to overcome these microbial defenses. A thorough understanding of these complex interactions between microbial symbionts and pathogens is crucial for the development of innovative therapeutic strategies that enhance CR, aiming to prevent or treat microbial infections effectively.
... What is important to note is that glycome changes are driven by dysbiosis. For example, Salmonella can directly alter human glycan biosynthesis [87]. Impairment of the glycosylation profile leads to disruption of the mucus layer, glycan-lectin interactions, host-microbe interactions, and mucosal immunity, ultimately contributing to IBD pathogenesis [5]. ...
Inflammatory bowel disease (IBD) is an incurable, chronic disorder of the gastrointestinal tract whose incidence increases every year. Scientific research constantly delivers new information about the disease and its multivariate, complex etiology. Nevertheless, full discovery and understanding of the complete mechanism of IBD pathogenesis still pose a significant challenge to today’s science. Recent studies have unanimously confirmed the association of gut microbial dysbiosis with IBD and its contribution to the regulation of the inflammatory process. It transpires that the altered composition of pathogenic and commensal bacteria is not only characteristic of disturbed intestinal homeostasis in IBD, but also of viruses, parasites, and fungi, which are active in the intestine. The crucial function of the microbial metabolome in the human body is altered, which causes a wide range of effects on the host, thus providing a basis for the disease. On the other hand, human genomic and functional research has revealed more loci that play an essential role in gut homeostasis regulation, the immune response, and intestinal epithelial function. This review aims to organize and summarize the currently available knowledge concerning the role and interaction of crucial factors associated with IBD pathogenesis, notably, host genetic composition, intestinal microbiota and metabolome, and immune regulation.
... What is important to note is that glycome changes are driven by dysbiosis. For example, Salmonella can directly alter human glycan biosynthesis [64]. Impairment of the glycosylation profile leads to disruption of the mucus layer, glycan-lectin interactions, host-microbe interactions, mucosal immunity, and ultimately contributes to IBD pathogenesis [5]. ...
Inflammatory bowel disease (IBD) is an incurable, chronic disorder of the gastrointestinal tract, whose incidence increases every year. Scientific research is constantly delivering new information about the disease and its multivariate, complex etiology. Nevertheless, full discovery and understanding of the complete mechanism of IBD pathogenesis still pose a significant challenge to today's science. Recent studies unanimously confirmed the association of gut microbial dysbiosis with IBD, as well as its contribution to the regulation of the inflammatory process. It transpires that not only the altered composition of pathogenic and commensal bacteria is characteristic of disturbed intestinal homeostasis in IBD, but also of viruses, parasites, and fungi, which are active in the intestine. In fact, the crucial function of microbial metabolome in the human body is altered, which causes a wide range of effects in the host, thus providing a basis for the disease. On the other hand, human genomic and functional research revealed more loci that play an essential role in gut homeostasis regulation, immune response, and intestinal epithelial function. This review aims to organize and summarize currently available knowledge concerning the role and interaction of crucial factors associated with IBD pathogenesis, particularly host genetic composition, intestinal microbiota, and metabolome, with immune regulation.
... Small molecules are increasingly being associated with bacterial adhesion on epithelial cells (Ghorashi and Kohler, 2020;Lin et al., 2020). Modification via glycosylation of proteins, which also play a role in mediating of bacterial binding (Barboza et al., 2012;Arabyan et al., 2016) is also a route that likely leads to cross-talk. In complement to the gene expression profiles, small metabolites were measured from the same epithelial cell treatment used for gene expression. ...
... Colonic epithelial (Caco2) cells were obtained from ATCC (HTB-37, Manassas, VA) and cultured as per ATCC's protocols and previously described (He et al., 2013;Arabyan et al., 2016). All the cells used in the assay were between passage numbers 22-30. ...
Probiotic bacteria have been proposed as an alternative to antibiotics for the control of antimicrobial resistant enteric pathogens. The mechanistic details of this approach remain unclear, in part because pathogen reduction appears to be both strain and ecology dependent. Here we tested the ability of five probiotic strains, including some from common probiotic genera Lactobacillus and Bifidobacterium, to reduce binding of Salmonella enterica sv. Typhimurium to epithelial cells in vitro. Bifidobacterium longum subsp. infantis emerged as a promising strain; however, S. Typhimurium infection outcome in epithelial cells was dependent on inoculation order, with B. infantis unable to rescue host cells from preceding or concurrent infection. We further investigated the complex mechanisms underlying this interaction between B. infantis, S. Typhimurium, and epithelial cells using a multi-omics approach that included gene expression and altered metabolism via metabolomics. Incubation with B. infantis repressed apoptotic pathways and induced anti-inflammatory cascades in epithelial cells. In contrast, co-incubation with B. infantis increased in S. Typhimurium the expression of virulence factors, induced anaerobic metabolism, and repressed components of arginine metabolism as well as altering the metabolic profile. Concurrent application of the probiotic and pathogen notably generated metabolic profiles more similar to that of the probiotic alone than to the pathogen, indicating a central role for metabolism in modulating probiotic-pathogen-host interactions. Together these data imply crosstalk via small molecules between the epithelial cells, pathogen and probiotic that consistently demonstrated unique molecular mechanisms specific probiotic/pathogen the individual associations.
... Employing this strategy, the bacteria uncover novel adhesin binding sites and gain closer proximity to the cell membrane to infect the host. Notable examples include glycosyl-hydrolases NanA of Streptococcus pneumoniae, and NanH ( Figure 4) and ChiA of Salmonella typhimurium, which degrade terminal sialic acid residues (202)(203)(204). In the case of PMM2-CDG patients who present lower levels of sialylation, pathogenic bacteria may find the infection process easier because they do not need to use their neuraminidase to access internal glycan epitopes to initiate their adhesion process. ...
Glycosylation is a critical post-translational modification that plays a pivotal role in several biological processes, such as the immune response. Alterations in glycosylation can modulate the course of various pathologies, such as the case of congenital disorders of glycosylation (CDG), a group of more than 160 rare and complex genetic diseases. Although the link between glycosylation and immune dysfunction has already been recognized, the immune involvement in most CDG remains largely unexplored and poorly understood. In this study, we provide an update on the immune dysfunction and clinical manifestations of the 12 CDG with major immune involvement, organized into 6 categories of inborn errors of immunity according to the International Union of Immunological Societies (IUIS). The immune involvement in phosphomannomutase 2 (PMM2)-CDG - the most frequent CDG - was comprehensively reviewed, highlighting a higher prevalence of immune issues during infancy and childhood and in R141H-bearing genotypes. Finally, using PMM2-CDG as a model, we point to links between abnormal glycosylation patterns in host cells and possibly favored interactions with microorganisms that may explain the higher susceptibility to infection. Further characterizing immunopathology and unusual host-pathogen adhesion in CDG can not only improve immunological standards of care but also pave the way for innovative preventive measures and targeted glycan-based therapies that may improve quality of life for people living with CDG.
... Mammalian epithelial cells are densely coated with carbohydrate chains (glycans) (34)(35)(36) that are often the first point of contact for microbes at mucosal sites (37). The cellular glycan coat or glycocalyx can provide physical protection from pathogens (38,39), mediate host-microbe interactions (40), and regulate immunity (41)(42)(43)(44). Host glycans can be modified in many human diseases (45,46), including infectious diseases caused by viruses and bacteria (47). ...
Epithelial cells are covered in carbohydrates (glycans). This glycan coat or “glycocalyx” interfaces directly with microbes, providing a protective barrier against potential pathogens. Bacterial vaginosis (BV) is a condition associated with adverse health outcomes in which bacteria reside in direct proximity to the vaginal epithelium. Some of these bacteria, including Gardnerella , produce glycosyl hydrolase enzymes. However, glycans of the human vaginal epithelial surface have not been studied in detail. Here, we elucidate key characteristics of the “normal” vaginal epithelial glycan landscape and analyze the impact of resident microbes on the surface glycocalyx. In human BV, glycocalyx staining was visibly diminished in electron micrographs compared to controls. Biochemical and mass spectrometric analysis showed that, compared to normal vaginal epithelial cells, BV cells were depleted of sialylated N - and O -glycans, with underlying galactose residues exposed on the surface. Treatment of primary epithelial cells from BV-negative women with recombinant Gardnerella sialidases generated BV-like glycan phenotypes. Exposure of cultured VK2 vaginal epithelial cells to recombinant Gardnerella sialidase led to desialylation of glycans and induction of pathways regulating cell death, differentiation, and inflammatory responses. These data provide evidence that vaginal epithelial cells exhibit an altered glycan landscape in BV and suggest that BV-associated glycosidic enzymes may lead to changes in epithelial gene transcription that promote cell turnover and regulate responses toward the resident microbiome.
... respectively) were obtained from the American Type Culture Collection (Manassas, VA, USA) and grown as per the manufacturer's instructions in T-75 or T-125 flasks. For phagocytosis assays, cells were seeded to a density of 10 5 cells/cm 2 in 48-well plates [34,35]. ...
... After incubation, each treatment was aspirated and the Caco2 monolayer washed three times with 200 µL of Tyrodes buffer (pH 7.2) [36,37] to remove non-adhered bacterial cells. Adhered bacterial concentration was determined as described by Elsinghorst et al. [38] and others [34,35], except qPCR was used to determine the bacterial count using 50 µL of a commercial lysis buffer (AES CHEMUNEX, Inc., Cranbury, NJ, USA) that lyses mammalian and bacterial cells prior to qPCR. The amplification parameters for mammalian GAPDH primers (forward: ACCACAGTCCATGCCATCAC; reverse: TCCACCACCCTGTTGCT-GTA) was 95 • C for 5 min, followed by 40 cycles at 95 • C for 15 s, 56 • C for 30 s, and 72 • C for 30 s, then a final extension at 72 • C for 1 min. ...
Methicillin-resistant Staphylococcus aureus (MRSA) is a pervasive and persistent threat that requires the development of novel therapies or adjuvants for existing ones. Aptamers, small single-stranded oligonucleotides that form 3D structures and can bind to target molecules, provide one possible therapeutic route, especially when presented in combination with current antibiotic applications. BALB/c α-1, 3-galactosyltransferase (−/−) knockout (GTKO) mice were infected with MRSA via tail vein IV and subsequently treated with the αSA31 aptamer (n = 4), vancomycin (n = 12), or αSA31 plus vancomycin (n = 12), with split doses in the morning and evening. The heart, lungs, liver, spleen, and kidneys were harvested upon necropsy for histological and qPCR analysis. All mice treated with αSA31 alone died, whereas 5/12 mice treated with vancomycin alone and 7/12 mice treated with vancomycin plus αSA31 survived the course of the experiment. The treatment of MRSA-infected mice with Vancomycin and an adjuvant aptamer αSA31 reduced disease persistence and dispersion as compared to treatment with either vancomycin SA31 alone, indicating the combination of antibiotic and specifically targeted αSA31 aptamer could be a novel way to control MRSA infection. The data further indicate that aptamers may serve as a potential therapeutic option for other emerging antibiotic resistant pathogens.
... It was reported that www.nature.com/scientificreports/ damages in the glycocalyx integrity disrupt normal cellular functions, leading to organ/tissue dysfunction and severe diseases 65,66 . ...
This study presents “mouse tissue glycome atlas” representing the profiles of major N -glycans of mouse glycoproteins that may define their essential functions in the surface glycocalyx of mouse organs/tissues and serum-derived extracellular vesicles (exosomes). Cell surface glycocalyx composed of a variety of N -glycans attached covalently to the membrane proteins, notably characteristic “ N -glycosylation patterns” of the glycocalyx, plays a critical role for the regulation of cell differentiation, cell adhesion, homeostatic immune response, and biodistribution of secreted exosomes. Given that the integrity of cell surface glycocalyx correlates significantly with maintenance of the cellular morphology and homeostatic immune functions, dynamic alterations of N -glycosylation patterns in the normal glycocalyx caused by cellular abnormalities may serve as highly sensitive and promising biomarkers. Although it is believed that inter-organs variations in N -glycosylation patterns exist, information of the glycan diversity in mouse organs/tissues remains to be elusive. Here we communicate for the first-time N -glycosylation patterns of 16 mouse organs/tissues, serum, and serum-derived exosomes of Slc:ddY mice using an established solid-phase glycoblotting platform for the rapid, easy, and high throughput MALDI-TOFMS-based quantitative glycomics. The present results elicited occurrence of the organ/tissue-characteristic N -glycosylation patterns that can be discriminated to each other. Basic machine learning analysis using this N -glycome dataset enabled classification between 16 mouse organs/tissues with the highest F1 score (69.7–100%) when neural network algorithm was used. A preliminary examination demonstrated that machine learning analysis of mouse lung N -glycome dataset by random forest algorithm allows for the discrimination of lungs among the different mouse strains such as the outbred mouse Slc:ddY, inbred mouse DBA/2Crslc, and systemic lupus erythematosus model mouse MRL- lpr / lpr with the highest F1 score (74.5–83.8%). Our results strongly implicate importance of “human organ/tissue glycome atlas” for understanding the crucial and diversified roles of glycocalyx determined by the organ/tissue-characteristic N -glycosylation patterns and the discovery research for N -glycome-based disease-specific biomarkers and therapeutic targets.
... Glycans are the first point of contact for microbes, and they must penetrate O-linked mucins in mucous and the glycocalyx oligosaccharides to allow successful pathogen binding and cell entry. For instance, S. Typhimurium secretes chitinases and sialidases that target N-linked GlcNAc-containing glycans and sialic acid, respectively [60][61][62][63]. Gut microbes frequently target O-glycans such as mucin to disrupt mucous viscosity or to use as an energy source [64]. ...
Legionella pneumophila is an accidental pathogen that replicates intracellularly within the Legionella-containing vacuole (LCV) in macrophages. Within an hour of infection, L. pneumophila secretes effectors to manipulate Rab1 and intercept ER-derived vesicles to the LCV. The downstream consequences of interrupted ER trafficking on the Golgi of macrophages are not clear. We examined the Golgi structure and function in L. pneumophila-infected human U937 macrophages. Intriguingly, the size of the Golgi in infected macrophages remained similar to uninfected macrophages. Furthermore, TEM analysis also did not reveal any significant changes in the ultrastructure of the Golgi in L. pneumophila-infected cells. Drug-induced Golgi disruption impacted bacterial replication in human macrophages, suggesting that an intact organelle is important for bacteria growth. To probe for Golgi functionality after L. pneumophila infection, we assayed glycosylation levels using fluorescent lectins. Golgi O-glycosylation levels, visualized by the fluorescent cis-Golgi lectin, Helix pomatia agglutinin (HPA), significantly decreased over time as infection progressed, compared to control cells. N-glycosylation levels in the Golgi, as measured by L-PHA lectin staining, were not impacted by L. pneumophila infection. To understand the mechanism of reduced O-glycans in the Golgi we monitored UDP-GalNAc transporter levels in infected macrophages. The solute carrier family 35 membrane A2 (SLC35A2) protein levels were significantly reduced in L. pneumophila-infected U937 and HeLa cells and L. pneumophila growth in human macrophages benefitted from GalNAc supplementation. The pronounced reduction in Golgi HPA levels was dependent on the translocation apparatus DotA expression in bacteria and occurred in a ubiquitin-independent manner. Thus, L. pneumophila infection of human macrophages maintains and requires an intact host Golgi ultrastructure despite known interference of ER–Golgi trafficking. Finally, L. pneumophila infection blocks the formation of O-linked glycans and reduces SLC35A2 protein levels in infected human macrophages.
... For example, once in circulation, Dengue virus infects target cells such as monocytes/macrophages and triggers the secretion of a protein that activates endothelial sialidases, cathepsin L, and heparinase, which subsequently degrade the endothelial glycocalyx (20,235). Analogous mechanism(s) involving endothelial glycocalyx disruption have been adopted by other agents, including foodborne pathogens such as Salmonella (8) and Listeria (245), airborne pathogens such as betacoronavirus SARS-CoV-2, the virus that causes COVID-19 (277), as well as bloodborne pathogens like the malarial parasite Plasmodium falciparum (111). ...
The glycocalyx is a polysaccharide structure that protrudes from the body of a cell. It is primarily conformed of glycoproteins and proteoglycans, which provide communication, electrostatic charge, ionic buffering, permeability, and mechanosensation-mechanotransduction capabilities to cells. In blood vessels, the endothelial glycocalyx that projects into the vascular lumen separates the vascular wall from the circulating blood. Such a physical location allows a number of its components, including sialic acid, glypican-1, heparan sulfate, and hyaluronan, to participate in the mechanosensation-mechanotransduction of blood flow-dependent shear stress, which results in the synthesis of nitric oxide and flow-mediated vasodilation. The endothelial glycocalyx also participates in the regulation of vascular permeability and the modulation of inflammatory responses, including the processes of leukocyte rolling and extravasation. Its structural architecture and negative charge work to prevent macromolecules greater than approximately 70 kDa and cationic molecules from binding and flowing out of the vasculature. This also prevents the extravasation of pathogens such as bacteria and virus, as well as that of tumor cells. Due to its constant exposure to shear and circulating enzymes such as neuraminidase, heparanase, hyaluronidase, and matrix metalloproteinases, the endothelial glycocalyx is in a continuous process of degradation and renovation. A balance favoring degradation is associated with a variety of pathologies including atherosclerosis, hypertension, vascular aging, metastatic cancer, and diabetic vasculopathies. Consequently, ongoing research efforts are focused on deciphering the mechanisms that promote glycocalyx degradation or limit its syntheses, as well as on therapeutic approaches to improve glycocalyx integrity with the goal of reducing vascular disease. © 2022 American Physiological Society. Compr Physiol 12: 1-31, 2022.
