Show the inhibition zone around the extract that affected against bacterial species on Muller Hinton agar 4. Discussion Earlier study found that the Escherichia coli utilize different kinds of amino acids in different percentages such as phenylalanine (Liu et al., 2018), serine (Zhang et al., 2019), alanine (Xu et al., 2021) and phenylalanine (Satoh et al., 2023). Our observations differ from findings reported by Baral and Vaidya in 2011, who found that the aqueous extract exhibited weak antibacterial activity, compared to other extracts, but demonstrated better efficacy as an antifungal agent. This phenomenon can be attributed to the bacteria's lack of prior exposure to these extracts, resulting in their absence of resistance. The findings of this study match with a previous study conducted by Sanaa M. et al. in 2010, as well as with the results reported by Hiba H. Hamid et al. in 2013 in Iraq. Bacterial cells and appropriate vectors are employed to introduce chemicals into the cell, with the aim of inhibiting the activity of

Show the inhibition zone around the extract that affected against bacterial species on Muller Hinton agar 4. Discussion Earlier study found that the Escherichia coli utilize different kinds of amino acids in different percentages such as phenylalanine (Liu et al., 2018), serine (Zhang et al., 2019), alanine (Xu et al., 2021) and phenylalanine (Satoh et al., 2023). Our observations differ from findings reported by Baral and Vaidya in 2011, who found that the aqueous extract exhibited weak antibacterial activity, compared to other extracts, but demonstrated better efficacy as an antifungal agent. This phenomenon can be attributed to the bacteria's lack of prior exposure to these extracts, resulting in their absence of resistance. The findings of this study match with a previous study conducted by Sanaa M. et al. in 2010, as well as with the results reported by Hiba H. Hamid et al. in 2013 in Iraq. Bacterial cells and appropriate vectors are employed to introduce chemicals into the cell, with the aim of inhibiting the activity of

Source publication
Article
Full-text available
It has been observed that the leaves of Eichhornia crassipes have a significant capacity to absorb water from rivers, leading to water loss and potentially blocking the flow of rivers. However, previous studies provided that the Eichhornia crassipes has biological important in the environment. The objective of this study is to isolate and identify...

Contexts in source publication

Context 1
... mixtures have been employed by many researchers for the treatment of Pseudomonas aeruginosa infections; nonetheless, it is important to conduct clinical tests in order to assess their effectiveness and safety (Kutateladze and Adamia 2008). Several antibiotics have restricted penetration into biofilms (Hoiby et al., 2010). Hence, it has been observed that bacteria surviving in biofilms exhibit a remarkable ability to withstand antibiotic doses that are several orders higher greater than those tolerated by planktonic bacteria (Ciofu et al., 2002). ...
Context 2
... or GAS, is a type of Gram-positive cocci that commonly inhabits humans as its specific host. Streptococcus is a bacterial pathogen that causes a wide range of infections in humans, varying from mild conditions like sore throat and impetigo to more severe illnesses such as necrotizing fasciitis, glomerulonephritis, acute rheumatic fever, and streptococcal toxic shock syndrome (Luca- Harari et al., 2009) and (Carapetis et al., 2005). Escherichia coli, a member of the Enterobacteriaceae family, is a highly diverse and widespread group. ...
Context 3
... change in color from red to pink was perceived as a favorable indication of mannitol action by other Staphylococcus sp. (Santos et al., 2015; Saab et al., 2018). ...
Context 4
... using specific extraction and purification kits (QIAamp DNA and QIAquick PCR Kits, respectively (Qiagen, Germany)), chromosomal DNA isolated and purified depending on instructions, then DNA amplified by using PCR technique and specific forward and reverse primers for Staphylococcus aureus, [F-(GTAGGTGGCAAGCGTTACC) R-(CGCACATCA GCGTCAG) (Almusawi et al., 2014)], for streptococcus pyogenes [F-(AAGAGAGACTAACGCATG TTAGTAAT) and R-(ATTTTCCACTCCCACCATCA) (Kulkarni et al., 2016)], for Pseudomonas aeroginosa [F-(GGGGGATCTTCGGACCTCA) and R-(TCCTTAGAGTGCC CACCCG) (Spilker et al., 2004)], and for Escherichia coli [F-(GACCTCGGTTTAGTTCACAGA) and R-(CACACGCTGACGCTGA CCA) (Mamun et al., 2016)]. ...
Context 5
... using specific extraction and purification kits (QIAamp DNA and QIAquick PCR Kits, respectively (Qiagen, Germany)), chromosomal DNA isolated and purified depending on instructions, then DNA amplified by using PCR technique and specific forward and reverse primers for Staphylococcus aureus, [F-(GTAGGTGGCAAGCGTTACC) R-(CGCACATCA GCGTCAG) (Almusawi et al., 2014)], for streptococcus pyogenes [F-(AAGAGAGACTAACGCATG TTAGTAAT) and R-(ATTTTCCACTCCCACCATCA) (Kulkarni et al., 2016)], for Pseudomonas aeroginosa [F-(GGGGGATCTTCGGACCTCA) and R-(TCCTTAGAGTGCC CACCCG) (Spilker et al., 2004)], and for Escherichia coli [F-(GACCTCGGTTTAGTTCACAGA) and R-(CACACGCTGACGCTGA CCA) (Mamun et al., 2016)]. ...
Context 6
... using specific extraction and purification kits (QIAamp DNA and QIAquick PCR Kits, respectively (Qiagen, Germany)), chromosomal DNA isolated and purified depending on instructions, then DNA amplified by using PCR technique and specific forward and reverse primers for Staphylococcus aureus, [F-(GTAGGTGGCAAGCGTTACC) R-(CGCACATCA GCGTCAG) (Almusawi et al., 2014)], for streptococcus pyogenes [F-(AAGAGAGACTAACGCATG TTAGTAAT) and R-(ATTTTCCACTCCCACCATCA) (Kulkarni et al., 2016)], for Pseudomonas aeroginosa [F-(GGGGGATCTTCGGACCTCA) and R-(TCCTTAGAGTGCC CACCCG) (Spilker et al., 2004)], and for Escherichia coli [F-(GACCTCGGTTTAGTTCACAGA) and R-(CACACGCTGACGCTGA CCA) (Mamun et al., 2016)]. ...
Context 7
... findings of this study indicate that a significant impact of ethanol extracts on the tested bacteria (Table 5; Figure 2). Table 4 Phytochemical screening, chemical structure, chemical test, test result of Thyme Leaves and chemical notes These findings elucidate the mechanism underlying the capacity of multidrug-resistant (MDR) microorganisms to withstand the effects of antibiotics. ...