Figure 4 - available via license: Creative Commons Attribution 4.0 International
Content may be subject to copyright.
Phylogram of relationships of Laubuka tenella and similar taxa, based on a Bayesian analysis of the mitochondrial COI gene. Branch lengths are proportional to expected changes per site, visualizing estimated genetic distance. The scale bar represents number of expected substitutions per nucleotide site. Node labels show the Bayesian posterior probability of the clade. Terminal labels start with GenBank accession number and end with a locality indication when known. Devario xyrops and Malayochela maassi are outgroup taxa. HM224171, identified as Laubuka fasciata in GenBank, is apparently a misidentified L. laubuca. JN815300 and JN815301 with locality in the Bay of Bengal off Bangladesh and India, obviously in error. CTOL samples lack locality information.
Source publication
Laubuka tenella is a new species characterized by the colour pattern, consisting of short dark vertical bars anteriorly on the side, and a dark lateral band posteriorly on the side, combined with a relatively short pelvic fin and 29–30 lateral-line scales. It is separated from other Laubuka analysed by minimum 9 % uncorrected p -distance in the mit...
Contexts in source publication
Context 1
... characterization and relationships. The Bayesian phylogenetic analysis recovered Laubuka tenella as the sister species of L. laubuca (Fig. 4). COI sequences of L. tenella differed from the most similar sequences, in L. laubuca, by 9 % uncorrected p-distance. The within-species variation in L. tenella amounted to 0.9 %, between the Majerchora and Domdomia samples. Maximum pairwise p-dis- tance in L. laubuca was 2.5% when the sequence KT353103 was included, and 0.9 % when excluded. Species delimitation methods confirmed reciprocal distinctness of L. laubuca and L. tenella: P ID(Liberal), the mean probability of making a correct identi- fication of an unknown specimen of the focal species was reciprocally 0.97. At 6*10 -4 , Rosenberg's P(AB) failed the null hypothesis that the combined clade (L. laubuca+L. tenella) represents a single ...
Context 2
... the phylogenetic analysis, Laubuka tenella came out as sister group to L. laubu- ca, which has a complementary geographical distribution west of L. tenella. Only few sequences of Laubuka were available from GenBank to supplement our material from India and Bangladesh, and among them several lacked locality information (Fig. 4). In- corporation of additional taxa, e.g., from Sri Lanka, Myanmar and Indochina may al- ter significantly the pattern shown in Fig. 4. Nevertheless, the position in the tree (Fig. 4) and the 9 % p-distance difference from the most similar species, are strong indica- tors of species distinctness of L. tenella. One of the downloaded GenBank sequences, KT353103, from northern Bangladesh, and identified as L. laubuca in GenBank, is resolved in the L. laubuca clade (Fig. 4), but as sister to the remaining specimens. A possible explanation is that it represents one more species of Laubuka in the region, but could also reflect wide genetic variation in L. ...
Context 3
... the phylogenetic analysis, Laubuka tenella came out as sister group to L. laubu- ca, which has a complementary geographical distribution west of L. tenella. Only few sequences of Laubuka were available from GenBank to supplement our material from India and Bangladesh, and among them several lacked locality information (Fig. 4). In- corporation of additional taxa, e.g., from Sri Lanka, Myanmar and Indochina may al- ter significantly the pattern shown in Fig. 4. Nevertheless, the position in the tree (Fig. 4) and the 9 % p-distance difference from the most similar species, are strong indica- tors of species distinctness of L. tenella. One of the downloaded GenBank sequences, KT353103, from northern Bangladesh, and identified as L. laubuca in GenBank, is resolved in the L. laubuca clade (Fig. 4), but as sister to the remaining specimens. A possible explanation is that it represents one more species of Laubuka in the region, but could also reflect wide genetic variation in L. ...
Context 4
... the phylogenetic analysis, Laubuka tenella came out as sister group to L. laubu- ca, which has a complementary geographical distribution west of L. tenella. Only few sequences of Laubuka were available from GenBank to supplement our material from India and Bangladesh, and among them several lacked locality information (Fig. 4). In- corporation of additional taxa, e.g., from Sri Lanka, Myanmar and Indochina may al- ter significantly the pattern shown in Fig. 4. Nevertheless, the position in the tree (Fig. 4) and the 9 % p-distance difference from the most similar species, are strong indica- tors of species distinctness of L. tenella. One of the downloaded GenBank sequences, KT353103, from northern Bangladesh, and identified as L. laubuca in GenBank, is resolved in the L. laubuca clade (Fig. 4), but as sister to the remaining specimens. A possible explanation is that it represents one more species of Laubuka in the region, but could also reflect wide genetic variation in L. ...
Context 5
... the phylogenetic analysis, Laubuka tenella came out as sister group to L. laubu- ca, which has a complementary geographical distribution west of L. tenella. Only few sequences of Laubuka were available from GenBank to supplement our material from India and Bangladesh, and among them several lacked locality information (Fig. 4). In- corporation of additional taxa, e.g., from Sri Lanka, Myanmar and Indochina may al- ter significantly the pattern shown in Fig. 4. Nevertheless, the position in the tree (Fig. 4) and the 9 % p-distance difference from the most similar species, are strong indica- tors of species distinctness of L. tenella. One of the downloaded GenBank sequences, KT353103, from northern Bangladesh, and identified as L. laubuca in GenBank, is resolved in the L. laubuca clade (Fig. 4), but as sister to the remaining specimens. A possible explanation is that it represents one more species of Laubuka in the region, but could also reflect wide genetic variation in L. ...
Similar publications
DNA barcoding mosquitoes: advice for potential prospectors – CORRIGENDUM - Nigel W. Beebe
Citations
... Vertebrae were counted on X-radiographs and reported as precaudal+caudal; the first caudal vertebra is that with the haemal spine inserted behind the anteriormost anal-fin pterygiophores [56,57]. This convention, used by Ř íčan et al. [13] and Ř íčan and Kullander [4] typically gave 13 precaudal vertebrae in Australoheros. ...
Morphological and genetic analyses of species of Australoheros focusing on those distributed in coastal rivers from the Rio de La Plata north to the Rio Buranhém, support recognition of 17 valid species in the genus. Eight species are represented in coastal rivers: A acaroides , A . facetus , A . ipatinguensis , A . oblongus , A . ribeirae , and A . sanguineus are validated from earlier descriptions. Australoheros mboapari is a new species from the Rio Taquari in the Rio Jacuí drainage. Australoheros ricani is a new species from the upper Rio Jacuí. Specimens from the Rio Yaguarón and Rio Tacuary, affluents of Laguna Merín, and tributaries of the Rio Negro, tributary of the Rio Uruguay are assigned to A . minuano pending critical data on specimens from the type locality of A . minuano . Australoheros taura is a junior synonym of A . acaroides . Australoheros autrani , A . saquarema , A . capixaba , A . macaensis , A . perdi , and A . muriae are junior synonyms of A . ipatinguensis . Heros autochthon , A . mattosi , A . macacuensis , A . montanus , A . tavaresi , A . paraibae , and A . barbosae , are junior synonyms of A . oblongus . Heros jenynsii is a junior synonym of A . facetus .
... In Malaysia, there are a lot of studies on fishes that implement DNA barcoding. Since the COI gene is a conserved gene throughout many species, it therefore has a considerable of impact to DNA barcoding since it serves as an identification tags for the discovery of closely related species for example in parasite [4], and discovery of new species on Danio htamanthinus [5]. The DNA barcoding analysis COI gene amplification helps us to identify a lot of new species. ...
Rasbora sumatrana or locally known as “seluang” in Malaysia is a pelagic fish. Unlike its other congeneric species is not categorized as an ornamental fish. Samples of the presumed R. sumatrana was obtained from an abandoned swamp in Hulu Langat, Selangor. Initial identification of the samples was conducted based on meristic and morphometric analyses, which showed congruence with R. sumatrana when referenced to FishBase. To complement the analysis, a molecular study was conducted based on the cytochrome oxidase subunit I (COI) DNA barcoding marker. Confirmation of the species identity was done by BLAST results with six voucher sequences of R. sumatrana and other Rasbora species from GenBank. The relationship of Rasbora spp. was analysed by phylogenetic and Automatic Barcode Gap Discovery (ABGD) analysis. Contradicting with morphological and meristic data analysis, both Maximum-Likelihood and Maximum Parsimony phylogenetic tree showed that the currently studied samples did not cluster with R. sumatrana . We believe that they may represent cryptic diversity and are tentatively classified as Rasbora spp.
... The standard barcoding region of the mitochondrial cytochrome c oxidase subunit 1 gene (MT-COX1, also known as COI) was extracted, amplified, and sequenced as detailed in Kullander et al. (2018), with the modification that we used the primers COI_Rep_F5 (AACCACAAAGAYATYGGAACCC) and COI_Rep_5R (GGTGGC-CRAARAATCAGAACAG). Total length, snout-vent length and tail length were measured by marking a piece of string, and rounded to the nearest five millimeters (mm). Snout-vent length was measured to the posterior margin of the anal plate. ...
As part of an investigation into the status of the near threatened Gotland grass snake, Natrix natrix gotlandica Nilson & Andrén, 1981, endemic to the island of Gotland, we discovered that Linnaeus’ type series of the common grass snake, Natrix natrix (Linnaeus, 1758), is comprised of specimens from three different currently recognized species. To stabilize the usage of the name Coluber natrix, we investigate Linnaeus’ type series, and a specimen which Linnaeus in 1741 examined west of the Swedish city of Nyköping is designated lectotype. The lectotype has since been lost, and a newly collected specimen from the same locality is designated neotype for Coluber natrix. The neotype is deposited in the herpetology collection of the Swedish Museum of Natural History in Stockholm, Sweden, catalog number NRM 8260.
... The freshwater-fish genus Laubuka Bleeker, 1859 includes some 13 species distributed through the lowlands of tropical South and South-east Asia (Kottelat, 2013;Kullander et al., 2018). While five species occur between the Ganges basin of India and Thailand, four have been reported from the peninsula of India: L. fasciata (Silas, 1958), L. latens Knight, 2015, L. laubuca (Hamilton, 1822), and L. trevori Knight, 2015. ...
... Head length and body measurements are provided as ratios of standard length; and subunits of the head as ratios of head length. Comparative data for Laubuka caeruleostigmata (Smith, 1931), L. khujairokensis (Arunkumar, 2000), L. latens, L. trevori, L. parafasciata (Lalramliana et al., 2017), L. siamensis (Fowler, 1939), and L. tenella (Kullander et al., 2018) were taken from their original descriptions and from Kottelat (2001) as relevant. Material examined is listed in Appendix S3. ...
... The structures identified as lower-jaw tubercles by Pethiyagoda et al. (2008) in L. lankensis and L. insularis were described as neuromast fields by Kullander et al. (2018). We have examined a total of 123 and 152 specimens of L. varuna and L. lankensis, respectively, collected during different times of the year and found the presence/absence of these lower jaw neuromast fields to be of diagnostic value between these two species (Table S5). ...
The freshwater-fish genus Laubuka contains ∼13 species distributed through the lowlands of tropical South and South-east Asia. Four of these species (Laubuka lankensis, L. varuna, L. ruhuna, and L. insularis) are reported as endemic to Sri Lanka, a remarkable datum given the island’s small size. We sampled populations of Laubuka at 56 locations in 14 of the island’s principal river basins and analysed their morphological, meristic, phylogenetic, and phylogeographic relationships using the mitochondrial genes cytochrome b and cytochrome c oxidase subunit 1 and the nuclear recombination activating protein 1. We investigated the geographic structure, and delineated species using molecular species delimitation methods and morphological analysis within the general lineage concept of species. Molecular and morphological analyses failed to identify L. ruhuna and L. insularis as distinct species; we show them to be synonyms of L. varuna and L. lankensis, respectively. Taxonomic inflation in previous literature is attributed as a result of limited sampling and negligence of size allometry. Additionally, a third, cryptic species discovered in this study is described as L. hema sp. nov. which is evidently confined to the headwaters of the Gal basin in eastern Sri Lanka. Phylogenetic and haplotype network analyses suggest phylogeographic structure within both the southwest-endemic L. varuna and the dry-zone endemic L. lankensis, but the former shows strong phylogeographic structure between adjacent basins. The Sri Lankan species of Laubuka do not form a monophyletic group: they stem from two dispersal or vicariance events, one involving the lineage that led to L. varuna in south-western Sri Lanka, and the other, of [L. lankensis + L. hema] in the dry zone.
http://zoobank.org/urn:lsid:zoobank.org:pub:D2A29329-E0E7-447E-B316-81049212CCCB
http://zoobank.org/urn:lsid:zoobank.org:act:920E5DC0-CEDC-4243-98C7-12CCF829CBCD
... There was no indication of contamination. Five species descriptions were already published based on the present material [16][17][18][19][20] . ...
... Expectations of additional taxa from that area, are low, however. The coverage of the Chittagong Division, including Karnafuli and Sangu Rivers and the Cox's Bazar region provides for considerable new ocurrences and new species 16,[18][19][20] , but also strong affinity to the adjacent western Rakhine in Myanmar, e.g., in the shared distribution of Laubuka tenella 19 . Most of the samples, from the Meghna, Jamuna and Padma tributaries, reflect a common fish fauna with adjacent India, the samples from the Pyain River, draining the Garo Hills, provide a distinct representation belonging to the Eastern Himalaya Region 28 . ...
... Expectations of additional taxa from that area, are low, however. The coverage of the Chittagong Division, including Karnafuli and Sangu Rivers and the Cox's Bazar region provides for considerable new ocurrences and new species 16,[18][19][20] , but also strong affinity to the adjacent western Rakhine in Myanmar, e.g., in the shared distribution of Laubuka tenella 19 . Most of the samples, from the Meghna, Jamuna and Padma tributaries, reflect a common fish fauna with adjacent India, the samples from the Pyain River, draining the Garo Hills, provide a distinct representation belonging to the Eastern Himalaya Region 28 . ...
We sequenced the standard DNA barcode gene fragment in 694 newly collected specimens, representing 243 species level Operational Barcode Units (OBUs) of freshwater fishes from Bangladesh. We produced coi sequences for 149 out of the 237 species already recorded from Bangladesh. Another 83 species sequenced were not previously recorded for the country, and include about 30 undescribed or potentially undescribed species. Several of the taxa that we could not sample represent erroneous records for the country, or sporadic occurrences. Species identifications were classified at confidence levels 1(best) to 3 (worst). We propose the new term Operational Barcode Unit (OBU) to simplify references to would-be DNA barcode sequences and sequence clusters. We found one case where there were two mitochondrial lineages present in the same species, several cases of cryptic species, one case of introgression, one species yielding a pseudogene to standard barcoding primers, and several cases of taxonomic uncertainty and need for taxonomic revision. Large scale national level DNA barcode prospecting in high diversity regions may suffer from lack of taxonomic expertise that cripples the result. Consequently, DNA barcoding should be performed in the context of taxonomic revision, and have a defined, competent end-user.
... Vertebral counts, obtained from X-radiographs, were recorded as abdominal+caudal, where the first vertebra posterior to the first interhaemal anal-fin pterygiophore was recorded as the first caudal vertebra (Roberts 1989;Kullander et al. 2018). X-radiographs were made with a Kevex 130kVp microfocus X-ray source and a Samsung/ Rayence 17×17 inch DR panel. ...
... For the genetic analysis, a 654 basepair (bp) fragment of the 5′ end of the mitochondrial cytochrome c oxidase subunit I gene (coi, also known as mt-cox1) and the complete or nearly complete mitochondrial cytochrome b gene (cytb, also known as mt-cyb) was sequenced from morphologically identified specimens of the Badidae. DNA was extracted, and coi sequences obtained as described by Kullander et al. (2018). cytb was amplified using the primers CYTB_GlufishF (AACCACCGTTGTTATTCAACTACAA) and CYTB_TrucCytb (CCGACTTCCGGATTACAAGACCG), with the PCR cycling: 94°C 4 min; 40 * (94°C 30s; 52°C 30s; 72°C 60s); 72°C 8 min. ...
... cytb was amplified using the primers CYTB_GlufishF (AACCACCGTTGTTATTCAACTACAA) and CYTB_TrucCytb (CCGACTTCCGGATTACAAGACCG), with the PCR cycling: 94°C 4 min; 40 * (94°C 30s; 52°C 30s; 72°C 60s); 72°C 8 min. The PCR products were processed as described by Kullander et al. (2018). The 58 obtained coi sequences were combined with all 600 bp or longer corresponding sequences of Badidae available from GenBank on 21 June 2018, for a total of 126 sequences representing 21 putative species of Badidae. ...
Five species of Badidae are reported from Bangladesh, with morphological diagnoses and mitochondrial DNA sequences (cytochrome b, cytb; and cytochrome c oxidase subunit I, coi). Dario kajal is recorded from Bangladesh for the first time with a precise locality. Badis badis is reported from several localities in central Bangladesh. Badis chittagongis is redescribed on the basis of samples from the region of Cox′s Bazar, including Maheskhali Island. Badis pallidus, new species, is described from the Sangu and Karnafuli River drainages in Bangladesh. It is most similar to B. chittagongis, but differs slightly in colouration and meristics, and is separated by 3.8% uncorrected p-distance in coi from B. chittagongis. Badis chittagongis and B. pallidus are almost identical in morphology, colour pattern and meristics, but occupy different habitats and are reciprocally allopatric. Pronounced genetic difference but similar morphology in these two species may be due to strong stabilizing selection for cryptic colouration in Badis. Badis rhabdotus is a new species from northeastern Bangladesh and adjacent Meghalaya in India. It is distinguished from congeneric species by the colour pattern, including well-defined narrow vertical bars; posterior bars curved; and meristics. Species delimitation analysis of an alignment comprising all coi sequences available from GenBank longer than 600 bp and attributed to species of Badidae (21 June 2018) plus our coi sequences and outgroup sequences of Nandus nandus, using pairwise p-distance and the computer software GMYC, ABGD, and bPTP, produced similar results. Among 103 coi sequences of Badidae, unidentified or tagged with one of 18 valid species names, uncorrected p-distance suggests 27 OTUs at 2% difference threshold; ABGD found between 15 and 55 OTUs; GMYC with single evolutionary rate 33 OTUs, with multiple evolutionary rates 32 OTUs; PTP, mPTP and bPTP 27–28 OTUs. Phylogenetic analysis based on coi and cytb sequences support previous analyses and previously proposed species groups. Inadequate recent species descriptions and many misidentifications or provisional identifications of published DNA sequences hamper progress in species-level systematics in Badis. Based on published morphological data, Badis triocellus cannot be distinguished from B. singenensis; Badis dibruensis and B. pancharatnaensis cannot be distinguished from B. badis; Badis andrewraoi, B. autumnum, B. kyanos, and B. soraya are insufficiently well distinguished from each other.
... Measurements and counts were taken as described by Fang (1997). Vertebral counts are given as precaudal+caudal, where the first vertebra bearing a long haemal spine articulating with anal-fin pterygiophores was recorded as the first caudal vertebra (Kullander et al. 2018). X-radiographs were made with a Kevex 130kVP microfocus X-ray source and a Samsung/Rayence 17x17 inch DR panel. ...
... Additional sequences of Osteobrama were downloaded from GenBank. DNA was extracted, and COI sequences obtained as as described by Kullander et al. (2018) 16S rRNA was amplified using the primers 16S_arLm2 (CCTCGCCTGTTTACCAAAAACA) and 16S_brHm (CTCCGGTCTGAACTCAGATCACGT), with a PCR cycle of 94°C 4 min; 35 * (94°C 30s; 55°C 30s; 72°C 30s); 72°C 8 min). The PCR products were processed as described by Kullander et al. (2018). ...
... DNA was extracted, and COI sequences obtained as as described by Kullander et al. (2018) 16S rRNA was amplified using the primers 16S_arLm2 (CCTCGCCTGTTTACCAAAAACA) and 16S_brHm (CTCCGGTCTGAACTCAGATCACGT), with a PCR cycle of 94°C 4 min; 35 * (94°C 30s; 55°C 30s; 72°C 30s); 72°C 8 min). The PCR products were processed as described by Kullander et al. (2018). Geneious (Kearse et al. 2008) was used to calculate genetic distances (uncorrected pairwise p-distance, as recommended by Srivatsan & Meier (2012), and the Geneious plugin Species Delimitation (Masters et al. 2011) was used to calculate the probability of reciprocal monophyly under a model of random coalescence. ...
Osteobrama cotio is considered to be a widespread species in India and Bangladesh. Mitochondrial DNA (COI, 16S rRNA) shows that populations from the Meghna River, Karnafuli and Sangu Rivers, Narmada River, and Godavari River are genetically distinct from each other. No morphological differences were found to separate Meghna and Karnafuli+Sangu populations, however. A putative new species, “Osteobrama serrata” has been described from the Barak River basin, stated to be distinguished from O. cotio by the presence of a serrated third dorsal-fin ray. The description of “O. serrata” does not fulfil requirements of the International Code of Zoological Nomenclature, (International Commission on Zoological Nomenclature 1999) and the name is thus unavailable. Published DNA sequences of “Osteobrama serrata” are identical to sequences of O. cotio from Bangladesh. As mentioned already in the original description, O. cotio has a serrated third dorsal-fin ray.
