FIG 3 - uploaded by Douglas E Soltis
Content may be subject to copyright.
One of six equally most parsimonious trees derived from rb s. str. Numbers above each branch indicate the number of base substitu below each branch represent the percentage of occurrence of each mo bootstrap replicates. Well-supported groups of genera are bracketed, w which do not form a monophyletic group in this analysis, are indi Soltis et al. 1993, with Chrysosplenium iowense added).
Source publication
Comparative DNA sequencing of matK, a maturase coding gene located within the intron of the chloroplast gene trnK, was evaluated for phylogenetic utility using genera of Saxifragaceae s. str. The entire matK gene was sequenced for two members of the family, Sullivantia sullivantii and Saxifraga integrifolia. Comparison of base substitution rates be...
Context in source publication
Context 1
... evaluate the non-random structure and robustness of the matK data set, the skewness test of Hillis (1991;see also Hillis and Huelsenbeck 1992;Huelsenbeck 1991) ( Fig. 2) (Fig. 3), a result that probably reflects the lower limits of resolution of rbcL sequence data, rather than a major discrepancy among the three cpDNA-based phylogenies (see ). It is readily apparent, for ex- ample, that very few base differences support the monophyly of members of the Darmera group in our matK analysis (Fig. ...
Similar publications
Comparative sequencing of the maturase-encoding chloroplast gene matK has great potential for reconstructing phylogenetic relationships not only within families, but also within genera of land plants. This gene of 1550 bp is easily amplified due to highly conserved, flanking coding regions that include the trnK exons, rps 16, and psbA. Several avai...
Two aquatic moss species, Calliergon megalophyllum and Drepanocladus sordidus (Amblystegiaceae, Bryophyta), which had been considered extinct in the Czech Republic, were found in the Třeboň Basin, South Bohemia, in 2016–2017. They co-occurred in extensive reed- and sedge-dominated fen pools with humic water on the shore of an old fishpond and the f...
Saxifraga damingshanensis (Saxifragaceae), a new species from Damingshan Nature Reserve in Guangxi Province, is described and illustrated. A morphological comparison between the new species and its putative relatives, S. mengtzeana and S. luoxiaoensis , is presented. The new species is morphologically similar to S. mengtzeana , but it can be easily...
Citations
... In addition, twelve mutation hotspot regions (matK gene, ccsA gene, trnH-GUG -psbA, ycf2-trnL-CAA , trnG-UCC -trnR-UCU , psbA-trnK-UUU , psbK-psbI, petA-psbJ, rps2-rpoC2, ndhC-trnV-UAC , rpl32-trnL-UAG and cemA-petA) longer than 200 bp with high Pi values were selected as candidate DNA barcodes for phylogenetic analysis and species identification of Seseli. Among them, matK gene, ccsA gene, and trnH-psbA region have been used as universal DNA barcodes in studying plant phylogeny [39][40][41]. We will further explore the reliability and effectiveness of these regions in future studies. ...
Background
The genus Seseli L., which consists of 125–140 species distributed in the Old World from western Europe and northwestern Africa to China and Japan, is one of the largest and most taxonomically difficult genera of Apiaceae Lindl. Although several previous studies have been conducted on Seseli based on limited morphological characteristics and molecular fragments, a robust and comprehensive phylogeny of Seseli remains elusive. Plastomes provide abundant genetic information and have been widely used in studying plant phylogeny and evolution. Consequently, we newly generated the complete plastomes of eleven Seseli taxa. We combined plastome data and morphological characteristics to investigate the phylogeny of Seseli .
Results
In our study, we observed that the genome length, gene numbers, IR/SC borders, and repeat composition of the eleven Seseli plastomes were variable. Several appropriate mutation hotspot regions may be developed as candidate DNA barcodes for evolution, phylogeny, and species identification of Seseli . The phylogenetic results identified that Seseli was not a monophyletic group. Moreover, the eleven newly sequenced Seseli taxa did not cluster with S. tortuosum (the type species of Seseli , belonging to the tribe Selineae), where S. delavayi clustered with Eriocycla belonging to the tribe Echinophoreae and the other ten belonged to Selineae. The comparative plastome and morphological characteristics analyses confirmed the reliability of the phylogenetic analyses and implied the complex evolution of Seseli .
Conclusion
Combining molecular and morphological data is efficient and useful for studying the phylogeny of Seseli . We suggest that “a narrow sense” of Seseli will be meaningful for further study and the current taxonomic system of Seseli needs to be revised. In summary, our study can provide new insights into the phylogenetic relationships and taxonomic framework of Seseli .
... Hızlı geliĢen plastid kodlama bölgelerinin arasında yer alan matK bölgesi moleküler sistematik ve evrime potansiyel katkıları olan bölgedir. Angiyospermlere ait türlerin arasında büyük oranda ayrım gösteren bölgedir [19][20][21]. ġekil 1.3: MatK gen bölgesi [20] TrnL bölgesi filogenetik analiz için tercih edilen kloroplast markörlerinden birisidir. TrnL bölgesininbitkiler hakkında çeĢitli evrimsel soruları cevaplamada faydalı olduğu kanıtlanmıĢtır. ...
... PCR reagents, primers and cycling conditions are described in Suppl. material 1 (Johnson and Soltis 1994;Sun et al. 1994;Käss and Wink 1997;Baldwin and Markos 1998;Miller and Bayer 2001;Ariati et al. 2006;Choi et al. 2006;Shaw et al. 2007;Li et al. 2008). PCR products were visualised on a 1.5% agarose gel with Easy ladder I (Bioline) and cleaned with ExoSAP-IT (USB) as per the manufacturer's protocol. ...
The morphologically variable genus Archidendron is the second largest mimosoid legume genus from the Indomalayan-Australasian region, yet it has not been well represented in phylogenetic studies. Phylogenies that have included multiple representatives of Archidendron suggest it may not be monophyletic, and the same applies to Archidendropsis , another understudied genus of the Archidendron clade. The most comprehensive phylogeny of Archidendron and Archidendropsis to date is presented, based on four nuclear markers (ITS, ETS, SHMT and RBPCO). Exemplars from all genera of the wider Archidendron clade are sampled, including representatives of all series within Archidendron and the two subgenera of Archidendropsis . Our results confirm that Archidendron and Archidendropsis are not monophyletic. Within Archidendron , only one series (ser. Ptenopae) is resolved as monophyletic and species of Archidendron are divided into two primarily geographic lineages. One clade is distributed in western Malesia and mainland Asia and includes most representatives of series Clypeariae , while the other is mostly restricted to eastern Malesia and Australia and includes representatives of the seven other series plus two samples of series Clypeariae . No taxonomic changes are made for Archidendron due to the high level of topological uncertainty and the lack of discrete macromorphological characters separating these two lineages. Each of the two subgenera of Archidendropsis is monophyletic but they are not closely related. A new genus endemic to Queensland (Australia), Heliodendron Gill.K. Br. & Bayly, gen. nov. , is described for the former Archidendropsis subg. Basaltica, and combinations for its three species are proposed: Heliodendron basalticum (F. Muell.) Gill.K. Br. & Bayly, comb. nov. , Heliodendron thozetianum (F. Muell.) Gill.K. Br. & Bayly, comb. nov. , and Heliodendron xanthoxylon (C.T. White & W.D. Francis) Gill.K. Br. & Bayly, comb. nov.
... Morphological characters along with molecular approaches have been used for taxonomic assessment and phylogenetic studies at infrageneric levels in the family Thymelaeaceae (Albert et al. 1992;Johnson and Soltis 1994;Baldwin et al. 1995;Alverson et al. 1998;Bakker et al. 1998; Van der Bank et al. 2002;Herbada 2006). Several species of Daphne were included in these analyses. ...
Daphne (Thymelaeaceae) is a small group of shrubby plants mainly distributed in subtropical and temperate regions of the world with a few species also occurring in alpine habitats. Of ca. 95 species in the world, six species and one variety are reported from India. Phylogenetic relationships of the Indian Daphne were investigated based on nuclear (ITS) and plastid (rbcL and trnL-F) regions. A total of 21 sequences representing five taxa of the six species reported from India were newly generated for the present study. The phylogenies using ML and Bayesian analyses obtained from individual and combined datasets were congruent and strongly supported the monophyly of the genus Daphne. Combined analyses revealed two major well-supported clades. The systematic relationship of the narrow endemic species, D. thanguensis was also confirmed as sister to the morphologically similar D. tangutica. The study supports the independent species status of D. retusa and D. tangutica. Ancestral state reconstructions were done using two major features, viz. presence or absence of indumentum on calyx and colour of the calyx occurrence of species. A taxonomic key has also been provided for the Indian taxa. This is the first comprehensive molecular study on the Indian Daphne.
... trnK-3914F (Johnson & Soltis, 1994), AR-matK-1200F, AR-matK-1510R, AR-matK-2510R, AR-matK-2100R, AR-matK-2400R (Wanke, 2006), and Ari-trnK-1938F: TGGCAGTGTTATTTTCACTTGTGG, Ari-trnK-2466F: TCCAAGAACCTCTTCTATTTCGCA, Ari-trnK-2756R: ...
The taxonomy of the Mediterranean Aristolochia pallida complex has been under debate since several decades with the following species currently recognized: A. pallida, A. lutea, A. nardiana, A. microstoma, A. merxmuelleri, A. croatica, and A. castellana. These taxa are distributed from Iberia to Turkey. To reconstruct phylogenetic and biogeographic patterns, we employed cpDNA sequence variation using both noncoding (intron and spacer) and protein-coding regions (i.e., trnK intron, matK gene, and trnK-psbA spacer). Our results show that the morphology-based traditional taxonomy was not corroborated by our phylogenetic analyses. Aristolochia pallida, A. lutea, A. nardiana, and A. microstoma were not monophyletic. Instead, strong geographic signals were detected. Two major clades, one exclusively occurring in Greece and a second one of pan-Mediterranean distribution, were found. Several subclades distributed in Greece, NW Turkey, Italy, as well as amphi-Adriatic subclades, and a subgroup of southern France and Spain, were revealed. The distribution areas of these groups are in close vicinity to hypothesized glacial refugia areas in the Mediterranean. According to molecular clock analyses the diversification of this complex started around 3-3.3 my, before the onset of glaciation cycles, and the further evolution of and within major lineages falls into the Pleistocene. Based on these data, we conclude that the Aristolochia pallida alliance survived in different Mediterranean refugia rarely with low, but often with a high potential for range extension, and a high degree of morphological diversity.
... Furthermore, this gene's high substitution rate aids in the construction of parsimony information-rich regions and the generation of robust phylogenetic predictions. In addition, the rate of substitution of the matK gene is a useful guide for obtaining accurate phylogenetic predictions and assessing how the evolutionary past evolved at various taxon levels (Johnson and Soltis 1994). However, it has been shown that for taxonomic groups (e.g. ...
Countries' genetic resources and biological variation are extremely valuable. Biodiversity and genetic resources, particularly for endemic species, should be protected. DNA barcoding studies are a useful for identifying unknown taxa and protecting a country's biodiversity. DNA barcodes are small segments of DNA that are taxonomically informative and can be used to for species identification. DNA barcodes have been used to associate life phases, determine cryptic species, and prohibit illegal commerce, among other things. Astragalus argaeus and A. stenosemioides are endemic plant species to Turkey's Mt. Erciyes. To distinguish these two endemic Astagalus, we used two DNA barcodes in the matK region. The current study used A. argaeus, A. stenosemioides, and 23 GenBank sequences of other relative in the genus Astragalus, including one from a closely related species, to infer phylogenetic relationships and DNA barcodes for two endemic plants. The matK gene region could clearly identify A. argaeus and A. stenosemioides from closely related taxa, according to the phylogenetic study. Taxonomic and biodiversity research, as well as molecular ecology and population genetics investigations, will benefit from DNA barcoding surveys to unambiguously differentiate between these two species. Also, by separating the matK DNA gene area, which is one of the molecular features, it is feasible to detect the species, and A. argaeus and A. stenosemioides were successfully barcoded for the first time.
... For amplification and sequencing, four candidate DNA barcoding regions were selected: the internal transcribed spacer regions (ITS) from nuclear genomes and three plastid regions (matK, trnL-F and psbA-trnH). PCR amplifications were performed in 20 µL using the AccuPower HotStart PCR PreMix kit (Bioneer, Daejeon, Korea), with either universal ITS-1 and ITS-4 primers from White et al. [27] or matK primers from Johnson et al. [28] or primers for the trnL-F intergenic spacer from Taberlet et al. [29] or primers for the psbA-trnH intergenic spacer from Sang et al. [30]. For ITS, psbA-trnH and trnL-F regions, PCR cycles consisted of an initial denaturation for 6 min at 95 • C, followed by 32 cycles of 60 s at 95 • C, 45 s at 56 • C, 90 s at 72 • C, and a final extension of 5 min 72 • C. The matK region was amplified following Hayashi and Kawano (2000) [31], including 35 cycles of 60 s at 94 • C, 120 s at 50 • C, 180 s at 72 • C and a final extension at for 7 min at 72 • C). ...
... For amplification and sequencing, four candidate DNA barcoding regions were selected: the internal transcribed spacer regions (ITS) from nuclear genomes and three plastid regions (matK, trnL-F and psbA-trnH). PCR amplifications were performed in 20 μL using the AccuPower HotStart PCR PreMix kit (Bioneer, Daejeon, Korea), with either universal ITS-1 and ITS-4 primers from White et al. [27] or matK primers from Johnson et al. [28] or primers for the trnL-F intergenic spacer from Taberlet et al. [29] or primers for the psbA-trnH intergenic spacer from Sang et al. [30]. For ITS, psbA-trnH and trnL-F regions, PCR cycles consisted of an initial denaturation for 6 min at 95 °C, followed by 32 cycles of ...
Lilium ledebourii (Baker) Boiss is one of the most endangered lilies, restricted to only a few
small and fragmented areas in the Hyrcanian forest. This study aimed at evaluating the taxonomy of
this unique Iranian lily and reconstructing divergence time from other species of the genus Lilium
to address the role of this region in its diversification. Phylogenetic trees based on nuclear ITS and
chloroplastic matK strongly supported the monophyly of the genus Lilium and division into subclades
hardly matching prior morphological classifications. Biogeographic analyses using S-DIVA revealed
East Asia as the ancestral range from where Lilium presented a multidirectional expansion towards
North America, West-Central Asia, North Asia, and Europe. Diverging from ancestral Lilium during
the beginning of Eocene (50 Ma; 95% HDP: 68.8–36.8). Specific members of Lilium colonized Iran
(Western Asia) separated from the Clade IV (West-Central Asia and Europe lineage), and then yielded
the Iranian L. ledebourri. Accordingly, the north of Iran appears to have promoted both long-term
persistence and migration of Lily species from Asia to the Europe.
... We amplified two regions: matK-trnK sequences for 19 species and internal transcribed spacers from the nuclear ribosomal DNA (ITS) sequences for 12 species. To amplify the former region, we used primers 19F (Goldman et al., 2001) and trnK2R (Johnson and Soltis, 1994), with a third internal primer, 308F, for sequencing Whitten et al. (2007) and, to amplify the ITS, we used primers 17SE and 26SE (Sun et al., 1994). The PCR parameters and reagent volumes are described in Whitten et al. (2007). ...
Background and aims:
The entangled relationship between chromosome number and genome size with species distribution has been the subject of study for almost a century but remains an open question due to previous ecological and phylogenetic knowledge constraints. To better address this subject, we used the clade Maxillariinae, a widely distributed and karyotypically known orchid group, as a model system to infer such relationships in a robust methodological framework.
Methods:
Based on literature and new data, we gathered the chromosome number and genome size for 93 and 64 species, respectively. We built a phylogenetic hypothesis and assessed the best macroevolutionary model for both genomic traits. Additionally, we gathered ecological data (preferences for bioclimatic variables, elevation, and habit) used as explanatory variables in multivariate phylogenetic models explaining genomic traits. Finally, the impact of polyploidy was estimated by running the analyses with and without polyploids in the sample.
Key results:
The association between genomic and ecological data varied depending on whether polyploids were considered or not. Without polyploids, chromosome number failed to present consistent associations with ecological variables. With polyploids, there was a tendency to waive epiphytism and colonise new habitats outside humid forests. The genome size showed association with ecological variables: without polyploids, genome upsize was associated with flexible habits, with higher elevation and with drier summers; with polyploids, genome size increase was associated with colonising drier environments.
Conclusions:
The chromosome number and genome size variations, essential but neglected traits in the ecological niche, are shaped in the Maxillariinae by both neutral and adaptive evolution. Both genomic traits are partially correlated to bioclimatic variables and elevation, even when controlling for phylogenetic constraints. While polyploidy was associated with shifts in the environmental niche, the genome size emerges as a central trait to orchid evolution by the association between small genome size with epiphytism, a key innovation to Neotropical orchid diversification.
... Fragments of the three cpDNA regions, i.e., matK and ndhF genes and trnL intron plus trnL-trnF intergenic spacer (hereinafter called trnL-trnF), were amplified by polymerase chain reaction (PCR) using the following primer pairs: matK-AF and matK-8R (Ooi et al. 1995), 1506R (Johnson and Soltis 1994), and matK-05 (Kato et al. 1998) for matK; 5.5F and 10.2R (Davis et al. 2001), 972F and 1318R (Olmstead and Sweere 1994), and 205 and 1018R (Kornhall et al. 2001) for ndhF; c, d, e, and f (Taberlet et al. 1991) for trnL-trnF; ITS-2, ITS-3, ITS-4, and ITS-5 (White 1990) for nrITS. PCR amplification was conducted using TaKaRa Ex Taq polymerase (TaKaRa Bio, Shiga, Japan) with the following PCR cycling conditions: 94 °C for 60 s, followed by 30 cycles of 94 °C for 45 s, 50 °C for 30 s, 72 °C for 60 s, with a final extension at 72 °C for 5 min. ...
Nothapodytes (Icacinaceae) is a genus of seven to eleven evergreen or deciduous tree species distributed in tropical Asia from India to Japan. Nothapodytes nimmoniana sensu lato is the most widespread species of the genus, being reported sporadically throughout South Asia, Southeast Asia, Taiwan, and Japan’s southwest islands. Nothapodytes amamianus was recently described from Amami-oshima, Japan, the northeastern edge of this widespread species’ range. However, the phylogenetic distinction between these two species has yet to be explored. Here we present an analysis of molecular species delimitation to test the morphology-based taxonomic hypothesis currently used to differentiate the two species. The results clearly show that N. nimmoniana sensu lato comprises two species, one in India and the other in Taiwan and Japan, including N. amamianus, requiring a reassessment of the morphological traits hitherto used to define the former and distinguish it from the latter in East Asia. Based on the taxonomic history of the taxa and rules of nomenclature, the name N. nimmoniana is retained for the former. We propose a new combination, N. insularis, for the latter. Longitudinal intraspecific geographic structure is highlighted as an apparent indicator of further hidden diversity in India’s Western Ghats.
... PCR amplification was done for two chloroplast gene regions trn L-F and trn S-ƒM, using trn L-F (Taberlet et al., 1991) and trn S-ƒM (Shaw et al., 2005) primer pairs, respectively. The chloroplast genome regions matK, and trn L-F together with nuclear ribosomal ITS regions have been explicitly used in evolutionary studies of the family Zingiberaceae (Johnson & Soltis, 1994;Baldwin et al., 1995;Kress et al., 2002). However, only the chloroplast intergenic spacer trn L-F and the non-coding region trn S-fM were used because in the initial steps, the primers that were used for ITS and matK regions failed to amplify the desired region for several species (A. ...
To assess the systematics and the phylogenetic
placement of the members of the two important genera
Alpinia Roxb. and Amomum Roxb. in Sri Lanka, molecular
data of twelve in-group species together with three outgroup
taxa of the family Zingiberaceae were extensively
analysed for phylogenetic significance. The current analysis
of the evolutionary relationships of the Sri Lankan members
of the genera of interest, utilising DNA sequence data of the
chloroplast genome regions trn L-F and trn S-fM, has resolved
four groups of Alpinia and two major clades of Amomum
with substantial parsimony analysis and Bayesian inferences
consistency values. With new accessions from the entire
native range of the family, this result points to the need for an
inevitable re-circumscription of the genus Alpinia, and shows
congruence to the recent reshuffling of the genus Amomum and
the family Zingiberaceae, except for the placement of each
genus as monophyletic groups in the context of our study.
Here, we suggest swapping the group defining species of an
Alpinia clade observed in previous studies. Finally, our study
suggests the use of fruit morphology to distinguish among
recognised groups for Sri Lankan species as they exhibit
positive correspondence.
