Figure - available from: Mitochondrial DNA Part B
This content is subject to copyright. Terms and conditions apply.
Maximum likelihood tree of 14 Callichthyidae species and one outgroup based on 13 protein-coding genes. The accession numbers are listed after the species names. The C. pygmaeus mitochondrial genome is marked in bold font.
Source publication
The Pygmy corydoras Corydoras pygmaeus Knaack, 1966, is the smallest member of the genus Corydoras, belonging to the family Callichthyidae and order Siluriformes. The complete mitochondrial genome of C. pygmaeus was sequenced and assembled using next-generation sequencing technology, and phylogenetically compared with those of other species of this...
Citations
... Insertion sequences of 29 bp (TATTTAAATCTAGCTCTATTAAATTAATT) and 30 bp (TATCTAAAACTATACTAAACTAAATAATTA) were observed in D. longibarbis and D. urostriatum, respectively. A similarly long intergenic sequence of 30 bp (CACATAAT-TAATCACATAAATTAAATCT) was also observed in H. littiorale, another species in the Callichthyinae, while a shorter intergenic sequence of 15-21 bp was observed in Corydoradinae [14,[38][39][40][41][42][43][44][45][46][47][48]. Given the high interspecific similarity in Corydoradinae, it was suggested that the atp6-cox3 intergenic sequence could function as a molecular marker for species classification, whereas in Callichthyinae, no intergenic sequence similarity was observed, except for length [48]. ...
... Supplementary Materials: The following supporting information can be downloaded at: https:// www.mdpi.com/article/10.3390/genes16030355/s1, Figure S1: Photographs of (a) D. longibarbis and (b) D. urostriatum used for DNA extraction; Figure S2 Table S1: The mitogenome data used in phylogenetic analysis; Table S2: Best substitution model used for phylogenetic trees; Table S3: Details on codon count and RSCU in the D. longibarbis mitogenome; Table S4: Details on codon count and RSCU in the D. urostriatum mitogenome. References [14,38,[40][41][42][43][44][45][46][47][48][51][52][53][54][55][56][57][58][59] ...
Background/Objectives: To date, no information is available on the complete mitochondrial genome of the genus Dianema (Siluriformes: Callichthyidae), a callichthyid catfish. In this study, we report on two complete mitochondrial genome sequences of Dianema longibarbis Cope, 1872, and Dianema urostriatum Miranda Ribeiro, 1912, the only two recognized species within the genus Dianema. Methods: DNA sequencing was performed using the HiSeq platform to obtain their complete mitogenomes. To confirm phylogenetic distance, two phylogenetic trees were established using maximum-likelihood and Bayesian inference methods with all concatenated protein-coding sequences (PCGs) and two ribosomal RNA (rRNA) genes from the D. longibarbis and D. urostriatum mitogenomes, along with 32 mitogenomes retrieved from Siluriformes. Results: The complete mitogenomes of D. longibarbis and D. urostriatum are 16,493 and 16,495 base pairs in length, respectively. Their nucleotide compositions are 31.79% A, 27.53% T, 25.86% C, and 14.82% G for D. longibarbis, and 31.69% A, 27.04% T, 26.36% C, and 14.91% G for D. urostriatum. Both mitogenomes contain 13 PCGs, 22 transfer RNA (tRNA) genes, and two rRNA genes. Phylogenetic results based on all PCGs and two rRNAs genes confirm D. longibarbis as a sister species to D. urostriatum in the subfamily Callichthyinae. Conclusions: In contrast to the extensive mitochondrial studies on species in the Corydoradinae, species in the Callichthyinae have been largely understudied. This study provides valuable insights into genetic diversity and evolutionary complexity by presenting the first mitochondrial genome analysis of two Dianema species, a genus within the Callichthyinae.
... Supplementary Materials: The following supporting information can be downloaded at: https:// www.mdpi.com/article/10.3390/genes16030282/s1, References [31][32][33][34][35][36][37][38][39][40][41][42][43][44][45][46][47] are cited in the Supplementary Materials. Figure S1: Photograph of H. concolor used for analysis; Figure S2: Tandem repeat sequence in control region of the H. concolor mitogenome; Figure S3: AT and GC-skewness of the 13 PCGs in the H. concolor mitogenome; Figure S4: A maximum likelihood (ML) phylogenetic tree of 32 published mitogenomes of Siluriformes, including that of H. concolor, based on the concatenated nucleotide sequences of 13 PCGs; Figure S5: A Bayesian phylogenetic tree of 32 published mitogenomes of Siluriformes, including that of H. concolor, based on the concatenated nucleotide sequences of 13 PCGs; Figure S6: The number of lengths for the uncorrected p-distance of the atp6-cox3 intergenic sequence between and within clades is presented for 21 species belonging to the family Corydoradinae; Table S1: ...
Background/Objectives: In this study, we report the complete mitochondrial genome sequence of Hoplisoma concolor Weitzman, 1961 (Siluriformes: Callichthyidae), a callichthyid catfish. Methods: DNA sequencing was performed to obtain its complete mitogenome using the HiSeq platform. To assess the phylogenetic relationships, maximum-likelihood and Bayesian inference phylogenetic trees were constructed using two ribosomal RNA (rRNA) genes and all protein-coding sequences (PCGs) concatenated from the H. concolor mitogenome, along with 31 other Siluriformes mitogenomes. Results: The complete mitogenome of H. concolor is 16,579 base pairs in length, with a nucleotide composition of 32.2% A, 26.0% T, 15.3% G, and 26.5% C. It contains 13 PCGs, 22 transfer RNA genes, and 2 rRNA genes. Phylogenetic analysis based on all PCGs and two rRNAs of the complete mitogenome confirms H. concolor as a sister species of H. panda within the subfamily Corydoradinae. In addition, intergenic sequences between atp6 and cox3 of 21 species of Corydoradinae provide further support for their phylogenetic relationship. Conclusions: Given the lack of detailed descriptions regarding the length and nucleotide composition of these intergenic sequences, our study contributes valuable insights into the genetic diversity and evolutionary complexity of Callichthyidae.
The complete mitogenome of four Scleromystax barbatus populations distributed along the species natural range was reconstructed, comprising the first study with this genus and the second with Corydoradinae specimens sampled from their natural environment and deposited in permanent collections. The mitogenome of S. barbatus is a circular molecule of 16,694 base pairs (bp) comprising 37 genes, 22 of which are tRNA, two are rRNA, 13 are protein-coding genes and one control region (D-loop). An 18-nucleotide insertion sequence was found between the ATPase subunit 6 and COIII genes. Most genes are encoded on the heavy strand, while the ND6 and eight tRNAs are found on the light strand. Phylogenetic analyses using other available Callichthyidae mitogenomes confirmed the monophyly of Callichthyinae and Corydoradinae and indicate that S. barbatus populations form a separate and more closely related branch of Corydoras nattereri + Corydoras paleatus.
