Figure - available from: Veterinary Medicine: Research and Reports
This content is subject to copyright. Terms and conditions apply.
Source publication
Introduction
Brucellosis is a neglected bacterial zoonosis with serious veterinary and public health importance throughout the world. A cross-sectional study on animal brucellosis was conducted aiming to estimate seroprevalence and molecular detection.
Methods
Blood samples were collected from a total of 4274 individual animals (cattle, small rumi...
Similar publications
Goats contribute significantly to the global food security and industry. They constitute a main supplier of meat and milk for large proportions of people in Egypt and worldwide. Brucellosis is a zoonotic infectious disease that causes a significant economic loss in animal production. A case-control genome-wide association analysis (GWAS) was conduc...
Background
Human brucellosis is the most common bacterial zoonosis worldwide, with brucella spondylitis (BS) being one of its most severe forms, potentially leading to spinal deformity or paralysis. This study aims to provide a comprehensive overview of the current status and research trends in the BS field using bibliometric methods.
Methods
Publ...
Introduction. Brucellosis is a pervasive zoonotic disease causing considerable human morbidity worldwide. This report focuses on a case of neurobrucellosis in a rural Indian patient, emphasizing the need for timely microbiological confirmation given its nonspecific clinical presentation.
Case Presentation. A 55-year-old rural Indian farmer presente...
Zoonotic diseases pose a growing health risk in developing nations because of the ongoing animal-human interaction. India has experienced significant urbanization in recent years, with a large population migration from rural to urban areas. One of the most common and feared risks to which humans are exposed is zoonotic diseases. Numerous studies co...
Brucellosis is a globally prevalent zoonotic disease caused by Brucella spp. posing significant threats to animal and human health. In this study, a novel lytic brucellaphage designated Y17 was isolated from sheep fecal samples collected in Ludian County, Yunnan Province, China. Transmission electron microscopy revealed that Y17 was composed of an...
Citations
... To date, B. abortus has been isolated from samples collected from aborting dairy cows in the central Oromia region using bacteriological culture and biochemical methods and later confirmed through species-specific conventional PCR. Similarly, B. melitensis has been identified in goats slaughtered for meat [29], as well as in aborting goats from pastoral areas of Afar [30] and Borena [31] in Ethiopia. Further strain-level genotyping has been limited, with only one study providing a detailed analysis of B. abortus [28]. ...
... Further, we could identify Brucella melitensis in 15% of sheep and goats with a recent history of abortion. This is similar to previous studies that successfully isolated Brucella from clinical samples obtained from small ruminants using bacteriological methods, later confirmed with conventional PCR, and identified only B. melitensis in goats from the Afar and Borena pastoral areas [29][30][31]. However, one previous study detected only B. abortus, in 35 of 36 small ruminants, but only species-specific conventional PCR from livestock serum samples was used [58]. ...
Brucellosis is a neglected zoonotic disease affecting livestock and humans that remains endemic in Ethiopia. Despite its prevalence, only a few studies have identified Brucella species circulating in livestock in the country. This study aimed to determine the Brucella species responsible for infections in livestock in the Afar region of Ethiopia and characterize the isolates using whole-genome single nucleotide polymorphism (wgSNP) analysis and in silico multi-locus sequence typing (MLST). Comparisons were made between Ethiopian Brucella and regional and global isolates to determine their phylogenetic relationships. Surveys conducted in May and October–November 2022 in six villages of the Amibara district involved the collection of vaginal swabs (n = 231) and milk samples (n = 17) from 32 sheep and 199 goats kept by 143 pastoral households reporting recent abortions in the animals. Brucella melitensis was detected in three sheep and 32 goats, i.e., 15% (35/231) of animals across 20% (29/143) of households using bacterial culture and PCR-based methods (bcsp31, AMOS, and Bruce-ladder multiplex PCR). Of the 35 positive animals, B. melitensis was isolated from 24 swabs, while the remaining 11 were culture-negative and detected only by PCR. The genomic DNA of the 24 isolates was sequenced using Illumina Novaseq 6000 and assembled using the SPAdes pipeline. Nine- and 21-locus MLST identified 23 isolates as genotype ST12, while one isolate could not be typed. The wgSNP-based phylogenetic analysis revealed that the Ethiopian isolates clustered within the African clade and were closely related to isolates from Somalia. Several virulence factors responsible for adhesion, intracellular survival, and regulatory functions were detected in all isolates. No antimicrobial resistance genes associated with resistance to drugs commonly used for treating brucellosis were detected. Since B. melitensis is prevalent in sheep and goats, vaccination with the B. melitensis Rev-1 vaccine is the recommended strategy in these pastoral systems to protect animal and human health.
... Bacterial DNA was analyzed by RT-PCR with the IS711 primer probe. Amplification of the Brucella DNA genus was in Bayeta et al. 25 Using (forward: GCTTGAAGCTTGCGGACAGT) and (reverse: GGCCTACCGCTGCGAAT), probe (5'-6-FAM-AAGC-CAACACCCGGCCATTATGGT-TAMRA 3') (Invitrogen, Thermo Fisher Scientific, Waltham, Massachusetts, USA). Total mix volume was 15 μL/sample containing: Master mix 3 μL (Applied Biosystems, Waltham, Massachusetts, USA), 0.3 μL for each forward and reverse primer, 0.1 μL of the labelled probe, and 3.5 μL DNA and water to make up the total volume. ...
Introduction and aim. Brucellosis is a zoonotic disease. Experimental clinical and laboratory diagnosis is still facing problems in identifying the organism. The present study will diagnose a Brucella infection in camel blood in Qatar using serological assays. Isolation and identification were performed on a camel blood sample. Brucella in bacterial isolates was determined by real-time polymerase chain reaction (RT-PCR) as a gold standard test. Material and methods. A total of 220 samples, 200 random serum samples, and 20 EDTA blood samples were selected among the above-mentioned random samples, and 20 serum samples from camel handlers were collected from Al Shahaniya prov ince, Qatar. The Rose Bengal test (RBT), buffered antigen plate agglutination test (BAPAT), and enzyme linked immunosorbent assay (cELISA) for the monoclonal antibody in serum samples were performed using commercially available kits. For the molecular detection of Brucella, conventional PCR and real-time PCR (GPS kit) were used for the genus-specific insertion sequence IS711. Brucella melitensis (MICROBOSS Hightech GmbH kit) was used to identify subspecies. Results. The results identified by vitek2 compact (30%) showed B. melitensis in 6 samples out of 20 isolates. Both conventional (66.67%) and RT-PCR (83.33%) analyses supported this, demonstrating the presence of Brucella. These tests also showed that Brucella species were present in Rose Bengal 182/200 (91%), BAPAT 182/200 (91%), and cELISA (90%) 180/200 in camel serum. Conclusion. To conclude, the prevalence of brucellosis in dromedary camels is higher in this region, and as a matter of urgency, measures should be taken to control the disease.
... Amplification of the Brucella DNA genus was in Bayeta et al. 25 ...
... A recent study showed that the brucellosis seroprevalence rate, which was confirmed by PCR, among domestic animals in Southern and central Ethiopia was 3.95% (Wakjira et al., 2022). ...
Brucellosis is one of the most highly infectious zoonotic diseases worldwide and has substantial health and economic impact. Strenuous efforts are essential to combat and prevent this disease from the one-health perspective. Brucellosis is successfully eradicated from domestic animals in the United States, but control strategies continue to eradicate it from wildlife in the Greater Yellowstone Area (GYA). Brucellosis in the Nile River Basin countries (Egypt, Sudan, Ethiopia, and Tanzania) is highly prevalent and endemic. There are several factors behind the failure of eradication of Brucella in these countries. The lack of cooperation between policymakers, health officials, veterinary sectors, and farmers is the key reason that impedes the control and prevention strategies in brucellosis-endemic countries. This review will focus on the epidemiology, prevention, and control strategies of Brucella abortus and Brucella melitensis in the United States and the Nile Basin countries (Egypt, Sudan, Ethiopia, and Tanzania).
... RB=Rose Bengal test, SAT=Sero agglutination tube, SAT-2Me=Sero agglutination tube with 2 Mercaptoethanol, FPA=Fluorescence polarization assay all months of diagnosis, proving that the antibodies induced by RB51 cannot be detected (there is no antigen-antibody interaction) by the diagnostic screening tests for bovine brucellosis [34]. Thus, in cattle herds where the RB51 vaccine strain is used correctly, the use of diagnostic screening tests, such as RB, could be considered unequivocally. ...
Background and Aim
The diagnosis of bovine brucellosis in animals vaccinated with strain-19 (S19) and Rose Bengal (RB)-51 strain vaccines can be misinterpreted due to false positives. This study aimed to compare diagnostic tests for detecting bovine brucellosis in animals vaccinated with S19 and RB51 vaccine strains.
Materials and Methods
Two groups of 12 crossbred Holstein calves between 6 and 8 months of age were used. On day 0, blood samples were collected from the animals, and the competitive enzyme-linked immunosorbent assay was used for serological diagnosis of bovine Brucellosis. All animals tested negative. After the first blood collection, the animals were subcutaneously vaccinated: one group received the S19 vaccine and the other received the RB51 vaccine. From the 3rd month after vaccination, all animals were sampled. Sampling was repeated every 2 months until the 7th month. Serological diagnosis of bovine brucellosis was performed using RB, tube serum agglutination test (SAT), SAT with 2-mercaptoethanol (SAT-2Me), and fluorescence polarization assay (FPA).
Results
Animals vaccinated with S19 showed positive results with the RB, SAT, and SAT-2Me tests in all months of post-vaccination diagnosis. In animals vaccinated with S19, FPA showed positive results at months 3 and 5 and negative results at month 7, indicating that this test discriminates vaccinated animals from infected animals 7 months after vaccination. Rose Bengal, SAT, SAT-2Me, and FPA tests showed negative results in animals vaccinated with RB51 in all months of diagnosis.
Conclusion
Animals vaccinated with S19 may test positive for brucellosis using RB, SAT, or SAT-2Me tests 7 months later. Fluorescence polarization assay is an optimal alternative for diagnosing animals in the field, thereby preventing false positives, and consequently, unnecessary confiscations of animals. Animals vaccinated with RB51 tested negative with RB, SAT, SAT-2Me, and FPA tests in all months of diagnosis, confirming that the tests are ineffective for diagnosing brucellosis caused by rough strains.
Background and objective
Brucellosis is a neglected zoonotic disease caused by Brucella species. Unlike most developed nations, the problem of brucellosis in Ethiopia remains a public and animal health concern. This study was conducted to determine the magnitude of brucellosis in animals (mainly cattle, sheep, goats, dogs and camels) and humans, and to identify the risk factors for human brucellosis.
Methodology
The Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines were followed to conduct this systematic review and meta-analysis, which was performed from May 2024 to July 2024. Academic databases such as PubMed, ScienceDirect, Scopus, PubMed Central, Web of Science, and Google Scholar were searched to identify articles focusing on brucellosis in humans and animals in Ethiopia. Data extraction was performed according to predefined inclusion and exclusion criteria. The included articles were appraised using the appraisal tool for cross-sectional studies to assess study quality. Publication bias and small study effects were examined using funnel plot observation and Egger’s test, respectively. Statistical analysis was conducted using R software version 4.4.1.
Results
Thirty-nine articles published between 2015 and 2024 were included in the final analysis from a total of 1,427 identified articles. The overall pooled seroprevalence of brucellosis was 5.0% (95% CI: 3.0, 6.0). The seroprevalence of brucellosis was higher in humans at 6.9% (95% CI: 4.9, 8.8) and lower in cattle at 3.5% (95% CI: 2.2, 4.7). There was high heterogeneity in the reports of brucellosis seroprevalence between studies (τ² = 0.0038, H² = 255.9, I² = 99.61%, Q-test = 1954.99, df = 56, p ≤ 0.001). Laboratory tests and study location were identified as factors contributing to potential sources of variation in the pooled seroprevalence. Drinking raw milk from aborted animals, touching aborted materials or fetuses, and occupation were among the risk factors for human brucellosis. No publication bias or small study effects were detected.
Conclusion
The findings indicate that brucellosis continues to pose a significant zoonotic threat, particularly to humans, where the seroprevalence is notably higher than in animals. These results highlight the need for targeted public health interventions and greater awareness to reduce the incidence of brucellosis, especially among high-risk populations.
BACKGROUND ANDMETHODS: Brucellosis is a dreadful zoonotic disease affecting humans and all domestic animals including camels worldwide. Serological evidence for Brucella infection in camels has been reported from all pastoralist and agro-pastoralist regions of Ethiopia. Investigations have shown that antibody concentrations are lower in camels than in cattle. However, serological diagnostic kits have been developed for cattle brucellosis is directly transposed for camels without adequate assay validation and genotyping of Brucella species is still absent in camel population in Ethiopia. This study aimed to evaluate gaps associated with Rose Bengal Plate Test (RBPT) and molecular detection of Brucella species from apparently healthy camels slaughtered at the Akaki abattoir. The study applied Brucella genus speci c, Brucella abortus (B.abortus) and Brucella melitensis (B.melitensis) species-speci c primers on RBPT-positive and retropharyngeal lymph node samples collected from 100 camels' heads. RESULTS: RBPT revealed the presence of anti-Brucella antibodies in 5 of 100 (5%) slaughtered camels. All RBPT-positive were also positive for PCR. Among the100 lymph node samples examined, 35 (35%) were Brucella positive by PCR. All were found to be B. abortus;however, B. melitessis was not detected in either the serum or lymph node samples. CONCLUSION: To the authors' knowledge, this investigation is the rst report on the molecular detection of B.abortus from camel in Ethiopia. Sequence data con rmed the presence of B. abortus from apparently healthy camels slaughtered at Akaki abattoir, Ethiopia. B. abortus molecular detection rate on lymph nodes samples was seven times greater than that of RBPT. We recommend that advanced research be conducted on camel milk and meat and those camel herders emphasize Ethiopian pastoral areas in particular to understand Brucella epidemiology and its public health signi cance.
BACKGROUND ANDMETHODS: Brucellosis is a dreadful zoonotic disease affecting humans and all domestic animals including camels worldwide. Serological evidence for Brucella infection in camels has been reported from all pastoralist and agro-pastoralist regions of Ethiopia. Investigations have shown that antibody concentrations are lower in camels than in cattle. However, serological diagnostic kits have been developed for cattle brucellosis is directly transposed for camels without adequate assay validation and genotyping of Brucella species is still absent in camel population in Ethiopia. This study aimed to evaluate gaps associated with Rose Bengal Plate Test (RBPT) and molecular detection of Brucella species from apparently healthy camels slaughtered at the Akaki abattoir. The study applied Brucella genus specific, Brucella abortus (B.abortus) and Brucella melitensis (B.melitensis) species-specific primers on RBPT-positive and retropharyngeal lymph node samples collected from 100 camels’ heads.
RESULTS: RBPT revealed the presence of anti-Brucella antibodies in 5 of 100 (5%) slaughtered camels. All RBPT-positive were also positive for PCR. Among the100 lymph node samples examined, 35 (35%) were Brucella positive by PCR. All were found to be B. abortus;however, B. melitessis was not detected in either the serum or lymph node samples.
CONCLUSION: To the authors’ knowledge, this investigation is the first report on the molecular detection of B.abortus from camel in Ethiopia. Sequence data confirmed the presence of B. abortus from apparently healthy camels slaughtered at Akaki abattoir, Ethiopia. B. abortus molecular detection rate on lymph nodes samples was seven times greater than that of RBPT. We recommend that advanced research be conducted on camel milk and meat and those camel herders emphasize Ethiopian pastoral areas in particular to understand Brucella epidemiology and its public health significance.
