Fig 1 - uploaded by Horacio Cadena
Content may be subject to copyright.
Source publication
The identity of the sandfly vectors of Leishmania braziliensis in Valle del Cauca Department, Colombia, was originally given as Lutzomyia townsendi, but then changed to L. youngi, another member of the L. townsendi series (Verrucarum group) with isomorphic females. To identify members of this series in Valle del Cauca, we analyzed the nuclear gene...
Contexts in source publication
Context 1
... bloodsucking females of Lutzomyia species classified in the Verrucarum species group (Theodor, 1965; Kreutzer et al., 1990) are the pro v en or suspected v ectors of many Leishmania species in the northern Neotropics (Young and Duncan, 1994), including Leishmania ( Leishmania ) chagasi , Le . ( Le .) mexicana , Le . ( Viannia ) braziliensis and Le . ( V .) panamensis . Most transmission occurs in rural or wooded locations and the disease is usually contracted by people who work in or li v e near plantations and forested areas (Alexander et al., 1995c). Kreutzer et al. (1990) recognized three series in the Verrucarum species group, and in this paper we consider the molecular systematics of the Lutzomyia townsendi series, the females of which are usually considered to be isomorphic (Feliciangeli et al., 1992; Young and Duncan, 1994). The males are readily separable morphologically but the identification of the females often requires the presence of identifiable males that are assumed to be conspecifics of females caught at the same place and time. Although multi v ariate analysis of morphological characters can discriminate some females of some species (Anez et al., 1997), the diagnostic body parts are often missing from preser v ed specimens. Isoenzymes ha v e also been used for identification (Kreutzer et al., 1990) but specimens for isoenzyme analysis need to be cryopreser v ed, which is not always possible in the field. In contrast, it is feasible to preser v e specimens in ethanol for DNA analysis. To identify species in the Verrucarum group, we used a molecular phylogenetic analysis of the nuclear gene elongation factor-alpha (EF-alpha) and the mitochondrial gene cytochrome b (Cyt b ). Here we report on the identities of the v ectors of Le. braziliensis in the Department of Valle del Cauca, southwest Colombia (Fig. 1). These were identified as L. townsendi (Ortiz) by Warburg et al. (1991), but as L. youngi Feliciangeli and Murillo, 1987 (another member of the L. townsendi series) in later reports by Alexander and Usma (1994), Alexander et al. (1995a,b,c,d). Details are gi v en in Table 1 and Fig. 1. Three collection sites were used in Valle del Cauca, all located on the lower slopes (1150 Á / 1800 m a.s.l.) of the v alley of the Ri v er Cauca, which runs north- wards between the western and central cordilleras of the Andes. This is a region where much tropical forest was cleared in the last century, to make way for plantations of sugar cane, fruits and, as in the Versalles and Jiguales sites, coffee. Remnants of secondary or degraded primary forest remain, as in the Mateguadua site, where the low v egetation includes brush and open grassland (Warburg et al., 1991). Three species of the L. v errucarum series of the Verrucarum group (Young and Duncan, 1994) were also collected in Colombia, to be used as outgroups for phylogenetic analyses, namely L. columbiana (Ristorcelli and Van Ty), L. e v ansi (Nun ̃ ez-To v ar) and L. o v allesi (Ortiz). All specimens were stored in 96% ethanol at ( / 20 8 C. Each sandfly was washed in a dilute solution (1%) of domestic detergent and rinsed three times in molecular biology grade water (Sigma), in order to remo v e much of the ethanol before being dissected with sterilized forceps and micro-needles. This was carried out in a room away from the molecular biology laboratory, to reduce the risk of polymerase chain reaction (PCR) carryo v er, i.e. the ‘‘contamination’’ of a genomic DNA sample with a PCR product that had already been amplified. After dissection, the thorax and anterior abdomen were used for DNA extraction and the head and terminalia were slide- mounted in Berlese fluid (Ready et al., 1991) to permit morphological identification (Young and Duncan, 1994). Voucher specimens were placed in the phlebotomine collection of the Department of Entomology, The Natural History Museum, London. DNA was extracted from single sandflies by the method of Ish-Horowicz with minor modifications (Ish-Horowicz, 1982; Ready et al., 1991). The thorax and anterior abdomen of each specimen was homogenized with a Gilson pipette tip or a sealed Pasteur pipette in a 1.5 ml microfuge tube. Following ethanol precipitation, the genomic DNA was dissol v ed in 15 m l 1 ) / TE (10 mM Tris Á / HCl, 1 mM EDTA, pH 8.0). 0.5 Á / 2.0 m l of this DNA solution was added to 50 m l of PCR mix, which contained 1 ) / Promega buffer (without MgCl 2 ), 1.5 mM MgCl 2 , 60 m M of each dNTP, 500 ng of each primer and 1 unit of Promega TAQ polymerase. A 622 bp fragment of EF-alpha was amplified using the following primers, designed by P.D.R. based on amino acid motifs conser v ed between Phlebotomus ( Larroussius ) species and other insects, as found in the sequence alignments of Esseghir (1998): EF-F03 5 ? -3 ? GCTCCTGGAC- ATCGTGAYTT; EF-R04 5 ? -3 ? AGTGCTTCGT- GGTGTATYTC. A 505 bp fragment of the Cyt b was amplified using the following primers (Esseghir, 1998; Esseghir et al., 2000): CB1-SE 5 ? -3 ? TATGTAC- TACCCTGAGGACAAATATC; CB3-R3A 5 ? - 3 ? GCTATTACTCCYCCTAACTTRTT. The PCR reactions were performed in a PE- GeneAmp † PCR system 9700 (0.5 ml block). Cycling conditions for PCR amplification were: an initial denaturation step at 94 8 C for 3 min; fi v e cycles of 94 8 C for 30 s, 38 8 C (EF-alpha) or 40 8 C (Cyt b ) for 30 s, and 72 8 C for 90 s; 35 cycles of 94 8 C for 30 s, 44 8 C for 30 s and 72 8 C for 90 s; and, a final extension of 72 8 C for 10 min was followed by cooling to 4 8 C. The PCR products were separated on 1.5% agarose gels and the DNA samples in the excised gel ...
Context 2
... bloodsucking females of Lutzomyia species classified in the Verrucarum species group (Theodor, 1965; Kreutzer et al., 1990) are the pro v en or suspected v ectors of many Leishmania species in the northern Neotropics (Young and Duncan, 1994), including Leishmania ( Leishmania ) chagasi , Le . ( Le .) mexicana , Le . ( Viannia ) braziliensis and Le . ( V .) panamensis . Most transmission occurs in rural or wooded locations and the disease is usually contracted by people who work in or li v e near plantations and forested areas (Alexander et al., 1995c). Kreutzer et al. (1990) recognized three series in the Verrucarum species group, and in this paper we consider the molecular systematics of the Lutzomyia townsendi series, the females of which are usually considered to be isomorphic (Feliciangeli et al., 1992; Young and Duncan, 1994). The males are readily separable morphologically but the identification of the females often requires the presence of identifiable males that are assumed to be conspecifics of females caught at the same place and time. Although multi v ariate analysis of morphological characters can discriminate some females of some species (Anez et al., 1997), the diagnostic body parts are often missing from preser v ed specimens. Isoenzymes ha v e also been used for identification (Kreutzer et al., 1990) but specimens for isoenzyme analysis need to be cryopreser v ed, which is not always possible in the field. In contrast, it is feasible to preser v e specimens in ethanol for DNA analysis. To identify species in the Verrucarum group, we used a molecular phylogenetic analysis of the nuclear gene elongation factor-alpha (EF-alpha) and the mitochondrial gene cytochrome b (Cyt b ). Here we report on the identities of the v ectors of Le. braziliensis in the Department of Valle del Cauca, southwest Colombia (Fig. 1). These were identified as L. townsendi (Ortiz) by Warburg et al. (1991), but as L. youngi Feliciangeli and Murillo, 1987 (another member of the L. townsendi series) in later reports by Alexander and Usma (1994), Alexander et al. (1995a,b,c,d). Details are gi v en in Table 1 and Fig. 1. Three collection sites were used in Valle del Cauca, all located on the lower slopes (1150 Á / 1800 m a.s.l.) of the v alley of the Ri v er Cauca, which runs north- wards between the western and central cordilleras of the Andes. This is a region where much tropical forest was cleared in the last century, to make way for plantations of sugar cane, fruits and, as in the Versalles and Jiguales sites, coffee. Remnants of secondary or degraded primary forest remain, as in the Mateguadua site, where the low v egetation includes brush and open grassland (Warburg et al., 1991). Three species of the L. v errucarum series of the Verrucarum group (Young and Duncan, 1994) were also collected in Colombia, to be used as outgroups for phylogenetic analyses, namely L. columbiana (Ristorcelli and Van Ty), L. e v ansi (Nun ̃ ez-To v ar) and L. o v allesi (Ortiz). All specimens were stored in 96% ethanol at ( / 20 8 C. Each sandfly was washed in a dilute solution (1%) of domestic detergent and rinsed three times in molecular biology grade water (Sigma), in order to remo v e much of the ethanol before being dissected with sterilized forceps and micro-needles. This was carried out in a room away from the molecular biology laboratory, to reduce the risk of polymerase chain reaction (PCR) carryo v er, i.e. the ‘‘contamination’’ of a genomic DNA sample with a PCR product that had already been amplified. After dissection, the thorax and anterior abdomen were used for DNA extraction and the head and terminalia were slide- mounted in Berlese fluid (Ready et al., 1991) to permit morphological identification (Young and Duncan, 1994). Voucher specimens were placed in the phlebotomine collection of the Department of Entomology, The Natural History Museum, London. DNA was extracted from single sandflies by the method of Ish-Horowicz with minor modifications (Ish-Horowicz, 1982; Ready et al., 1991). The thorax and anterior abdomen of each specimen was homogenized with a Gilson pipette tip or a sealed Pasteur pipette in a 1.5 ml microfuge tube. Following ethanol precipitation, the genomic DNA was dissol v ed in 15 m l 1 ) / TE (10 mM Tris Á / HCl, 1 mM EDTA, pH 8.0). 0.5 Á / 2.0 m l of this DNA solution was added to 50 m l of PCR mix, which contained 1 ) / Promega buffer (without MgCl 2 ), 1.5 mM MgCl 2 , 60 m M of each dNTP, 500 ng of each primer and 1 unit of Promega TAQ polymerase. A 622 bp fragment of EF-alpha was amplified using the following primers, designed by P.D.R. based on amino acid motifs conser v ed between Phlebotomus ( Larroussius ) species and other insects, as found in the sequence alignments of Esseghir (1998): EF-F03 5 ? -3 ? GCTCCTGGAC- ATCGTGAYTT; EF-R04 5 ? -3 ? AGTGCTTCGT- GGTGTATYTC. A 505 bp fragment of the Cyt b was amplified using the following primers (Esseghir, 1998; Esseghir et al., 2000): CB1-SE 5 ? -3 ? TATGTAC- TACCCTGAGGACAAATATC; CB3-R3A 5 ? - 3 ? GCTATTACTCCYCCTAACTTRTT. The PCR reactions were performed in a PE- GeneAmp † PCR system 9700 (0.5 ml block). Cycling conditions for PCR amplification were: an initial denaturation step at 94 8 C for 3 min; fi v e cycles of 94 8 C for 30 s, 38 8 C (EF-alpha) or 40 8 C (Cyt b ) for 30 s, and 72 8 C for 90 s; 35 cycles of 94 8 C for 30 s, 44 8 C for 30 s and 72 8 C for 90 s; and, a final extension of 72 8 C for 10 min was followed by cooling to 4 8 C. The PCR products were separated on 1.5% agarose gels and the DNA samples in the excised gel ...
Context 3
... purified with glassmilk (Geneclean II, Bio 101, Inc.). One-hundred-nanogram of each purified DNA sample was cycle-sequenced using an ABI Prism † Big Dye TM Terminator Cycle Sequencing Ready Reaction Kit ( v ersion 2.0), with 3.2 pmol of the same primers that were used for PCR, except for primer CB1-SE which was replaced by CB1 5 ? - 3 ? TATGTACTACCATGAGGACAAATATC (Esseghir, 1998). Unless stated otherwise, PCR products from each fly were sequenced on both strands for both primer sets. Sequencing reactions were performed in a PE-GeneAmp † PCR system 9700 (0.2 ml block). Cycling conditions were: an initial denaturation step at 96 8 C for 2 min; 35 cycles of 96 8 C for 15 s, 50 8 C for 15 s and 60 8 C for 4 min; followed by cooling to 4 8 C (Applied Biosystems protocol). Purification of the extension products was carried out using the ethanol precipitation method, and sequences were resol v ed using the ABI 373A or 377 system, all according to ABI protocols (PE Applied Biosystems). All sequences were aligned and edited using Sequencher TM 3.1.1 software (Gene Codes Cor- poration). PAUP* 4.0b7 software was used to in v estigate phylogenetic relationships by parsimony analysis and to produce genetic distance tables (Swofford, 2001). Trees were produced using a branch and bound search (with equal character weighting), and the le v el of support for each branch was estimated using bootstrap analysis with heuristic searches (100) to produce a consensus tree. The latter was used because the branch and bound algorithm could not quickly resol v e the relationships within terminal clades. The EF-alpha sequences were determined from PCR products containing the two alleles from each fly, and consequently the alleles were not unambiguously resol v ed at some sites in heterozygous indi v iduals (Fig. 2). Howe v er, the membership of the different lineages did not change when the phylogenetic analyses were performed either with ambiguous sites or with the alternati v e alleles that could be inferred. L. columbiana was collected from Versalles and Jiguales, the two sites on the eastern flank of the western cordillera of the Andes (Fig. 1). In these collections (Table 1), this was the only member of the L. v errucarum series, the males of which ha v e two basal spines inserted at the same le v el on each style of the external genitalia (Young and Duncan, 1994). All three sites contained members of the L. townsendi series, including males which were recognized by the presence of a single, isolated basal spine on each style (Young and Duncan, 1994). Based on the structure and setation of the central lobe (or paramere) of the external genitalia, all 12 males collected in Mateguadua, situated on the western flank of the central cordillera of the Andes (Fig. 1), were L. youngi . In contrast, all fi v e males from Versalles and Jiguales were L. townsendi sensu stricto. The analysis was based on an alignment of 582 nucleotides, all PCR products from all specimens being of this size (fragment without primers). Each sequence consisted of a single open reading frame, and this fragment of uninterrupted exon (there was no intron) had high homology with the EF-alpha amino acid sequences of Drosophila melanogaster and sandflies of the genus Phlebotomus (90.2 Á / 98.5%) (Esseghir, 1998). Considering all fi v e morphospecies studied, 18 genotypes (or unique sequences) were obtained, and the alignment of the 57 v ariant nucleotide characters is gi v en in Fig. 2. Comparisons between all morphospecies showed polymorphic nucleotide sites occurring mostly at third-base positions in codons (53 out of 57), 51 of which were synonymous. Fi v e out of the six non-synonymous changes were fixed polymorphisms, diagnostic for L. columbiana (nucleotide position 151), L. o v allesi (nucleotide positions 331 Á / 333) or L. e v ansi (nucleotide position 396). Of the 51 synonymous changes (Fig. 2), many were fixed polymorphisms diagnostic for the species: six for L. o v allesi , se v en for L. e v ansi , 11 for L. columbiana , and nine for the L. townsendi series (nucleotide positions 18, 27, 147, 177, 195, 225, 303, 519, 558). Variation within the latter series is reported in Sections 3.6 and 3.7. Phylogenetic analysis included all genotypes in the L. townsendi series (two morphospecies recognized from the males) and in the L. v errucarum series (three morphospecies recognized). Of the latter, L. o v allesi was selected as the outgroup because its genotypes were genetically more distant from those of the L. townsendi series (see Section 3.6). Of the 57 v ariant characters, 54 were infor- mati v e in maximum parsimony (MP) analyses. A branch and bound search found 384 most parsimonious trees of 66 steps (consistency index excluding constant characters (CI) 0 / 0.9365, homoplasy index excluding constant characters (HI) 0 / 0.0635, rescaled consistency index (RCI) 0 / 0.9220). MP analysis unambiguously identified (with a bootstrap support of 100%) the genotypes of L. columbiana as forming the sister group to those of the monophyletic L. townsendi series (Fig. 3). Nine EF-alpha genotypes were identified among the 47 sequences obtained from flies of the L. townsendi series. These genotypes formed two phylogenetic lineages (each supported by a bootstrap v alue of 67%). The L. youngi lineage (EF-yC/ V) contained all the genotypes from all indi v iduals of this series captured in Trujillo (the type locality of L. youngi in Venezuela) and in Mateguadua (Colombia); and, morphologically, all the males were L. youngi (Table 2). The L. townsendi lineage (EF-tC) contained all the genotypes from all the flies captured in both Versalles and Jiguales (Colombia); and, morphologically, all the males were L. townsendi s.s. The Cyt b genes were identified by homology to the nucleotide and deduced amino acid sequences of Anopheles gambiae (Beard et al., 1993). Each sequence consisted of a single open reading frame when translated with the mitochondrial genetic code of D. melanogaster , and this does not suggest a chromosomal origin for any of the amplified fragments. The analysis excluded L. o v allesi and L. e v ansi , because of the large genetic distances (unpublished data) between their Cyt b sequences and those of the L. townsendi series. Analysis of the latter was based on 426 nucleotides near the 3 ? end of the Cyt b gene (without the primers) and, following the outcome of the EF-alpha analysis, L. columbiana was used as an outgroup. The alignment of the 105 v ariant characters is gi v en in Fig. 4. Thirty-one nucleotide characters were diagnostic for the single haplotype of L. columbiana , with eight of the changes being non-synonymous. Twenty-eight out of these 31 nucleotide positions also had fixed polymorphisms diagnostic for the L. townsendi series. A further 48 v ariant nucleotide positions characterized the 25 haplotypes (or unique sequences) obtained from the 47 specimens of this series (Fig. 4), and this v ariation is analyzed further in Sections 3.6 and 3.7. Of the 105 v ariant characters, 53 were informa- ti v e in MP analyses. A branch and bound search found 24 most parsimonious trees of 149 steps (CI 0 / 0.6458, HI 0 / 0.3542, RCI 0 / 0.7135). The Cyt b phylogeny was largely congruent with that gi v en by EF-alpha (Fig. 3). There were two main lineages: the L . youngi lineage (97% bootstrap support) included the haplotypes of all flies from Venezuela and most flies from Mateguadua; and the L . townsendi lineage (100% bootstrap support) mostly contained the haplotypes of flies from Versalles and Jiguales, Colombia. The Cyt b and EF-alpha phylogenies differed in two ways. First, the Cyt b lineage of L . youngi formed two distinct sub-lineages, representing the populations from ...
Context 4
... purified with glassmilk (Geneclean II, Bio 101, Inc.). One-hundred-nanogram of each purified DNA sample was cycle-sequenced using an ABI Prism † Big Dye TM Terminator Cycle Sequencing Ready Reaction Kit ( v ersion 2.0), with 3.2 pmol of the same primers that were used for PCR, except for primer CB1-SE which was replaced by CB1 5 ? - 3 ? TATGTACTACCATGAGGACAAATATC (Esseghir, 1998). Unless stated otherwise, PCR products from each fly were sequenced on both strands for both primer sets. Sequencing reactions were performed in a PE-GeneAmp † PCR system 9700 (0.2 ml block). Cycling conditions were: an initial denaturation step at 96 8 C for 2 min; 35 cycles of 96 8 C for 15 s, 50 8 C for 15 s and 60 8 C for 4 min; followed by cooling to 4 8 C (Applied Biosystems protocol). Purification of the extension products was carried out using the ethanol precipitation method, and sequences were resol v ed using the ABI 373A or 377 system, all according to ABI protocols (PE Applied Biosystems). All sequences were aligned and edited using Sequencher TM 3.1.1 software (Gene Codes Cor- poration). PAUP* 4.0b7 software was used to in v estigate phylogenetic relationships by parsimony analysis and to produce genetic distance tables (Swofford, 2001). Trees were produced using a branch and bound search (with equal character weighting), and the le v el of support for each branch was estimated using bootstrap analysis with heuristic searches (100) to produce a consensus tree. The latter was used because the branch and bound algorithm could not quickly resol v e the relationships within terminal clades. The EF-alpha sequences were determined from PCR products containing the two alleles from each fly, and consequently the alleles were not unambiguously resol v ed at some sites in heterozygous indi v iduals (Fig. 2). Howe v er, the membership of the different lineages did not change when the phylogenetic analyses were performed either with ambiguous sites or with the alternati v e alleles that could be inferred. L. columbiana was collected from Versalles and Jiguales, the two sites on the eastern flank of the western cordillera of the Andes (Fig. 1). In these collections (Table 1), this was the only member of the L. v errucarum series, the males of which ha v e two basal spines inserted at the same le v el on each style of the external genitalia (Young and Duncan, 1994). All three sites contained members of the L. townsendi series, including males which were recognized by the presence of a single, isolated basal spine on each style (Young and Duncan, 1994). Based on the structure and setation of the central lobe (or paramere) of the external genitalia, all 12 males collected in Mateguadua, situated on the western flank of the central cordillera of the Andes (Fig. 1), were L. youngi . In contrast, all fi v e males from Versalles and Jiguales were L. townsendi sensu stricto. The analysis was based on an alignment of 582 nucleotides, all PCR products from all specimens being of this size (fragment without primers). Each sequence consisted of a single open reading frame, and this fragment of uninterrupted exon (there was no intron) had high homology with the EF-alpha amino acid sequences of Drosophila melanogaster and sandflies of the genus Phlebotomus (90.2 Á / 98.5%) (Esseghir, 1998). Considering all fi v e morphospecies studied, 18 genotypes (or unique sequences) were obtained, and the alignment of the 57 v ariant nucleotide characters is gi v en in Fig. 2. Comparisons between all morphospecies showed polymorphic nucleotide sites occurring mostly at third-base positions in codons (53 out of 57), 51 of which were synonymous. Fi v e out of the six non-synonymous changes were fixed polymorphisms, diagnostic for L. columbiana (nucleotide position 151), L. o v allesi (nucleotide positions 331 Á / 333) or L. e v ansi (nucleotide position 396). Of the 51 synonymous changes (Fig. 2), many were fixed polymorphisms diagnostic for the species: six for L. o v allesi , se v en for L. e v ansi , 11 for L. columbiana , and nine for the L. townsendi series (nucleotide positions 18, 27, 147, 177, 195, 225, 303, 519, 558). Variation within the latter series is reported in Sections 3.6 and 3.7. Phylogenetic analysis included all genotypes in the L. townsendi series (two morphospecies recognized from the males) and in the L. v errucarum series (three morphospecies recognized). Of the latter, L. o v allesi was selected as the outgroup because its genotypes were genetically more distant from those of the L. townsendi series (see Section 3.6). Of the 57 v ariant characters, 54 were infor- mati v e in maximum parsimony (MP) analyses. A branch and bound search found 384 most parsimonious trees of 66 steps (consistency index excluding constant characters (CI) 0 / 0.9365, homoplasy index excluding constant characters (HI) 0 / 0.0635, rescaled consistency index (RCI) 0 / 0.9220). MP analysis unambiguously identified (with a bootstrap support of 100%) the genotypes of L. columbiana as forming the sister group to those of the monophyletic L. townsendi series (Fig. 3). Nine EF-alpha genotypes were identified among the 47 sequences obtained from flies of the L. townsendi series. These genotypes formed two phylogenetic lineages (each supported by a bootstrap v alue of 67%). The L. youngi lineage (EF-yC/ V) contained all the genotypes from all indi v iduals of this series captured in Trujillo (the type locality of L. youngi in Venezuela) and in Mateguadua (Colombia); and, morphologically, all the males were L. youngi (Table 2). The L. townsendi lineage (EF-tC) contained all the genotypes from all the flies captured in both Versalles and Jiguales (Colombia); and, morphologically, all the males were L. townsendi s.s. The Cyt b genes were identified by homology to the nucleotide and deduced amino acid sequences of Anopheles gambiae (Beard et al., 1993). Each sequence consisted of a single open reading frame when translated with the mitochondrial genetic code of D. melanogaster , and this does not suggest a chromosomal origin for any of the amplified fragments. The analysis excluded L. o v allesi and L. e v ansi , because of the large genetic distances (unpublished data) between their Cyt b sequences and those of the L. townsendi series. Analysis of the latter was based on 426 nucleotides near the 3 ? end of the Cyt b gene (without the primers) and, following the outcome of the EF-alpha analysis, L. columbiana was used as an outgroup. The alignment of the 105 v ariant characters is gi v en in Fig. 4. Thirty-one nucleotide characters were diagnostic for the single haplotype of L. columbiana , with eight of the changes being non-synonymous. Twenty-eight out of these 31 nucleotide positions also had fixed polymorphisms diagnostic for the L. townsendi series. A further 48 v ariant nucleotide positions characterized the 25 haplotypes (or unique sequences) obtained from the 47 specimens of this series (Fig. 4), and this v ariation is analyzed further in Sections 3.6 and 3.7. Of the 105 v ariant characters, 53 were informa- ti v e in MP analyses. A branch and bound search found 24 ...
Context 5
... we report on the identities of the vectors of Le. braziliensis in the Department of Valle del Cauca, southwest Colombia (Fig. 1). These were identified as L. townsendi (Ortiz) by Warburg et al. (1991), but as L. youngi Feliciangeli and Murillo, 1987 (another member of the L. townsendi series) in later reports by Alexander and Usma (1994), Alexander et al. ...
Context 6
... are given in Table 1 and Fig. 1. Three collection sites were used in Valle del Cauca, all located on the lower slopes (1150 Á/1800 m a.s.l.) of the valley of the River Cauca, which runs north- wards between the western and central cordilleras of the Andes. This is a region where much tropical forest was cleared in the last century, to make way for plantations of ...
Context 7
... columbiana was collected from Versalles and Jiguales, the two sites on the eastern flank of the western cordillera of the Andes (Fig. 1). In these collections (Table 1), this was the only member of the L. verrucarum series, the males of which have two basal spines inserted at the same level on each style of the external genitalia ( Young and Duncan, ...
Context 8
... series, including males which were recognized by the presence of a single, isolated basal spine on each style (Young and Duncan, 1994). Based on the structure and setation of the central lobe (or paramere) of the external genitalia, all 12 males collected in Mateguadua, situated on the western flank of the central cordillera of the Andes ( Fig. 1), were L. youngi . In contrast, all five males from Versalles and Jiguales were L. town- sendi sensu ...
Citations
... One of these sandflies was Pintomyia youngi, which is a confirmed vector of L. braziliensis, and a potential vector of L. amazonensis. Due to difficulty in taxonomic identification procedures, Pintomyia youngi could have been misidentified as Lutzomyia townsendi [31,101,102], which means that covariate and/or vector status data might be assigned to the wrong species. This can lead to misrepresentation in the model (that already relies on sparse data), which might explain the low probability score assigned to Pintomyia youngi. ...
The incidence of vector-borne diseases is rising as deforestation, climate change, and globalization bring humans in contact with arthropods that can transmit pathogens. In particular, incidence of American Cutaneous Leishmaniasis (ACL), a disease caused by parasites transmitted by sandflies, is increasing as previously intact habitats are cleared for agriculture and urban areas, potentially bringing people into contact with vectors and reservoir hosts. Previous evidence has identified dozens of sandfly species that have been infected with and/or transmit Leishmania parasites. However, there is an incomplete understanding of which sandfly species transmit the parasite, complicating efforts to limit disease spread. Here, we apply machine learning models (boosted regression trees) to leverage biological and geographical traits of known sandfly vectors to predict potential vectors. Additionally, we generate trait profiles of confirmed vectors and identify important factors in transmission. Our model performed well with an average out of sample accuracy of 86%. The models predict that synanthropic sandflies living in areas with greater canopy height, less human modification, and within an optimal range of rainfall are more likely to be Leishmania vectors. We also observed that generalist sandflies that are able to inhabit many different ecoregions are more likely to transmit the parasites. Our results suggest that Psychodopygus amazonensis and Nyssomia antunesi are unidentified potential vectors, and should be the focus of sampling and research efforts. Overall, we found that our machine learning approach provides valuable information for Leishmania surveillance and management in an otherwise complex and data sparse system.
... (Esseghir et al., 2000), the population genetics of Ph. ariasi (Mahamdallie et al., 2011), and the molecular identification of Ph. (Larroussius) spp. and Pintomyia (Pifanomyia) spp. of the Townsendi series (Testa et al., 2002;Absavaran et al., 2009). ...
The taxonomy and systematics of sand flies (Diptera, Psychodidae, Phlebotominae) are one of the pillars of research aimed to identifying vector populations and the agents transmitted by these insects. Traditionally, the use of morphological traits has been the main line of evidence for the definition of species, but the use of DNA sequences is useful as an integrative approach for their delimitation. Here, we discuss the current status of the molecular taxonomy of sand flies, including their most sequenced molecular markers and the main results. Only about 37% of all sand fly species have been processed for any molecular marker and are publicly available in the NCBI GenBank or BOLD Systems databases. The genera Phlebotomus, Nyssomyia, Psathyromyia and Psychodopygus are well-sampled, accounting for more than 56% of their sequenced species. However, less than 34% of the species of Sergentomyia, Lutzomyia, Trichopygomyia and Trichophoromyia have been sampled, representing a major gap in the knowledge of these groups. The most sequenced molecular markers are those within mtDNA, especially the DNA barcoding fragment of the cytochrome c oxidase subunit I (coi) gene, which has shown promising results in detecting cryptic diversity within species. Few sequences of conserved genes have been generated, which hampers higher-level phylogenetic inferences. We argue that sand fly species should be sequenced for at least the coi DNA barcoding marker, but multiple markers with different mutation rates should be assessed, whenever possible, to generate multilocus analysis.
... These data documented the power of ITS2 loci in the differentiation of these two morphotypes, too. CytB-NADH1 and especially EF-1α showed more diversity even at intraspecific level (Testa et al. 2002, Sonnenberg et al. 2007), but the ribosomal marker is much more conserved and it is worthy that ITS2 could separate these two morphotypes from each other. The proximity of GenBank sequences of P. neglectus to our morphotypes showed more support for the existence of this species in Iran. ...
The idea of the existence of Phlebotomus (Larroussius) neglectus (Diptera: Psychodidae) Tonnoir, 1921 in Iran and the skepticism about the existence of Phlebotomus major s.str. Annandale, 1910 had been grown recently in the country. This study reports a combined analysis of mitochondrial and ribosomal DNA target regions of P. major s.l.Annandale, 1910, specimens collected from different parts of Iran. Two different morphotypes were found among the collected samples based on the shape of the aedeagus, ventrally located hairs of the coxite, and parameral sheets. One morphotype seemed similar to P. neglectus Tonnoir 1921 or P. major krimensis Perfiliv1966 (called here MI.N.K.); the other one was similar to P. neglectus and to some extent to P. notus Artemiev & Neronov 1984 (here called MII.N.NO). Cytochrome B, elongation factor 1-alpha, and internal transcribed spacer II loci were amplified, sequenced, and characterized. High sequence homology (98-100%) was observed between P. neglectus and these morphotypes, and phylogenetic analysis was also concordant. Phlebotomus neglectus sequences available in GenBank are located as the sister group of sequences here, particularly near to morphotype MII.N.NO. Moreover, ITS2 locus provides the maximum resolution for differentiation of two morphotypes. Based on achieving results, although a strong support for the presence of P. neglectus was provided, but it is too early to say that P. major s.str. does/does not exist in Iran. This question could be resolved by studying more samples and, most importantly, by comparing the topotypes of P. neglectus and P. major s. str. if possible in the future.
... Sand flies were not directly targeted however, those flies in malaria endemic areas in the dry zone, which covers two-thirds of the country may have been regularly exposed to insecticides [9]. The presence of kdr mutation which is located at the position of 1014 with the amino acid changes from leucine to phenylalanine in a notable proportion of flies in Sri Lanka [10] will spread from one population to another by means of gene flow in sand flies similar to the case of mosquitoes [11][12][13][14]. ...
Phlebotomus argentipes is the vector of Leishmania donovani which causes the disease leishmaniasis, a neglected tropical disease and a growing health problem in Sri Lanka. A proper understanding of the population genetic structure of sand fly vectors is considered important prior to planning and implementation of a successful vector control program. Thus, the present study was conducted to determine the population genetic structure of sand fly vectors in Sri Lanka. Two mitochondrial genes namely Cytochrome c oxidase subunit 1 (Cox 1) and Cytochrome b (Cytb), and the internal transcribed spacer 2 (ITS2) region from the nuclear ribosomal DNA were used for molecular characterization. Analyses included maximum likelihood method, network analysis and DNA polymorphisms. The outcome revealed unique sequences of all genomic regions studied except the cox 1 gene had a relationship with sand flies isolated previously from Sri Lanka, India and Israel and cytb gene of 4 sand flies that aligned with those isolated earlier from Sri Lanka and 3 from Madagascar. Furthermore, cox 1 gene and ITS 2 region analyses based on FST values indicated a possible gene flow between the study sites whereas cytb gene analysis favoured the existence of genetically distinct populations of P. argentipes in each of the study sites. Poor population differentiation of P. argentipes, a possible consequence of a gene flow, is indeed of concern due to the risk imposed by promoting the spread of functionally important phenotypes such as insecticide resistance across the country, making future vector control efforts challenging.
... Finally, (iii): migration of animal reservoirs or sand fly vectors responsible for transmission of the parasite within the national territory. L. braziliensis is associated with a wide variety of sand fly vectors (Bejarano et al., 2002;Testa et al., 2002;Ovallos et al., 2013;Ovalle-Bracho et al., 2019). Another interesting finding was associated with the clear swapping event (incongruence in the tree topologies) identified in clade 4, when tree topology of nuclear genome was compared with the mitochondrial genome (Figure 1 and Supplementary Figure S1). ...
Leishmania (Viannia) braziliensis is an important Leishmania species circulating in several Central and South American countries. Among Leishmania species circulating in Brazil, Argentina and Colombia, L. braziliensis has the highest genomic variability. However, genomic variability at the whole genome level has been only studied in Brazilian and Peruvian isolates; to date, no Colombian isolates have been studied. Considering that in Colombia, L. braziliensis is a species with great clinical and therapeutic relevance, as well as the role of genetic variability in the epidemiology of leishmaniasis, we analyzed and evaluated intraspecific genomic variability of L. braziliensis from Colombian and Bolivian isolates and compared them with Brazilian isolates. Twenty-one genomes were analyzed, six from Colombian patients, one from a Bolivian patient, and 14 Brazilian isolates downloaded from public databases. The results obtained of Phylogenomic analysis showed the existence of four well-supported clades, which evidenced intraspecific variability. The whole-genome analysis revealed structural variations in the somy, mainly in the Brazilian genomes (clade 1 and clade 3), low copy number variations, and a moderate number of single-nucleotide polymorphisms (SNPs) in all genomes analyzed. Interestingly, the genomes belonging to clades 2 and 3 from Colombia and Brazil, respectively, were characterized by low heterozygosity (~90% of SNP loci were homozygous) and regions suggestive of loss of heterozygosity (LOH). Additionally, we observed the drastic whole genome loss of heterozygosity and possible hybridization events in one genome belonging to clade 4. Unique/shared SNPs between and within the four clades were identified, revealing the importance of some of them in biological processes of L. braziliensis. Our analyses demonstrate high genomic variability of L. braziliensis in different regions of South America, mainly in Colombia and suggest that this species exhibits striking genomic diversity and a capacity of genomic hybridization; additionally, this is the first study to report whole-genome sequences of Colombian L. braziliensis isolates.
... Traditionally, in large-scale field studies collected specimens are often killed and preserved in ethanol, prior to DNA extraction [3,9]. Ethanol is generally suitable for DNA analysis [31] and it has been suggested that 99% ethanol can also be used for molecular studies allowing a viral genome RNA identification [4]. While the long-term use of 70% ethanol may eventually affect the identification phlebotomine sand flies [6,10], in our experience, Table 1 Mean concentration (ng/µl) and 260/280 purity ratios of DNA extracts obtained from phlebotomine sand flies according to different preservation methods and storage times. ...
... PCR success (positive/total and percentage) for the mitochondrial cytochrome c oxidase subunit 1 (cox1) and cacophony (CAC ) genes is also shown Abbreviations: T1, < 12 h; T2, 3 months; T3, 6 months; T4, 9 months; T5, 12 months this is not usually a problem when examining slidemounted specimens that have been preserved in 70% ethanol at room temperature for some months or even a year. Another limitation of 70% ethanol is that it cannot be employed for preserving samples for isoenzyme analysis [31]. In this case, phlebotomine sand flies should be kept alive, stored at temperatures below − 40 °C (e.g. ...
... In this case, phlebotomine sand flies should be kept alive, stored at temperatures below − 40 °C (e.g. − 80 °C) or cryopreserved [31,32]. The storage time had no negative effect on the DNA concentration in any of the preservation methods used herein. ...
Background:
Different methods have been used to preserve phlebotomine sand flies for research purposes, including for taxonomic studies and detection of Leishmania spp. Here, we evaluated the effect of various preservation methods at different storage times on phlebotomine sand fly DNA concentration and purity.
Methods:
Field-collected phlebotomine sand flies were individually stored in 70% ethanol (G1) and 95% ethanol (G2) at room temperature, 70% ethanol (G3) and 95% ethanol (G4) at 8 °C or frozen dry (i.e. no preservation solution) at - 20 °C (G5). DNA concentration and purity were assessed at various storage times (T1, ≤ 12 h; T2, 3 months; T3, 6 months; T4, 9 months; and T5, 12 months). Fragments of the cytochrome c oxidase subunit 1 (cox1) and cacophony (CAC) genes of phlebotomine sand flies were also amplified.
Results:
Mean DNA concentration (P = 0.178) and 260/280 purity ratios (P = 0.584) did not vary significantly among various preservation methods and storage times. Within each group, DNA concentration varied in G1 (Kruskal-Wallis H-test, P = 0.009) for T3 vs T4 (Dunn's post-hoc, P < 0.05), and in G2 (Kruskal-Wallis H-test, P = 0.004) for T1 vs T2 and T1 vs T4 (Dunn's post-hoc, P < 0.05). For 260/280 purity ratios, the only statistically significant difference was found for G5 (Kruskal-Wallis H-test, P = 0.020) between T1 vs T4 (Dunn's post-hoc test, P < 0.05). The cox1 and CAC genes were successfully amplified, regardless of the preservation method and storage time; except in one sample from G2 at T1, for which the CAC gene failed to amplify.
Conclusions:
The preservation methods and storage times herein evaluated did not affect the concentration and purity of DNA samples obtained from field-collected phlebotomine sand flies, for up to 12 months. Furthermore, these preservation methods did not interfere with PCR amplification of CAC and cox1 genes, being suitable for molecular analyses under the conditions studied herein.
... However, uncertainties about the taxonomic resolution of certain groups are common as morphological identification is based on gender-specific morphological traits. This makes identification often difficult because of isomorphism among phlebotomine sand fly of different species of the same sex, and because of the presence of species complexes (Cohnstaedt et al., 2011;Hebert, Cywinska, Ball, & de Waard, 2003;Testa, Montoya-Lerma, Cadena, Oviedo, & Ready, 2002). Furthermore, ecological niche modeling has suggested incongruency in vectors and disease distributions in Mexico (González et al., 2010), necessitating a review of vector identification techniques. ...
Abstract Leishmaniasis, a vector‐borne disease transmitted to humans through the bite of phlebotomine sand flies, is of public health significance in southeastern Mexico. Active and continuous monitoring of vectors is an important aspect of disease control for the prediction of potential outbreaks. Thus, the correct identification of vectors is paramount in this regard. In this study, we employed DNA barcoding as a tool for identifying phlebotomine sand flies collected in localized cutaneous leishmaniasis endemic areas of Quintana Roo, Mexico. Specimens were collected using CDC light and Shannon traps as part of the Mexican Ministry of Health surveillance program. DNA extraction was carried out using a nondestructive protocol, and morphological identification based on taxonomic keys was conducted on slide‐mounted specimens. Molecular taxonomic resolution using the 658‐bp fragment of the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene was 100% congruent with the morphological identification. Seven species were identified: Lutzomyia cruciata (Coquillett 1907), Lutzomyia longipalpis (Lutz & Neiva 1912), Psathyromyia shannoni (Dyar 1929), Dampfomyia deleoni (Fairchild & Hertig 1947), Dampfomyia beltrani/steatopyga (Vargas & Díaz‐Nájera 1951), Bichromomyia olmeca olmeca (Vargas & Díaz‐Nájera, 1959), and Brumptomyia mesai (Sherlock 1962). Mean intraspecific divergence ranged from 0.12% to 1.22%, while interspecific distances ranged from 11.59% to 19.29%. Neighbor‐joining (NJ) analysis using the Kimura 2‐parameter model also showed specimens of the same species to be clustered together. The study provides the first cox1 sequences for three species of sand flies and indicates the utility of DNA barcoding for phlebotomine sand flies species identification in southeastern Mexico.
... evandroi is the least likely of these scenarios. Although these species have sympatric distribution along the sampling locations (Rebêlo et al. 2010a,b), and this type of event has already been recorded in several groups of sand flies (e.g., Testa et al. 2002, Pesson et al. 2004, Mazzoni et al. 2006, Mazzoni et al. 2008, Ready 2011, Pinto et al. 2015, the fact that they did not form separate clades (Fig. 3) supports the hypothesis of recent divergence. However, if this divergence resulted from a recent speciation event, they may still be able to hybridize if the reproductive barriers are incomplete. ...
Sand fly (Diptera: Psychodidae) taxonomy is complex and time-consuming, which hampers epidemiological efforts directed toward controlling leishmaniasis in endemic regions such as northeastern Brazil. Here, we used a fragment of the mitochondrial cytochrome c oxidase I (COI) gene to identify sand fly species in Maranhão State (northeastern Brazil) and to assess cryptic diversity occurring at different spatial scales. For this, we obtained 148 COI sequences of 15 sand fly species (10 genera) from Maranhão (fine spatial scale), and joined them to COI sequences from other Brazilian localities (distant about 2,000 km from Maranhão, broad spatial scale) available in GenBank. We revealed cases of cryptic diversity in sand flies both at fine (Lutzomyia longipalpis (Lutz and Neiva) and Evandromyia termitophila (Martins, Falcão and Silva)) and broad spatial scales (Migonemyia migonei (França), Pressatia choti (Floch and Abonnenc), Psychodopygus davisi (Root), Sciopemyia sordellii (Shannon and Del Ponte), and Bichromomyia flaviscutellata (Mangabeira)). We argue that in the case of Bi. flaviscutellata, the cryptic diversity is associated with a putative new species. Cases in which DNA taxonomy was not as effective as morphological identification possibly involved recent speciation and/or introgressive hybridization, highlighting the need for integrative approaches to identify some sand fly species. Finally, we provide the first barcode sequences for four species (Brumptomyia avellari (Costa Lima), Evandromyia infraspinosa (Mangabeira), Evandromyia evandroi (Costa Lima and Antunes), and Psychodopygus complexus (Mangabeira)), which will be useful for further molecular identification of neotropical species.
... Concerning our sampling, interspecific divergence of EF-1a between Ph. riouxi and Ph. chabaudi was 1.15% (SD = 0.53%), and intraspecific divergences were 0 and 0.009%, respectively, corresponding to normal values for this marker [43]. ...
... The nuclear EF-1a is known to be a good phylogenetic marker in Metazoa [37] and was previously used in several molecular studies in Phlebotomine sandflies [1,16,18,29,43]. Its utility in other groups has also been demonstrated in heliothine moths [8] and in Triatominae [14]. ...
... We selected this marker to compare our data with those of Tabbabi et al. [41]. Several studies successfully compared haplotypes of EF-1a [41,44], although EF-1a also showed considerable diversity of haplotypes for a same specimen, thus complicating the analyses [29,43]. In the present study, we also noted significant haplotype diversity. ...
Phlebotomus riouxi Depaquit, Killick-Kendrick & Léger 1998 was described as a species closely related to Phlebotomus chabaudi Croset, Abonnenc & Rioux 1970, differing mainly by the size and number of setae of the coxite basal lobe. Molecular studies carried out on several populations from Algeria and Tunisia and based on mitochondrial genes cytochrome b (Cytb) and cytochrome oxidase I (COI) supported the typological validity of these two species. Recently, specimens from a single population in southern Tunisia were morphologically identified as Ph. riouxi, Ph. chabaudi and intermediates, but were clustered in the same clade according to their Cytb and nuclear gene elongation factor-1 α (EF-1α) sequences. These species were thus synonymized. To further explore this synonymy, we carried out a molecular study on specimens from Algeria and Tunisia using the same molecular markers and a part of 28S rDNA. We did not find any morphologically intermediate specimens in our sampling. We highlighted differences between the genetic divergence rates within and between the two species for the three markers and we identified new haplotypes. The sequence analysis did not reveal any signature of introgression in allopatric nor in sympatric populations such as in the Ghomrassen population. Phylogenetic analyses based on our specimens revealed that the two main clades are Ph. chabaudi and Ph. riouxi, in agreement with the morphological identification. These results support the validity of Ph. riouxi and Ph. chabaudi as typological species.
... Currently, molecular methods are extensively used to study Leishmania infection in wildcaught sandflies [36][37][38][39]. kDNA-real time PCR is known to be highly sensitive [40,41] whereas the ITS1 sequencing allows Leishmania species identification with high specificity [42]. ...
Phlebotomus perniciosus is one of the major vectors of Leishmania infantum in the Mediterranean basin. The aim of this work was (i) to provide information about abundance and temporal dynamics of this Larroussius species in a hot spot area of visceral leishmaniasis in Tunisia, (ii) to detect L. infantum DNA in wild caught female sandflies and (iii) to measure Phlebotomus perniciosus infection rate throughout the active season. Sandflies were collected monthly during one year using CDC miniature light-traps in house and in animal shelters. Male specimens were identified at species level according to morphological characters. Female specimens were conserved individually for molecular study. Leishmania infection was tested by kinetoplast DNA real-time PCR and ITS-1 PCR-sequencing. Subsequent sandfly species identification of infected specimens was done by mitochondrial cytochrome b sequencing. In one year period, overall 4,441 specimens (2230 males and 2211 females) were collected. Sandfly activity started in end-April and ended in early-November. Mean sandfly density in house was significantly lower than in animal shelters (51 ± 50 versus 504 ± 460 sandflies /CDC night, p
