Table 2 - uploaded by Pierre Lacasse
Content may be subject to copyright.
Source publication
Staphylococcus aureus is a significant pathogen frequently causing persistent intramammary infections (IMI) in dairy cows. We compared some genotypic and phenotypic characteristics of 285 strains collected from quarter milk samples from cows with persistent and nonpersistent subclinical IMI across Canada. Variable number of tandem repeats typing wa...
Contexts in source publication
Context 1
... distribution of the 4 superantigen-encoding genes investigated among the different groups of strains (SUB-P, SUB-NP, DC-P, DC-NP) is reported in Table 2. Statistical analysis (logistic regression, adjusted for province of sampling as well as for clustering between herds) for strains recovered during lactation revealed that the presence of the gene seg is associated with a reduction in the possibility that the bacteria persist by 66% [odds ratio (OR) = 0.34, 95% CI: 0.14-0.85, ...
Similar publications
The dry period is acknowledged as playing a key role in mastitis epidemiology and yet surprisingly few studies have explored dry period infection dynamics in detail. The aim of this study was to investigate the dynamics of intramammary infection across a cohort of dairy herds in Europe. Five hundred and twenty-two cows were recruited from 12 farms...
Citations
... In S. aureus, the extracellular matrix is composed mainly of the polysaccharide intercellular adhesin (PIA) and microbial surface components recognizing adhesive matrix molecules (MSCRAMMs), which are required in the adhesion step of biofilm formation [7]. Studies have described the important role of biofilms in the persistence and resistance of S. aureus in the bovine mammary gland [8,9]. Veh et al. (2015) demonstrated that strains with phenotypes of strong biofilm formation are likely to persist during the dry period. ...
... Studies have described the important role of biofilms in the persistence and resistance of S. aureus in the bovine mammary gland [8,9]. Veh et al. (2015) demonstrated that strains with phenotypes of strong biofilm formation are likely to persist during the dry period. Moreover, a 3-year longitudinal study from a single dairy herd revealed that strains producing a larger quantity of biofilm/poly-N-acetylglucosamine (PNAG) had higher prevalence and persistence within the host [9]. ...
Bovine mastitis is a costly disease in the dairy sector worldwide. Here the objective was to identify and characterize anti-biofilm compounds produced by Bacillus spp. against S. aureus associated with bovine mastitis. Results showed that cell-free supernatants of three Bacillus strains (out of 33 analysed) reduced S. aureus biofilm formation by approximately 40 % without affecting bacterial growth. The anti-biofilm activity was associated with exopolysaccharides (EPS) secreted by Bacillus spp. The EPS decreased S. aureus biofilm formation in a dose-dependent manner, inhibiting biofilm formation by 83 % at 1 mg/mL. The EPS also showed some biofilm disruption activity (up to 36.4 %), which may be partially mediated by increased expression of the aur gene. The characterization of EPS produced by Bacillus velezensis 87 and B. velezensis TR47II revealed macromolecules with molecular weights of 31.2 and 33.7 kDa, respectively. These macromolecules were composed mainly of glucose (mean = 218.5 μg/mL) and mannose (mean = 241.5 μg/mL) and had similar functional groups (pyranose ring, beta-type glycosidic linkage, and alkynes) as revealed by FT-IR. In conclusion, this study shows the potential applications of EPS produced by B. velezensis as an anti-biofilm compound that could contribute to the treatment of bovine mastitis caused by S. aureus.
... However, when negative control was compared to S. aureus-derived cases, higher MPFF doses showed no better results for all parameters, especially at lower and medium MPFF doses. It is believed that the lack of cure during the dry-off period is related to the intracellular accumulation of S. aureus within leukocytes; however, intermittent and cyclical shedding of S. aureus frequently occurs [90,91]. Therefore, the MPFF use was beneficial in S. aureus-derived cases but not fully effective. ...
Simple Summary
Infectious mastitis causes significant economic losses and affects dairy cattle health and welfare. The present research aimed to test an intramammary-infused therapeutic compound to promote sustained mastitis treatment and improve cure rates in dairy cattle. The effects of intramammary infusion of micronised purified flavonoid fraction (MPFF) were studied as a natural alternative to conventional synthetic antimicrobials and against antimicrobial resistance in mastitis-diagnosed dairy cows infected by Staphylococcus spp. in the late lactation.
Abstract
Infectious mastitis is the most prevalent health problem in dairy cattle that can result in permanent economic losses on dairy farms. The micronised purified flavonoid fraction (MPFF) is a biocompatible active polyphenolic compound derived from flavonoid glycosides which exhibits several antimicrobial, anti-inflammatory, and phlebotonic properties. The goal was to assess the effects of an alternative therapy for mastitis based on MPFF intramammary infusions in late lactation in dairy cows naturally infected by Staphylococcus spp. The California Mastitis Test (CMT scores) was performed to detect mastitis-positive quarters in twelve dairy farms. All cows were screened for immune response by measuring somatic cell counts (SCCs; cells/mL) in milk samples from each quarter. In addition, bacteriological identification, pathogenic bacterial isolates, and total bacterial counts (TBCs; CFU/mL) were assessed before (day 0, last milking day) and after (day 3 post-calving) MPFF application. Antimicrobial sensitivity patterns of the pathogenic isolated bacteria were evaluated. Finally, cure rates (%) were determined for each MPFF treatment. Around 15 mastitis-related genera were isolated. Staphylococcus aureus (25.2%) and coagulase-negative Staphylococci (CNS; 22.4%) were the most prevalent pathogens. No statistical differences were observed in SCCs and TBCs after low, medium, and high MPFF dose administration in S. aureus-positive mastitis cases (p > 0.05). However, differences were observed in SCCs and TBCs after medium and high MPFF dose administration in CNS-positive quarters (p < 0.05). The pathogenic bacteria isolate reduction after MPFF applications showed a dose-response fashion (p < 0.01) while isolates obtained from controls and low MPFF-treated quarters remained similar, irrespective of the pathogen (p > 0.05). Sensitivity patterns were variable, although S. aureus remained resistant, irrespective of the MPFF dose. However, CNS showed a dose-response sensitivity pattern. Finally, the cure rate (%) on day 3 post-partum improved significantly using medium and higher MPFF doses in CNS-positive quarters (p < 0.05). In conclusion, MPFF treatment was found to be more effective for CNS-positive cases in the late lactation due to noticeable dose-specific responses regarding somatic cells, bacterial counts, sensitivity patterns, and cure rates in dairy cattle.
... Molecular studies are fundamental because they provide epidemiological information and knowledge regarding pathogenicity mechanisms, making it possible to understand the association of these mechanisms with the microorganism virulence profile (Veh et al. 2015, Ren et al. 2020. Our study demonstrated different virulence profiles for S. aureus strains involved in chronic SM. ...
... Similar to our findings, Zaatout et al. (2019) found a high diversity of MSCRAMMs genes (12 out of 14 genes), such as clfA, clfB, ebpS, eno, fnbA, fnbB, and bbp. This diversity in virulence factors, and their different combinations, can cause changes in the level of pathogenicity and the spread of infections among dairy cows inside or across herds (Veh et al. 2015). Furthermore, Gogoi-Tiwari et al. (2015) found a difference in the rates of fnbA and fnbB genes. ...
... Then again, the nonassertive antibiotic might cause variability in S. aureus resistance profiles, as evidenced by the results obtained in this study. Furthermore, there is a risk of exchanging clones among humans and animals since they adapt to the host and acquire virulence factors to colonize and generate new infections (Veh et al. 2015). In our study, S. aureus isolates harboured the β-lactamase gene blaZ, indicative of penicillin resistance, at an alarming frequency (94.7%). ...
Aims:
Staphylococcus aureus is one of the most common pathogens associated with mastitis in dairy herds worldwide. This study evaluated the profile of virulence and antimicrobial resistance genes of spa type t605 methicillin-susceptible Staphylococcus aureus isolated from subclinical bovine mastitis in São Paulo, Brazil.
Methods and results:
Fifty-seven S. aureus strains were screened by conventional PCR for 49 virulence genes. The most prevalent virulence genes detected were icaD (94.7%), fib (93%), fnbA (82.5%), clfA (80.7%), bap (78.9%), clfB (73.7%), icaA (66.7%), see (64.9%), and sed (61.4%). The blaZ (94.7%), aac6'aph2' (15.8%), and ant4 (12.3%) genes were the most common antimicrobial resistance genes; however, mecA and mecC genes were not found. All methicillin-susceptible S. aureus (MSSA) strains were characterised through spa and agr typing. The spa type t605 was found in all isolates. By agr typing, the most prevalent were type II (56.1%). Antimicrobial resistance was determined by the disk diffusion method, and 93% showed resistance to at least one antibiotic. Penicillin resistance was the most prevalent (87.7%), followed by tetracycline (12.3%), oxacillin (10.5%), and gentamicin (10.5%) resistance.
Conclusion:
Our study confirmed the spa type t605 as endemic, carrying a wide variety of virulence factors and high-level penicillin resistance. The profile seems to be associated with the colonisation of MSSA and its persistence in subclinical mastitis.
... spa AGCACCAAAAGAGGAAGACAA GTTTAACGACATGTACTCCGT [19] fema TGCCTTTACAGATAGCATGCCA AGTAAGTAAGCAAGCTGCAATGACC [20] pta AGAAGCAATCATTGATGGCGA ACCTGGCGCTTTTTTCTCAG [21] gapdH TGACACTATGCAAGGTCGTTTCAC TCAGAACCGTCTAACTCTTGGTGG [22] rpoB CAGCTGACGAAGAAGATAGCTATGT ACTTCATCATCCATGAAACGACCAT [23] 16s AGAGATAGAGCCTTCCCCTT TTAACCCAACATCTCACGACA [24] ...
Reference genes are frequently used for the normalization of quantitative reverse transcriptase PCR (qRTPCR) data in gene expression studies. Staphylococcus aureus is one of the most common causes of biofilm-related infections. Savirin and ticagrelor show in vitro as well as in vivo antibiofilm activity against S. aureus. The main aim of this study was to identify the most stably expressed reference genes to study the effect of these molecules on genes in a strong biofilm producing S. aureus isolate isolated from biofilm-related infection. Quantitative real-time PCR was performed by using relative quantification method. Four different algorithms, delta Ct, normfinder, bestkeeper, and genorm, followed by a comprehensive analysis was used to identify the most stable reference genes from a list of sixteen different candidate reference genes. All four algorithms reported different results, with some comparable findings among some methods. In the comprehensive analysis of the results of all the algorithms used, the most stable reference genes found were spa, rpoD, and pyk for savirin treatment experiment and gapdH, gyrA, and gmk for ticagrelor treatment experiment. The optimal number of reference genes required was two for both the experimental conditions. Despite having some drawbacks, each algorithm can reliably determine an appropriate reference gene independently. However, based on consensus ranking and the required optimal number of reference genes reported, spa and rpoD were the most appropriate reference genes for savirin treatment experiment, and gapdH and gyrA were most appropriate for ticagrelor treatment experiment. This study provides baseline data on reference genes to study the effect of savirin or ticagrelor treatment on the expression of potential reference genes in S. aureus. We recommend prior re-validation of reference genes on a case-by-case basis before they can be used.
... Although t267 was the second most common genotype in our study, its frequency was lower (15.15%) than in other studies carried out in China, India, Sweden, and Canada, which ranged between 18% and 25% [9,[31][32][33]. In Canada, t267 is one of the more predominant genotypes [34]. ...
Genotyping of Staphylococcus aureus isolated from mastitis has become a fundamental tool to understand its complex epidemiology and to evaluate spillover events. The aim of this study was to describe the frequency of genotypes of the S. aureus strains isolated from intramammary infections by spa typing technique, and to evaluate the association between genotypes and the ability to form biofilm under in vitro conditions. Sixty-six strains of S. aureus recovered from bovines intramammary infections on 56 dairy herds located in 14 municipalities of the department of Antioquia were characterized. The majority of strains (65/66) were isolated from milk samples collected from dairy cows with subclinical intramammary infections. Nineteen different spa types were found in this study, t521 (19.70%), t267 (15.15%), and t605 (12.12%) being the most frequent. The strains from the t605 spa type showed the highest biofilm production. The high frequency of spa types with zoonotic potential found in this study, identified cattle as an important reservoir of theses clones for people in close proximity, such as milkers and consumers of unpasteurized dairy products.
... Staphylococcus aureus (MRSA) is known for causing intramammary infections in dairy cows, leading to significant milk losses, animal suffering and economic losses for the dairy industry [60]. Reducing its health impact is dependent on the capacity and the availability of solutions to impede biofilm formation and consequently reduce its capacity to fight antibiotics [61][62][63]. ...
Farm biosecurity management includes a set of practical measures used to prevent and limit the spread of infections to humans and animals. Infections, predominantly caused by zoonotic agents, often occur due to a lack of safety standards monitoring on farms, but also because of the use of inappropriate antimicrobial products leading to bacterial resistance, tolerance to biocides and the emergence antimicrobial-resistant germs. To date, research was mainly focused on studying the antimicrobial resistance in bacterial biofilms and the mechanisms involved in their occurrence. At molecular level, the limited diffusion of biocides in the biofilm matrix, enzyme-mediated resistance, genetic adaptation, efflux pumps, and levels of metabolic activity inside the biofilm are some of the investigated biological mechanisms which can promote antimicrobial resistance in biofilms were also investigated. Interventions, based on the identification of novel antimicrobial compounds, that would exclude the occurrence of bacterial tolerance, including essential oils (oregano, cloves), organic acids (tannic & oleic acid) and natural plant compounds (e.g. alkaloids, flavonoids, tannins and coumarins) were also extensively studied and reviewed given their effectiveness against pathogen-produced biofilms. The aim of this review was emphasize the importance of biosecurity and farm management practices and to assess their impact on bacterial biofilm formation. Furthermore, we present the recent intervention strategies aimed at reducing and combating the formation of bacterial biofilms in livestock farms.
... Biofilm can be involved in animal diseases such as bovine mastitis [45], characterized by settling in the animal through chronic manifestations and intermittent acute exacerbations when antibiotic therapy is used for its control [46]. It is well established that the ability of staphylococcal species to produce biofilm is a factor that affects the persistence of bacteria for long periods in the mammary gland and can result in chronic mastitis and reduce effectiveness of antimicrobial therapy [47,48]. ...
Background
Mastitis is one of the major diseases in dairy cattle, as it causes great economic losses to producers due to the reduction of milk production and changes in the quality of the product. The disease is mainly caused by bacteria of the genus Staphylococcus spp., these microorganisms can express various virulence factors, such as biofilms for example. In herds with organic management, producers and technicians use unconventional ways to treat and control the disease, such as homeopathy. However, it is not known if this type of treatment is able to control pathogenic bacteria such as those of the genus Staphylococcus , of relevance to animal and human health. Thus, the objective of this study was to investigate the production of biofilm in vitro and its genes by Staphylococcus spp. isolated in the milk of cows treated with homeopathy, as well as the persistence of microorganisms in animals.
Methods
Ninety-nine isolates of Staphylococcus spp. from cows treated and not treated with homeopathy were identified by internal transcribed space-polymerase chain reaction and investigated for the presence of the ica ABCD, bap , aap , atlE , and bhp genes and in vitro biofilm production using the adhesion method on polystyrene plates. The enzyme restriction profile was determined by Pulsed-Field Gel Electrophoresis. Clusters of S. aureus and S. epidermidis with three or more isolates had an isolate selected for Multilocus Sequence Typing.
Results
The frequency of S. aureus isolations was similar in treated and untreated cows, while 71.4% of the coagulase-negative identified were isolated in cows treated with homeopathy. The distribution of the operon ica genes was similar in animals with and without treatment, except for the ica D gene, more frequent in treated cows. Production of biofilm was associated with presence of one or more genes from the ica ADBC operon. S. aureus revealed a greater diversity and greater dissemination in cows treated and not treated with homeopathy. Sequence Types ST1, ST5, and ST126 were identified in S. aureus .
Conclusions
The presence of biofilm-associated genes and the in vitro production of biofilms, combined with the persistence of clonal profiles of Staphylococcus spp. demonstrate other forms of control for bovine mastitis should be researched for organic production herds.
... These regions are highly polymorphous, and are therefore potentially suitable for discrimination in outbreak investigations. The spa gene has been used as an epidemiological target to identify the genetic lineages of S. aureus typing of bovine IMIs (Ben Said et al., 2016;Bonsaglia et al., 2018;Hasman et al., 2010;Holmes and Zadoks, 2011;Käppeli et al., 2019;Klibi et al., 2018;Mitra et al., 2013;Said et al., 2010;Veh et al., 2015). It is also the most widely used method for local and global short-term epidemiological studies (Boss et al., 2016;Nam et al., 2011;Tavakol et al., 2012;Vanderhaeghen et al., 2010;Yi et al., 2018), since spa typing was capable of simultaneously indexing genetic variations that accumulate both rapidly and slowly (Koreen et al., 2004). ...
In cattle, Staphylococcus aureus is a major pathogen of increasing importance due to its association with intramammary infections (IMIs), which are a primary cause of antibiotic use on farms and thus of the rise in antibiotic resistance. Methicillin-resistant S. aureus (MRSA), which are frequently isolated from cases of bovine mastitis, represent a public health problem worldwide. Understanding the epidemiology and the evolution of these strains relies on typing methods. Such methods were phenotypic at first, but more recently, molecular methods have been increasingly utilized. Multiple-locus variable number tandem repeat analysis (MLVA), a high-throughput molecular method for determining genetic diversity and the emergence of host- or udder-adapted clones, appears to be the most useful PCR-based method. Despite the difficulties present in reproducibility, interlaboratory reliability, and hard work, it is agreed that pulsed-field gel electrophoresis (PFGE) remains the gold standard, particularly for short-term surveillance. Multilocus sequence typing (MLST) is a good typing method for long-term and global epidemiological investigations, but it is not suitable for outbreak investigations. Staphylococcal protein A (spa) typing is the most widely used method today for first-line typing in the study of molecular evolution, and outbreaks investigations. Staphylococcal cassette chromosome mec (SCCmec) typing has gained popularity for the evolutionary analysis of MRSA strains. Whole-genome sequencing (WGS) and DNA microarrays that represent relatively new DNA-based technologies, provide more information for tracking antibioresistant and virulent outbreak strains. They offer a higher discriminatory power, but are not suitable for routine use in clinical veterinary medicine at this time. Descriptions of the evolution of these methods, their advantages, and limitations are given in this review.
... Bovine mastitis is a common disease in dairy herds causing significant economic losses to the dairy industry [1]. Staphylococcus aureus is a major pathogen of mastitis, which is mainly transmitted between cows by the contagious route, causing both subclinical and clinical mastitis (CM) [2,3]. Additionally, some strains comprising this species are considered a threat to public health [4]. ...
Staphylococcus aureus is a contagious pathogen frequently associated with bovine mastitis in Brazil. Molecular characterization of Staph. aureus isolated from affected mammary quarters of cows with clinical mastitis (CM) can provide data on epidemiological behavior of this pathogen and antimicrobial susceptibility (AMS) assessment at the genotypic level. This study genotypically characterized Staph. aureus isolates recovered from cows with CM and determined the association of genotypes and AMS. A total of 84 Staph. aureus strains identified from affected mammary quarters of cows with CM in 13 dairy herds from Southeastern Brazil were submitted for susceptibility testing to 10 antimicrobials using the technique of minimal inhibitory concentration. The same isolates were also genotyped using the spa-typing methodology. Results showed a high genotypic similarity between the Staph. aureus isolates within and between herds, which were categorized as resistant to most antimicrobials, especially to β-lactam antibiotics. In addition, differences in AMS were observed among genotypic clusters, which may affect the efficacy of antimicrobials used to treat CM in different dairy herds.
... The clinical outcome of the mastitis pathogen depends on several factors including herd factors such as nutritional and management practices, host factors such as breed, age, lactation period etc., and pathogen factors such as genotype and phenotype of the strain (Veh et al., 2015;Contreras and Rodríguez, 2011). However, it is still not known fully to what degree the host, herd and pathogen factors affect the clinical severity of mastitis (Fournier et al., 2008;Rainard et al., 2018). ...
Bovine mastitis is one of the biggest concerns in the dairy industry, where it affects sustainable milk production, farm economy and animal health. Most of the mastitis pathogens are bacterial in origin and accurate diagnosis of them enables understanding the epidemiology, outbreak prevention and rapid cure of the disease. This thesis aimed to provide a diagnostic solution that couples Matrix-Assisted Laser Desorption/Ionization-Time of Flight (MALDI-TOF) mass spectroscopy coupled with machine learning (ML), for detecting bovine mastitis pathogens at the subspecies level based on their phenotypic characters. In Chapter 3, MALDI-TOF coupled with ML was performed to discriminate bovine mastitis-causing Streptococcus uberis based on transmission routes; contagious and environmental. S. uberis isolates collected from dairy farms across England and Wales were compared within and between farms. The findings of this chapter suggested that the proposed methodology has the potential of successful classification at the farm level. In Chapter 4, MALDI-TOF coupled with ML was performed to show proteomic differences between bovine mastitis-causing Escherichia coli isolates with different clinical outcomes (clinical and subclinical) and disease phenotype (persistent and non-persistent). The findings of this chapter showed that phenotypic differences can be detected by the proposed methodology even for genotypically identical isolates. In Chapter 5, MALDI-TOF coupled with ML was performed to differentiate benzylpenicillin signatures of bovine mastitis-causing Staphylococcus aureus isolates. The findings of this chapter presented that the proposed methodology enables fast, affordable and effective diag-nostic solution for targeting resistant bacteria in dairy cows. Having shown this methodology successfully worked for differentiating benzylpenicillin resistant and susceptible S. aureus isolates in Chapter 5, the same technique was applied to other mastitis agents Enterococcus faecalis and Enterococcus faecium and for profiling other antimicrobials besides benzylpenicillin in Chapter 6. The findings of this chapter demonstrated that MALDI-TOF coupled with ML allows monitoring the disease epidemiology and provides suggestions for adjusting farm management strategies. Taken together, this thesis highlights that MALDI-TOF coupled with ML is capable of dis-criminating bovine mastitis pathogens at subspecies level based on transmission route, clinical outcome and antimicrobial resistance profile, which could be used as a diagnostic tool for bo-vine mastitis at dairy farms.
