Figure 5 - uploaded by Ahmad Ghoroghi
Content may be subject to copyright.
Comparison of diameters of clear zone produced by some isolated chitinolytic bacteria (Citrobacter freundii B1A and Bacillus cereus B3R).
Source publication
Chitinases have received attention because of their wide applications in the medicine, biotechnology, agriculture, waste management and industrial applications such as food quality enhancer and biopesticide. Excessive use of insecticides has led to several problems related to pollution and environmental degradation. In this study, isolation and ide...
Context in source publication
Context 1
... C (Fig. 6a). This chitinase was stable under 50 • C for 20 min (Fig. 6b). The optimum pH for activity of the enzyme was measured 5 (Fig. 6c). Chitinase was stable at pH 3 to 10 for 90 min at 25 • C (Fig. 6d). Analysis of amplified Serratia marcescens B4A chitinase DNA on 1% agarose gel was shown in Fig. 5. As we see in Fig. 7, size of chitinase gene was about 1600 ...
Citations
... The S. marcescens produces red colonies in this medium that facilitates their isolation. After 72 h, suspected red colonies grown in plates containing samples of cultured water were subcultured in nutrient agar medium (Zarei et al., 2012). ...
Purpose
The purpose of this paper was to identify Serratia marcescens to extract and purify prodigiosin pigment to evaluate the antibacterial potential of the pigment.
Design/methodology/approach
Samples were collected from shrimp aquaculture ponds. Species identification was conducted using morphological, biochemical and molecular tests. Pigment extraction and purification were carried out using column chromatography. The antibacterial effect of crude and purified prodigiosin pigment was evaluated on Escherichia coli , Bacillus subtilis , Pseudomonas aeruginosa and Staphylococcus aureus as biofouling bacteria. In addition, the interaction between prodigiosin and proteins involved in biofilm formation was evaluated using molecular docking.
Findings
The results of prodigiosin extraction with solvents showed the highest percentage of pigment presence with methanol solvent in the second day of culture. The chemical structure of pure prodigiosin obtained from the column chromatography was confirmed by Fourier-transform infrared spectroscopy. Both crude and purified pigments exhibited antibacterial effects against selected bacterial strains. The antibacterial effect of the purified pigment was higher, and the highest antibacterial effect was observed on B. subtilis . Prodigiosin docking was carried out with all target proteins, and the docked energy in all of them was at an acceptable level.
Originality/value
Prodigiosin extracted from S. marcescens can be used as a bioactive compound to design and manufacture of anti-biofouling and anti-biofilm formation products to use extensively for industrial applications as a natural color in marine industries, food industry, cosmetics and textile productions.
... The strength of chitinase activity in the tested fish was in proportion to the rate of growth of the fish when fed the chitin supplementation diet (Kono et al., 1987). Chitinases are hydrolytic enzymes that break down the glycosidic bonds in chitin (Zarei et al., 2012). Removal of chitin improves the digestibility of insect protein (Finke, 2007), because chitin is a complex matrix of proteins, lipids and other components (Kramer et al., 1995). ...
Frass, a by-product of the larval meal industry, is heterogeneous and includes larval excrement, exoskeleton sheds and residual feed ingredients along with abundant nutrients, chitin and beneficial microbes. The present study was performed to evaluate the changes in growth, feed utilization, body composition, hematology, serum chemistry, immune responses and disease resistance of hybrid tilapia, Nile x Mozambique (Oreocromis niloticus x O. mozambique) fed diets containing frass from black soldier fly larvae, Hermetia illucens. Five diets containing frass at levels of 0, 5, 10, 20, and 30% as partial replacements of a combination of soybean meal, wheat short and corn meal on an equal protein basis were fed to juvenile hybrid tilapia (2.6 ± 0.035 g) in quadruplicate aquaria to apparent satiation twice a day for the first two weeks and once daily for rest of the feeding trail. Final weight gain was significantly increased in fish fed the diet including the highest level of frass (30%). Fish fed diets containing frass (5% to 30%) had significantly higher protein efficiency than the group fed diet without frass (control diet). Feed intake and feed utilization efficiency were not significantly affected by dietary treatments. Survival during the feeding trail, whole-body composition, hematological parameters, and serum biochemistry were not affected by dietary treatment. Serum complement activity of fish fed 30% dietary frass was significantly higher than that of fish fed other treatments. Fish fed the diets containing frass showed significant dose-dependent trends in survival against both Flavobacterium columnare and Streptococcus iniae challenges. Frass from the larvae of black solder flies fed Distillers’ dried grains with solubles has potential for use as feed ingredient for improving growth of hybrid tilapia. Use of frass in tilapia diets may prove beneficial by improving innate immune components and the resistance of hybrid tilapia against bacterial infection.
... Meanwhile, Chakrabortty et al. (2012) reported that the addition of glucose and sucrose in the medium decreased the chitinase activity of S. marcescens culture compared to the control medium. Zarei et al. (2010) revealed that the addition of monosaccharides that were easily metabolized (glucose, lactose) inhibited chitinase formation by S. marcescens B4A. Holt et al. (1994) reported that growth of S. marcescens was inhibited in a medium containing urea, potassium chloride, and glucose. ...
Chitin hydrolysate is one of the value added product derived from shrimp shell waste. Production of chitin hydrolysate using biological process offers an environmental friendly method compared to chemical process. Serratia marcescens PT-6, a gram negative chitinolytic bacterium isolated from shrimp pond sediment, shows good activity in hydrolyzing chitin. This study aimed to improve the chitinase activity of S. marcescens PT-6 culture by optimizing the component of chitin-containing medium (additional nitrogen source, additional carbon source, and colloidal chitin). The optimization of chitinase by S. marcescens PT-6 culture was done using one variable at a time method. The sequence of the research were to optimize 1) the type of additional carbon source (glucose, lactose, sucrose, and starch), 2) the type of additional nitrogen source (yeast extract, peptone, ammonium sulphate, and ammonium chloride), 3) the concentration of colloidal chitin (0.5; 1; 1.5; 2; and 2.5%), and 4) the concentration of the additional carbon and nitrogen source. The culture of S. marcescens PT-6 was incubated in colloidal chitin medium at 30 oC and chitinase activity from culture supernatant was analyzed. The results showed that starch gave the highest chitinase activity compare to other carbon source, meanwhile yeast extract was chosen as the best nitrogen source among others. The combination of 1.5% colloidal chitin with 0.5% starch and 0.1% yeast extract in medium increased the chitinase activity of S. marcescens PT-6 to 0.021 U/ml. These results indicated that an appropriate medium composition could increase the chitinase activity produced by S. marcescens PT-6 culture.
... DNA amplification was done using universal primer namely primer forward 27F and 1492R (Frank et al. 2008). The amplification process occured on a Polymerase Chain Reaction (PCR) machine with composition and PCR reaction conditions were based on a procedure performed by Zarei et al. (2012). The PCR reaction composition was 15 μl PCR Master Mix (i TaqTM) 2X, 3 μl DNA template, 3 μl for primary forward, 3 μl reverse primer, and 6 μl nuclease free water (ddH 2 O). ...
Oil palm is widely known as one of vegetable oil sources and the main comodity in Indonesian agriculture because of the benefits in non-food and food industries. Ganoderma boninense attack results in considerable losses to agriculture. Chemical control creates a harmful effect on health and the environment. Biocontrol is required to take over the function of chemical control. This study aimed to select bacteria that produce bioactive compounds as biofungicide against G. boninense pathogenic fungi and identify bacteria producing biofungicide using molecular method. The stages of bacterial isolate selection were performed through the selected hemolysis and isolate tests in the antagonistic test. Bacteria were extracted using ethyl acetate and their extract activity were tested. Analysis of bioactive compounds was conducted using thin layer chromatography (TLC) and the identification was based on 16S rRNA gene. The result of bacterial pathogenic test was obtained from two selected bacterial isolates namely 11B LB and 11B MD. Both bacterial isolates showed antagonistic effects by forming an inhibitory zone against G. boninense growth with percentage of inhibitor of 81 and 75%. Activity test of bacterial extract showed that crude extract of bacterial isolate 11B MD had the highest inhibitor activity that is 88.34%. TLC analysis proved that the active extract of bacteria containing metabolite compounds had Rf value of 0.1, 0.28, and 0.38. Isolate bacteria 11B MD was identified as Pseudomonas aeruginosa.
... Chitinolytic bacteria are typically detected and screened through the production of clearing zones on chitin containing agar as selective medium. Chitinases have received attention because of their wide applications in the medicine, biotechnology, agriculture, biocontrol of plant pathogenic fungi, waste management and industrial applications such as food quality enhancer and biopesticide (Zarei and Aminzadeh, 2012). ...
The present research work focuses on the extraction of chitosanase enzyme from soil bacteria (Bacillus megaterium). In this research, the soil sample was collected from Htauk-kyant Township, Yangon Region for the isolation and cultivation of bacteria. In the isolation process, bacteria were isolated from the soil sample by serial dilution plate method, followed by culture in nutrient agar medium. Ten bacterial strains (A1 to A10) were isolated from the soil sample and were characterized by microscopic examination and gram staining methods. Among these bacterial strains, A1, A2, A3, A4, A6, A8, A9 and A10 were found to be gram positive, whereas only A5 and A7 were gram negative. According to the biochemical tests, out of eight gram positive bacterial strains, only A2 was observed to give the positive results on motility tests, methyl red tests, citrate utilization tests, starch hydrolysis tests, sugar fermentation tests and negative results on indole tests, nitrate tests, (VP) Voges-Proskauer tests that similar to the characteristics of chitosanase enzyme producing bacteria (Bacillus megaterium). Hence, A2 might be identified as Bacillus megaterium. For extraction of chitosanase enzyme, the isolated bacterial strain (A2) was cultured on chitosanase producing medium of 0.6 % poly peptone, 0.1 % K 2 HPO 4 , 0.05 % MgSO 4 .7H 2 O, 0.6 % yeast extract, 0.1 % glucose and 0.5 % colloidal chitosan and incubated at 30 C. The optimum incubation time (3 days) of enzyme forming bacteria, inoculum sizes of bacteria (10 %), age of culture of bacteria (3 days), temperature of enzyme-catalyzed reaction (55 C) and pH (7.0) of chitosanase producing medium were determined based on the chitosanase activities. Turbid enzyme bacterial solution was so prepared under above conditions for preparation of enzyme bacterial solution. The enzyme bacterial solution was centrifuged with 3000 rpm at room temperature and the supernatant enzyme solution was collected. The crude chitosanase solution was obtained and then partially purified by successive precipitation method by using 30 % and 70 % saturation of ammonium sulphate. Finally the total enzyme activity, protein contents and specific activity of crude enzymes obtained from each purification step were determined.
... Chitin is a polysaccharide with linear structure formed of N-acetyl-Dglucosamine (NAG) residueslinked with β-1-4 bonds (Zarei et al., 2012), and hydrolyzed by diverse chitinolytic enzymes with different modes of hydrolysis. These enzymes can be classified as endochitinases, exochitinases, chitobiases, and β-N-acetylglucosa minidases (Brzezinska et al., 2014). ...
... DNA amplification was done using universal primer namely primer forward 27F and 1492R (Frank et al. 2008). The amplification process occured on a Polymerase Chain Reaction (PCR) machine with composition and PCR reaction conditions were based on a procedure performed by Zarei et al. (2012). The PCR reaction composition was 15 μl PCR Master Mix (i TaqTM) 2X, 3 μl DNA template, 3 μl for primary forward, 3 μl reverse primer, and 6 μl nuclease free water (ddH 2 O). ...
Oil palm is widely known as one of vegetable oil sources and the main comodity in Indonesian agriculture because of the benefits in non-food and food industries. Ganoderma boninense attack results in considerable losses to agriculture. Chemical control creates a harmful effect on health and the environment. Biocontrol is required to take over the function of chemical control. This study aimed to select bacteria that produce bioactive compounds as biofungicide against G. boninense pathogenic fungi and identify bacteria producing biofungicide using molecular method. The stages of bacterial isolate selection were performed through the selected hemolysis and isolate tests in the antagonistic test. Bacteria were extracted using ethyl acetate and their extract activity were tested. Analysis of bioactive compounds was conducted using thin layer chromatography (TLC) and the identification was based on 16S rRNA gene. The result of bacterial pathogenic test was obtained from two selected bacterial isolates namely 11B LB and 11B MD. Both bacterial isolates showed antagonistic effects by forming an inhibitory zone against G. boninense growth with percentage of inhibitor of 81 and 75%. Activity test of bacterial extract showed that crude extract of bacterial isolate 11B MD had the highest inhibitor activity that is 88.34%. TLC analysis proved that the active extract of bacteria containing metabolite compounds had Rf value of 0.1, 0.28, and 0.38. Isolate bacteria 11B MD was identified as Pseudomonas aeruginosa.
... It accumulates as a waste from shellfish production and processing industries in the terrestrial environment (Chakrabortty et al., 2012). It occurs mainly as a structural component in the exoskeleton of arthropods and to lesser extents in plants, fungi, bacteria and other animals (Zarei et al., 2012). It could be degraded into various chitooligomer molecules that may undergo further enzymatic breakdown generating N-acetylglucosamine (GlcNAc) monomers by sequential action of two types of chitinase enzymes: endochitinase and exochitinase. ...
Microbial chitinases are important environmental biomolecules with biotechnological and medicinal applications in addition to being a source of environmental friendly biopesticides. They are considered as safe alternatives to some available chemical insecticides, especially against insects that may act as an intermediate hosts as well as vectors between manifested plant materials and humans. A crude chitinolytic enzyme was isolated from isolate A7 (Bacillus atrophaeus Nakamura 1989). The isolate was identified based on the morphological and biochemical characteristics as well as the sequencing of 16S rRNA. The produced enzyme had a total activity of 68.9±1.03 mU/mL; a specific activity of 2670±40.2 mU/mg protein, and was optimally active at 40°C, 4-9 pH with stability for one hour at 30-40°C and 6-7 pH. It was inhibited by Cu²⁺, Fe³⁺, Ni³⁺, Zn²⁺ and Ba²⁺ metal ions and impeded the development of 50 % of Drosophila melanogaster larvae into adults (LD50) at 17.3±1.4 mU/mL. In this study, the larvicidal activity of chitinase from B. atrophaeus is explored for the first time with the potential of being applied as environmental friendly biopesticide technologies.
... Chitinases are hydrolytic enzymes which break down the glycoside bonds in chitin [1], and were first detected in the secretions of mid intestinal gland of snail (Helix pomatia) [2]. Chitin is a b-1, 4-linked polymer of N-acetylglucosamine and one of the most abundant biopolymers in nature [3]. ...
Chitinases are hydrolytic enzymes which have been employed to breakdown chitin coats of pathogenic microorganisms, thereby weaken the defense system of several pathogens and insects. In this regard, we identified the chitinase genes of turbot and characterized their expression patterns in mucosal tissues following Vibrio anguillarum and Streptococcus iniae challenge. In present study, transcripts of three chitinase genes (CHIT1, CHIT2 and CHIT3) were captured, as well as their protein structures and expression patterns following different bacterial infection were characterized. The chitinases were widely expressed in all tested tissues with the highest expression level of CHIT1 and CHIT2 in intestine, and CHIT3 in skin. Finally, these three genes showed different expression patterns following bacterial challenge. The significant quick induction of chitinases in mucosal surfaces against infection indicated their key roles to prevent pathogen attachment and entry in mucosal immunity. Functional studies should further characterize the chitinases and avail utilization of their function to increase the disease resistance in maintaining the integrity of the mucosal barriers against infection and facilitating the disease resistant family/strain selection in turbot.
... The plasmid pQE60 chitinase (previous work) ( Babashpour et al., 2012;Zarei et al., 2012) (Webb and Sali, 2014) using opened form of chitinase (1edq_A) downloaded from PDB server as the template. The MODELLER generated structure of the mutant chitinase was further analyzed by Ramachandran analysis generated by Procheck (Laskowski et al., 1993), Qmean server (Benkert et al., 2008), ProSA-web (Wiederstein and Sippl, 2007), and RMSD value calculation (Humphrey et al., 1996). ...
... The Quik Change Site Directed Mutagenesis strategy was used for mutagenesis. The plasmid pQE60 harboring the chitinase gene (previous work) ( Babashpour et al., 2012;Zarei et al., 2012) was used as the template for producing the mutant chitinase. The forward (5'-CACATCTTCCTGATGATCTACGAC TTCTACG-3') and reverse (5' CGTAGAAGTCGTAGATCATCAGG AAGATGTG-3') mutant primers were used in polymerase chain reaction. ...
Thermostable chitinases are useful for industrial and biotechnological applications.
This paper reports the stabilization of chitinase from Serratia marcescens B4A through
rational mutagenesis. Changing of Ser 390 to Ile in S. marcescens. The stabilization
was enhanced through entropic stabilization by reduction of the loop length and also by
increasing of the beta chain length. With this replacement, polar uncharged residue
changed to non-polar one and increased the hydrophobic interactions. Furthermore
Isoleucine has branched β-carbon that restricts the backbone conformation more than
non-branched residues. Finally all of these factors lead to entropic stabilization and
thermal stabilization. The results exhibited that the optimal temperature and pH for
enzyme activity of native chitinase were not changed by mutagenesis which showed
that mutation didn’t affect the original characteristics of the enzyme, the Km values of
native and mutant chitinase were different very little, showing that the affinity of
enzyme towards the substrate and also the natural flexibility of chitinase did not change
by mutation. Besides the Vmax value of the mutant chitinase was decreased, while its pH
stability was increased briefly, but its thermal stability was increased remarkably.
Mutation made chitinase to tolerate high temperatures up to 90°C. In addition its
activity was increased at 50°C, 60°C for 120 min and up to 2 hours of incubation period
and the mutant chitinase demonstrated a high level of activity at 60°C. These results
show that entropic stabilization works well for chitinase and this approach may be
generally applicable for stabilization of other proteins.
