ResearchGate Q&A lets scientists and researchers exchange questions and answers relating to their research expertise, including areas such as techniques and methodologies.

Browse by research topic to find out what others in your field are discussing.

Browse Topics

  • Prakash Chandra added an answer in PCR:
    PCR: Gel extraction Vs PCR clean up?

    What is the difference between gel extraction and PCR clean up???

    Prakash Chandra

    please explain question.

    a/c what i have understood in gel extraction you run your product on Agarose gel and than you go for excision of your preferable band.

    and in PCR clean up you use a kit and use your PCR product directly (without using gel ) .

  • Asif nawaz Mughal asked a question in Business:
    Anyone else known that "how can owner measure their business performance"?

    fast gave answer

  • Marcus Heide added an answer in Underwater Acoustics:
    How does one measure ambient backbround noise in the deep ocean over a one year period?

    BREAM was one solution to this problem. I have a copy of the research results resulting from the deployment of two buoys in the central Pacific ocean 200 miles off the coast of Central California.

    Marcus Heide

    Hi Sam,

    what is your frequency range?


  • Isam Janajreh added an answer in MENA:
    What is the residence time of dust aerosols over the MENA region (below 1.5km, near surface)?

    I am trying to estimate the residence time of dust aerosol over the MENA region. I have tried to compute it using the equation T=fct(radius, normalized_radius,Twet). But, Twet varies with the meteorology (3*1e5, 6.91*1e5). From literature, residence time of dust  is : 1) varying between ~2 and 8 days, 2) varying between ~2.4 and 12.9 days, 3) global mean is ~2.7 days, 3)  average of ~4days, …

    Anyone can suggest more precise season specific residence time for the MENA region. 

    You help is greatly appreciated. 

    Isam Janajreh

    My approach is pretty different as this is a Lagrangian discrete particle is entrained in a continuous Eulerian fluid (air) subjected to buoyancy forces and gravitational forces with a particle trajectory coupled with  the conditions of the continuous flow within the atmospheric boundary layer. Your mathematical prediction is functional model and your constrains needs to be explicitly stated such as the terrain type, the mean velocity, the mean particle size, the mean temperature,  humidity  etc. Therefore given these data a miso scale simulation can be carried out to answer you more vividly. But I am afraid that this project on its own.

  • Lauri Kaila added an answer in Climate Change:
    Do you have any explanations to the 'over-reaction' of insects to climate change in their expansion northwards in North Europe?
    Insects have been displaying rapid range expansion northewards during last decades in North Europe . E.g. some Lepidoptera (moths/butterflies) have expanded their range even by over 500 km northwards during a decade in Finland. It seems that there must be other factors than climate change alone to explain this "over-reaction". Any ideas of possible other factors augmenting this phenomenon?
    Lauri Kaila

    Hello Rudolph,

    there is indeed observations that some - but seemingly a minority of - species that have their southern limit of their distribution in Finland are getting scarcer and scarcer, some even become extinct in southern part of their range. This has been noted in species living in coniferous forests or mires, but in some others too like Carterocephalus palaemon whose typical habitats definitely have not become scarcer (a few year old clear-cut spots of conifer forests). For the mire/bog species it may be difficult to separate climatic factors from the extensive destruction of their habitats due to peat exploitation. However, some species like Boloria freija and frigga seem to be going exctinct also from very large bogs in southern Finland that should not be that vulnerable to larger scale metapopulation effects. If this is normal or not, I don't know, but seems something new when comparing  to even not-so-old historical records. These species are not very mobile. The northward shift of their range seems significantly slower than northward expansion of the expanding species.

  • Masoomeh Rahimi asked a question in Peroxides:
    Whether roasting on the peroxide value of pistachio is effective?
    • roasting in 90 c for 15min
    • roasting in 90c for 30min
  • Ima Essiet added an answer in Speech Recognition:
    Is ANN any good in prediction of classification on speech recognition area (noisy environment)? if yes, which kind of algorithm is better?

    Is ANN any good in prediction of classification on speech recognition area (noisy environment)? if yes, which kind of algorithm is better?

    Ima Essiet

    It would be better to use HMMs for better results but u can do a comparison btw HMM and ANN to be sure which gives better classification results

  • Solange Cook-Darzens added an answer in DSM:
    Could we use DSM IV-R reference in an article?

    I'm working on a survey that provides DSM IV-TR reference because the data have been collected in 2013/2014. Could be a problem? Must we cite the classification of DSM V?

    Solange Cook-Darzens

    Dear Maura,

    Indeed, you should use the DSM-IV reference if you used that classification system for diagnosing your subjects or interviewees. And apparently, you had no other choice in 2013. Some researchers will attempt to re-diagnose their subjects according to the DSM-5 system, (for instance to demonstrate it does not change things much) but it is not always feasible nor relevant to do so.

    I would suggest you stick to the DSM-IV system and state clearly why.

    Solange Cook

  • Tomáš Hluska added an answer in Bioactive Peptides:
    Any advice on the purification method for the commercial production of bioactive peptide?

    what is the most suitable purification method for the commercial production of bioactive peptide?

    Tomáš Hluska

    As Duncan wrote, more details would be useful (pI, Mw, any tags?). Otherwise it will be trial and error.

    But some non-specific chromatography methods (ionex, hydrophobic, size exclusion) will help in any case, only their rpofitability will vary.

  • M U Dua asked a question in Human Rights:
    People are still being exploited and there is great injustice all over due to which our indian culture is fast erodig. why?

    human rights     www.aihra.org

  • Thierry C Gillebert added an answer in Coronary Artery Disease:
    Is there any role of prasugrel and ticagrelor as part of dual antiplatelet therapy after stenting in STABLE coronary artery disease?

    Ticagrelor and prasugrel have been advised in STEMI and NSTE-ACS after PCi. what about SCAD??

    Thierry C Gillebert

    Hi Aaysha,

    The P2Y12 inhibitors (clopidogrel, prasugrel, ticagrelor, cancrelor) are used in two indications: stenting and ACS. The newer agents have only a validated use in ACS.

    Of note for the treatment of SCAD (stable coronary heart disease) the 2014 ESC guidelines speak generically about DAPT. My reading is that we just have to wait for data with prasugrel, ticagrelor in SCAD.

    There however is a window to use them (weaker class IIB recommendation) in the case of stent thrombosis, high risk elective stenting. 

    Best regards,


  • Gyorgy Banhegyi added an answer in Dielectrics:
    What percentage of theoretical density (for ceramics) is required for a good dielectric measurement?

    whether it should be more than 90% ?

    Gyorgy Banhegyi

    If you measure the parameters of the porous ceramic, and if you know the porosity  and the shape and connectivity of the pores, you can calculate back the properties  of the ceramic components using one of the dielectric mixture formulas.

  • Helmut Brandl added an answer in Water Supply:
    How much do you pay for 1 cubic m of water (please specify your location)?

    I want to compare prices for freshwater...

    Helmut Brandl

    Here is something that might be helpful (see attachment: figure and table). In Zurich (Switerland) the price is 2 Euro per cubic meter.  The numbers in the table are prices for water AND wastewater.

  • Mohd Yusof b. Abdullah added an answer in Poverty:
    How does poverty affects one's well-being?

    In a developing country, I presume the way poverty is perceived is quite different from that of a developed country. How will poverty then affects ones well-being in a developing country? (most especially women). Will be nice if you can bullet point it. Thank you

    Mohd Yusof b. Abdullah

    Poverty affects well-being in many aspects of full life

    * accessibility to sources of information

    * political participation

    * basic needs of life e.g. healthy food, decent house, clean water

    * good education

    * social networking/affiliation

  • Sabine Strehl added an answer in Euchromatin:
    Are the results of chromosome banding all the same in different tissues?

    We know that many genes are expressed in a tissue-specific manner. Mechanisms include the remodeling of heterochomatin and euchromatin. I wonder now  if there's any way of high-resolution chromosome banding could show such difference? Or is there any other ways of staining could indicate that one gene is located in heterochromatin or euchromatin?


    Sabine Strehl

    This might answer your question: http://www.nature.com/scitable/topicpage/chromosomes-14121320

  • Cong Gao added an answer in Feature Vectors:
    Which is Worth? Extracting Features from Bounding box of segmented region or pixel wise feature extraction?

    I have initially segmented some regions using K-means clustering. Need to refine the results using output of clusters to Supervised based segmentation algorithms. using some features and Classifier (like SVM or RF). Whether Region wise Feature vector computation or Pixel wise Computation is useful?

    Which is best Please Suggest me..

    Cong Gao

    The answer is problem specific.  pixel-wise If you need a high accuracy, bounding box is easy to handle with fast computing and low accuracy. As trade off, convex hull will be a good choice.

  • Gyorgy Banhegyi added an answer in Polyethylene:
    How can I separate paperboard, polyethylene and aluminum in Tetra Pak products?

    I am eager to find out an economic way in order to recycle Tetra Pak wastes, and to separate aluminum from plastics in such products. Please let me know if you have any knowledge about recycling these products, and please introduce me some beneficial sources.

    Gyorgy Banhegyi









    In fact the net is full of information - yoou only have to process it ... Good luck

  • B. L. Gorberg added an answer in Thin Film Coatings:
    Is anyone experienced with the formulation of heat resistant coatings for PET film?

    Looking for a heat resistant coating for thin (4.5 micron) PET film used in a digital printing application. The coating must be less than .5 nm and protect the PET from sticking to a hot printhead (>200C).  Typical formulations are crosslinked silicone-urethane copolymers.  

    B. L. Gorberg

    Dear Daniel,  it would be better to make a trials. I can make magnetron sputtering of stailess steel or Al2O3 on your A4 samples.  If you have the interest - contact me by e-mail:   gorberg@isuct.ru         Best regards, Boris Gorberg

  • Norman T. Sheehan added an answer in Strategic Management:
    What experiential exercises can be used for teaching strategic management?

    I would like to know what experiential team-based exercises are recommended for teaching strategic management in Msc classes. For example, to introduce vision, mission, strategy, values, policies, etc.

    Norman T. Sheehan

    See http://carpenterstrategytoolbox.com/tag/experiential-exercise/

    for a comprehensive list of experiential exercises to use in strategy classes. 

  • Tomáš Hluska added an answer in Protein Biochemistry:
    What is a minimal promoter for low protein expression (in mammalian systems)?

    Hi everybody,

    we have a protein which is toxic if it is highly expressed (SV40 promoter). Therefor I had the idea to use a minimal promoter like the minimal CMV ( GTCGAGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAG ) to get only low amounts of the protein. However I found several "versions" of the minimal CMV and would like to have the one with the highest basal expression. Can somebody recommend me on and send me the sequence. Iam also happy to get other suggestions for promoter with low basal expression in a mammalian system. 

    Thanks a lot,


    Tomáš Hluska

    How about inducible expression? You'll grow your cells, then induce and quickly collect before they start dying.

  • Zhaozhi Lu added an answer in Fungal Infection:
    What's wrong with my aphid Aphis craccivora ?
    • The initial colony is collected from leaves of peanut and maintained on broad bean in a controlled climate room(24 ± 1℃, 65 ± 5 % RH, photoperiod 16L:8D ).
    • It has been 3 months that my aphid can't growing well, with slow growth rate and a few progeny. While no fungal infection and parasitism are found, and the plant grows well. There was no such a phenomenon before.
    • I have replace several broad bean varieties and even the culture medium but without any improvement. At last I collected some wild Aphis craccivora to restore the colony, it grew well for 3 weeks but then bacame bad and can never recover again.
    • I'm quite confused about this phenomenon.Can anybody help me? Thanks in anvance.
    Zhaozhi Lu

    You can call me in tomorrow. 0991-7885408

    0991-7885408.  My office phone.

  • Guillaume Touya added an answer in GIS Mapping:
    Can anyone suggest a very basic level GIS mapping software for district level data of India?

    This is for data visualization purpose.

    Guillaume Touya

    To complete the answers above, the open source combo PostGIS-QGIS is a good solution. One of the weaknesses of QGIS is the spatial query engine, but when using also PostGIS, it can be called through a QGIS plugin, and the spatial queries of PostGIS are very robust. It also allows to use PGRouting for routing queries.

  • Zaitceva Elena Nikolaevna added an answer in Kidney Disease:
    What is the best tubulary injury marker for acute kidney disease?

    what is the best tubulary injury marker for acute kidney disease

    Zaitceva Elena Nikolaevna

    Biomarkers that reflect the functional state of the kidneys is a cytoplasmic enzyme lactate dehydrogenase (LDH) and membrane enzyme gammaglutamyltransferase (GGT) in the urine. They help in the early stages of the disease to make a diagnosis of ARF and give the opportunity to start timely treatment.

  • Hala Hazzaa added an answer in Oral Rehabilitation:
    TMJ clicking is nowadays classified as a noisy annoyance. Is there any evidence when and how it should be treated?

    Does it matter whether a disk displacement is correctly identified at the early stage of assessment in a clinical setting? Do displaced disks represent a pathology that must be identified? Do displaced disks that do not cause pain or interference in joint movement represent a clinical problem requiring classification and, of greater concern, some type of treatment? 

    Ohrbach, R., & Greene, C. (2013). Temporomandibular joint diagnosis: striking a balance between the sufficiency of clinical assessment and the need for imaging. Oral Surgery, Oral Medicine, Oral Pathology and Oral Radiology, 116(1), 124–5. http://doi.org/10.1016/j.oooo.2013.03.021

    Naeije, M., te Veldhuis, A. H., te Veldhuis, E. C., Visscher, C. M., & Lobbezoo, F. (2013). Disc displacement within the human temporomandibular joint: a systematic review of a “noisy annoyance.” Journal of Oral Rehabilitation, 40(2), 139–158. http://doi.org/10.1111/joor.12016

    Hala Hazzaa

    Dear Katja, one of the most valuable treatment lines is the low level laser therapy (LLLT) in reducing pain & inflammation in both TMJ & muscles of mastication by irradiating the trigger points with the proper energy density. In addition, LLLT also increases the blood supply to the affected area, besides, its beneficial effects on regeneration.

  • Masaki Suimye Morioka added an answer in ChIP-Sequencing:
    Any suggestions for webbased chipseq analysis?

    I am looking for web based chipseq analysis software programms 

    Does the field have any suggestions for me

    Masaki Suimye Morioka

    BaseSpace is really useful for NGS beginners.

  • Shahid Ali Khan added an answer in Plant Genetics:
    Can anyone guide me about the successful mutant transformation in Peanut?

    I having some difficulty in that respect

    Shahid Ali Khan

    Hi Yuan-Yeu Yau

    Actually i am in the start of my PhD research and want how to transfer a mutated gene in to peanut genome because it is very difficult to carryout transformation in peanut as compared to other crops.


  • Claus Schnabel added an answer in Employment:
    What are the links between atypical employment and employment security ?

    According to you what is the undispensable reference on the stepping-stone effect of atypical jobs ?

    Claus Schnabel

    I don't think that there is one undispensable reference, in particular as atypical employment covers a wide field of employment relationship. If you are interested in fixed-term employment, have a look at the IZA World of Labor entry by Werner Eichhorst, which includes the most important references.

  • Holger Wille added an answer in Solvents:
    Is HFIP ( 1,1,1,3,3,3-hexafluoro-2-propanol) a universal solvent for aggregating peptides?

    And can we use it for conversion of any of the peptide (in Beta form) to its monomer form?

    Holger Wille

    HFIP is a strong inducer of alpha-helical structure, hence it tends to disrupt beta-structure in short peptides. I can't guarantee that it'll work with all peptides, but it would always be one of the first solvents I would try.

    A particularly good property is its low boiling point, i.e. it is easy to remove HFIP via evaporation if it is not needed anymore. This one is not so easy with most of the alternatives (ammonia etc.).

  • Hamaidia Malik added an answer in Adeno-associated Virus:
    Which is the best viral vector for overexpression of a protein in human primary macrophages?

    Primary monocyte-derived macrophages are resistant to infection. In fact, I have already tried to infect them with different serotypes of Adeno-associated virus expressing the GFP but without success.

    What are the best methods to transfect or to transduce human primary macrophages?

    Big Thanks

    Hamaidia Malik

    I'd like to thank you for your response

    Best regards

  • Tianheng Ren asked a question in Primer:
    Anybody know are there some PCR-PRIMERS specific for rye 2R, 4R and 7R chromosome, respectively?

    we want to find some primers specific for different rye chromosome, anybody can give me some information about it?