Q&A

ResearchGate Q&A lets scientists and researchers exchange questions and answers relating to their research expertise, including areas such as techniques and methodologies.

Browse by research topic to find out what others in your field are discussing.

Browse Topics

A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
  • Martin Yakum asked a question in Mass Vaccination:
    How to compare to proportion in stata?

    We conducted a community based study to estimate the vaccination coverage after a mass vaccination campaign. We wanted to compare this coverage obtained in our study with the administrative coverage obtained during immunisation campaign using stata. The problem is that some of the administrative coverages were more than 100% and stata does not seem to recognise any percentage above 100%. Can someone tell me how to go about this?

  • Svilena Mihaylova added an answer in Cointegration:
    Does the Toda-Yamamoto test check for long run or short run causality?

    If the results from Johansen test show no cointegration between two variables (i.e. no long run relationship between them), but causality test (Toda-Yamamoto procedure) shows one-direction causality, does the second result contradict the first one? In other words, my question is whether Toda-Yamamoto test checks for long run or short run causality. Thank you in advance!

    Svilena Mihaylova · University of Economics - Varna

    Thank you all for the helpful comments!

  • Stu Shulman added an answer in Twitter:
    How to get twitter historical data?

    I am doing a research in twitter sentiment analysis related to financial predictions and i need to have a historical dataset from twitter backed to three years. last year twitter announced that they will release historical data for scientific proposes.

    I am  asking if anybody have an idea about how to get this data? 

    Stu Shulman · Texifter

    You can can do it most inexpensively for smaller jobs via Sifter, which is a self-serve web service with unlimited free estimates and powerful filter rules, provided by a small business member of the Plugged In to Gnip partner program. If you make a purchase, the data is placed in an advance text analytics platform (DiscoverText.com), where you can analyze it for free using search, filters, duplicate detection, near-duplicate cluster, human coding, and machine learning. 

  • How do I solve higher order coupled PDE's?

    Hello Everyone 

    I have to solve a higher order coupled PDE with initial and boundary conditios. 

    I have tried Matlab pdex4 and pde but could not as they dont allow higher derivatives wrt t. My equations look like as follows

    d2v/dt2 = d4v/dx4 + F

    d2w/dt2 =d2v/dx2 + F

    In Matlab/pde apparently it doesnt allow higher derivative on left handside.

    Can anyone please help me in this?

    Majeed Ahmad Yousif · University of Zakho

    Dear you can also use Comsol. it is solve many problems type same as PDEs. ODEs. ...etc

    the results by that is program obtain by finite element method

  • Roland Cochard added an answer in Mangroves:
    Anyone familiar with this mangrove leaf species?

    My friends sent me a picture of mangrove leaf's sample. It has approximately 11-14,5 cm length, egg-shaped with rounded tips, compound leaves with 1 to 2 pairs of leaflets that are round.Unfortunately my friends didn't have any other sample. Could someone identify this mangrove?

    Thank you

    Roland Cochard · ETH Zurich

    Regarding leaf size there are different indications, e.g. up to 12 cm: https://www.hort.purdue.edu/newcrop/duke_energy/Avicennia_officinalis.html , but leaves often exceed the size given in the literature, especially if the leaves were 'shade leaves' which generally grow larger than leaves exposed to much sun. Cf. comment by Mr. Rao. The leaves are attached to woody twigs. You may google images of Avicennia leaves, and for 'bud scar', and compare to your sample.

  • Christian Baumgarten asked a question in Causality:
    Is a concept of causality required in science?

    John D. Norton characterized "Causation as Folk Science",

    (see http://quod.lib.umich.edu/p/phimp/3521354.0003.004/1).

    Would you say that causality is a well-defined concept that is

    essentially required in science?

  • Sahour Sayed added an answer in Graphene:
    How mono-layer graphene could have XRD pattern?

    Mono-layer graphene is a one atom thick layer of carbon, so how it could have XRD pattern? and what is it representative for? 

    Sahour Sayed · Cairo University

    Thank you for your kind reply.

  • Is possible to Zebrafish develop in dilutions of E3 medium?

    I'm trying to see the development of Zebrafish embryos (4hpf-96hpf) in dilutions of E3 medium in deionized water: 2%, 4%, 6%, 8% and 10% of E3.

    I put the 5 embryos in well in a 24 well plate and do static system (did not change the medium during all the time).

    All the embryos in the dilutions have normal development until 72hpf after this time they have malformations, pericardial edema, slow heartbeat and they died in 96hpf.

    I do some wells as control with 100% E3 medium and the embryos were fine in these wells.

    I really do not understand what is happening. If someone can help me with anything about this I would be very grateful!

  • Joan Villena added an answer in Caspase:
    Could it be possible that cells undergo apoptosis but caspase 3/7 levels are not changed?

    Dear all, We found our reagent reduced H82 small lung cancer tumor growth in null mice, and then we detected whether caspase 3/7 was increased in drug-treated H82 cells vs. control cells. However, we found the caspase 3/7 levels are not changed. How to explain the findings?

    Joan Villena · Universidad de Valparaíso (Chile)

    Dejar Yun

    As some colleagues comment there are different kinds of cell death, some of them are caspases-independent. First, you must to be sure which are associated with drug- treatment.

  • Any one have detail idea about XRF spectrometer for elemental analysis?

    any one have detail idea about XRF spectrometer for elemental analysis?

    Virendra Kumar Saxena · National Geophysical Research Institute

    For XRF and elemental analysis, a large number of published work available. For detailed acknowledge, the following institute may be contacted :

    Director, National Geophysical Research Institute, uppal Road, Hyderabad, 

  • In trying to establish inter-rater reliability, what are the appropriate statistics to be employed for a tool with a 5-point Likert rating scale?

     I want to establish degree of agreement of individual items in the designed scale, with multiple judges (at least 5) given all items. So it’s a full crossed design, but I’m unable to decide whether to select inter class coefficients (ICC) or Kendall’s coefficient of concordance measure (W)? What are the assumptions of these tests to judge which statistics is best suitable for my data? 

    Sravanti Adhikari · Indian Statistical Institute

    My readings suggest Cohen's Kappa provides levels of agreement between raters for nominal ratings. Also it may be limited in its usage with two raters only. What about cases with multiple raters and for Likert rating scale items which are considered as interval or ratio data? I am primarily interested in exploring the degree of consistency in ratings per item across the raters, I was suggested Kendall Coefficient of concordance. Is that appropriate? Please help ...

  • Amit Nayak asked a question in Paraformaldehyde:
    My CRyo section is breaking in to pices , what could be the problem?

    I am perfusing rat brain with 4% paraformaldehyde then , post post  fixing overnight in same fixative  after that i am replacing it with 30% Sucrose in PBS  and after 48 hour an preparing it for sectioning using cryostat. But my crosection were breaking in to pices as soon as i am washing it in PBS

    My work in Ischemic Stroke ,

    is it possible that my experiment is causing this ? Kindly help me out 

  • Adrian Andronic added an answer in Abaqus:
    Is there anybody working on modeling reinforced masonry or masonry wall in abaqus?

    My study is about the behaviour of reinforced masonry walls under horizontal loading. ı need to learn modeling of masonry walls and ı don't know where to start... ı need someone to show the way...

    Adrian Andronic · Technical University of Civil Engineering of Bucharest

    Very good point. I believe that the behavior of mortar can be simulated with the interaction property definition

  • Mary Giuffra added an answer in Competences:
    How to become a competent postgraduate Student?

    I am postgraduate  student and working on electroceramic.Please give me suggestions, how to be become a competent postgraduate student?  

    Mary Giuffra · US Association for Body Psychotherapy

    Ask Questions. Take time to listen,  Keep an open mind. Get excited about your subject and about learning. To not know is a gift. You are there to learn.

    Babies and young children are excited about exploring their world. Try to reawaken that same quality of  seeing the world as a gift to be studiedand appreciated rather than a hurdle to be overcome.

    That will be the start of an exciting life in which each day is a new gift to be explored. Once you think you are an experty and know your subject, you are on a path to stagnation and dead wood.

     In this day of the internet, use critical thinking and technology to help with answers. 

  • Priyanka Kohli asked a question in Proteomics:
    Is there any repository which provides a list of proteins and their inhibitory molecules?

    I have a proteomics dataset and would like to target some proteins from the dataset with some inhibitors. Is there any repository which provides a list of proteins and small inhibitory molecules?

  • Mahvash Jebeli added an answer in Vicon Nexus:
    How can I get XYZ coordinate of total body center of mass in Vicon Nexus 2 ?

    I've done a gait test and I need to know the xyz coordinates of CoM, the system was Vicon Nexus 2, as I couldn't find anything in manuals any help would be appreciated.

    Mahvash Jebeli · Amirkabir University of Technology

    thanks for your answer, I have csv file of markers coordinates, but now I need the coordination of CoM, I don't know how to set setting so I would be able to get com's coordination. If you know how please let me know

  • Vadiraj K T asked a question in Hybrid Solar Cells:
    Which German universities, working on Organic and Hybrid Solar cell?

    I am applying for DAAD fellowship. I wanted to know which University or the Institution working on Organic and Hybrid Solar cell

  • Radhwan Alnaimi added an answer in Laser:
    How to measure the spot size of the laser focus?

    Hi,

    Can anyone recommend a safe procedure to measure the focused spot of laser beam. We calculated the focus spot size, but would like to measure it as well. I am thinking of using a set of glass wedges, thin film polarizers  and ND's to reduced the beam energy, thus avoiding any burns or damages on the camera that captures the image.

    Many thanks 

    Rad

    Radhwan Alnaimi · Imperial College London

    Hi Md, 

    Thanks for your answer. I've already captured the profile with D-cam. However just to avoid any surprises with high power beam so I'll try a SMX camera with short focal length objective in front and damp the beam with ODS on the beam path before the lens which I hope it will work.

    Cheers,

    Rad

  • How can we analyse the road traffic accidents of different countries?

    How we can analysis the road traffic accidents of different countries with datas like no of RTA, injuries, fatality and vehicles registered ?

    Grzegorz Karoń · Silesian University of Technology

    Dear Jiří you are right. The most important question is about different levels of evaluation.

  • Can you imagine an Artficial Quantum Element?

    Classical computing was possible by artificial Semi Conductors (npn- and pnp-Transistors). Quantum Computing was always following classical intentions but tried to use latest QM.

    Now we find QM has own rules and we are not able to use the elements in manageable and steerable ways. We need Artificial Quantum Elements  (AQE) whatever they can be.... 

  • Subhash Gupta added an answer in Constitutionalism:
    Can anyone please refer me to journal articles dealing with transformative constitutionalism?

    I am looking at the relationship between transformative constitutionalism and freedom of testation.  I have read articles by Davis, Klare, Moseneke and Van Der Walt and would like to read similar articles from other authors as well as other jurisdictions outside South Africa.

    Subhash Gupta · GD Goenka University Gurgaon

    Respected Sir,
    Below-mentioned are few weblinks related to the captioned topic.

    Preliminary Notes on Transformative Constitutionalism by Upendra Baxi
    http://cscs.res.in/dataarchive/textfiles/textfile.2008-09-01.7968929411/file

    Lectures on Transformative Constitutionalism
    http://www.fljs.org/content/transformative-constitutionalism-and-socio-economic-rights-part-12

  • Alan Parker added an answer in Microemulsions:
    When stop considering micelles and start considering microemulsions?

    At what percentage of ”internal phase” (either water or oil, depending which is the phase added progressively to the system) can we stop considering the existence of micelles and start considering the formation of true droplets? For example, adding 2.5% water to a [Surfactant mixture+Oil] system generates a clear, transparent, single phase. Can this be a microemulsion? Is there such a threshold that differentiates between micelles and microemulsions? Do you know any paper on this topic? What is your opinion on this subject? Thank you.

    Alan Parker · Firmenich

    I agree with the first part of Leo's answer, As we add an apolar substance to "normal" micelles in water, it seems to me that it is an arbitrary choice to decide where "swollen micelles" end and "microemulsion droplets" start. Of course, once we get an excess phase, then we are definitely in the microemulsion region.

    However, I cannot agree with the second part. For a given oil/water/surfactant system, the interfacial tensions between microemulsion phases and micellar phases are surely exactly the same at the transition point. There is no sudden change in interfacial tension as we add oil to a micellar system. The interfacial tension is essentially controlled by the surfactant in the interfacial layer and that is the same for both systems.

  • Do you have the MATLAB code written by Staal which used for retinal vessel segmentation?

    J. Staal, M.D. Abràmoff, M. Niemeijer, M.A. Viergever, B. van Ginneken, Ridge-based vessel segmentation in color images of the retina, Medical Imaging, IEEE Transactions on, 23 (2004) 501-509.

    Nicola Strisciuglio · University of Groningen

    Hello guys,

    you may download also this code for vessel segmentation: http://www.mathworks.com/matlabcentral/fileexchange/49172-trainable-cosfire-filters-for-vessel-delineation-with-application-to-retinal-images

    It is not Staal et al. code but it might be useful for your studies.

  • Who can be a source of intelligent planning method introduced me to it?

    I am looking to learn the technique I used in the management of natural resources.

    Rosa Maria Regueiro-Ferreira · University of A Coruña

    Maybe the Life Cicle Analysis (análisis del ciclo de vida)

  • Laurence Stuart Hall added an answer in Gene Runner:
    Please, I would like to know if it is a problem to have a positive dG in primer self dimer?

    5' GGCATGTAACGAATTTCTTC 3'
    +++ |||
    3' CTTCTTTAAGCAATGTACGG 5'
    dG: 1.5

    Data from Gene Runner

    Laurence Stuart Hall · University of Nottingham

    Hello Flavia

    further to Paolos answer find a link to a a word doc prepared by me on drop box which expalins good primer design including links to software sites that will look at self annealing via hairpin loops/palinodromes and inter annealing between forward and reverse primers culminating in primer dimers; Have a look below

    With specific regard to your structure, the simple answer is you have absolutely nothing to worry about. I say this because many of these compliments are theoretical predictions and in reality exist fleetingly in an actual PCR reaction; that is effectively not at all. If you look at this putatiuve hybrid it cites a dG of '1.5'. This delta G refers to the free energy of the predicted hybrid; In other words how stable it is in reality and how in a steady state environment it is likely to exist. Structures with delta g values of -10kCal or over are predicted to be stable and therefore might pose an actual problem in real time and in the 'real' steady state world. Yours does not. Generally speaking in my experience you should only worry and dG values are >/= -10kCal if

    1. The complimentary bases are at the very ends of primers

    2. The bases annealing are G and C

    3. The number of G/C bases is 3 or more and next to one another

    If the above conditions are not met then primers will not anneal to one another because of steric hinderance, i.e they cannot bind freely to one another and will anneal so weakly that the structures fall apart as fast as they form - in other words the stady state level of this structure is minimal - or the denaturation temp of the PCR cycle will cause these structures to simply melt 

    I hope this helps !!

  • Eraldo Banovac added an answer in Ideas:
    What is an idea?

    How to spark new ideas for future scientific work?

    Eraldo Banovac · Croatian Energy Regulatory Agency

    "Great minds discuss ideas; average minds discuss events; small minds discuss people."

    - Eleanor Roosevelt

  • F. Vissani added an answer in Neutrino Physics:
    Why two additional Majorana phases are introduced in lepton mixing matrix?

    We do not know whether the neutrino is a Dirac particle or a Majorana particle. If neutrino turns out to be a Majorana particle then two additional phases are to be introduced in the 3x3 lepton flavor mixing matrix. Why these phases cannot be removed by field redefinitions. In the two generation case, we know that in the CKM matrix there is no CP violating Dirac phase. Similarly, will the Majorana phases disappear in the two generation case, or, will they continue to be non-zero even in the 2x2 mixing case. In which experiments will they show up.

    F. Vissani · INFN - Istituto Nazionale di Fisica Nucleare

    Hi Biswajoy

    I agree on counting, great!

    The name "Dirac" or "Majorana" is not so clarifying to me, so maybe it is better to speak of phases that matter in this or that observable quantity. The so called Dirac phase matters for oscillations of light neutrinos, whereas the so called Majorana phases matter for neutrinoless double beta decay and potentially for analogous processes where muon is captured and e+ is emitted  (but its importance for what I know is just academic).

    As for ordering rule, oscillations do not break total lepton number, neutrinoless double beta and the other ones do, and the special feature of neutrinoless etc is to break electronic lepton number by 2 units. 

    In practices it seems to me hopeless to reconstruct the Majorana phases by measurements. This is at least what we find in the recent couple of papers with Dell'Oro and Marcocci.

  • How can I determine the composition (as compounds) of a rock mineral sample?

    I understand that rock mineral samples can be analysed for individual elements. But I want to know whether there is an instrumental method to find the composition of minerals in terms of particular compound (in %), say some iron ore contains 30% Fe2O3, 40% Al2O3  and others as 30%. Also I would like to know how to calculate amount of particular compound from elemental analysis?

  • What may be the reason of this fact?

    Hot water extractable (80°C) and easily oxidizable (0,4 K2Cr2O7 + 0,5% H2SO4) fractions of SOM are considered to be the most labile organic compounds. Often they are called labile or active soil organic matter. However, in peat these parameters change with depth in the opposite way.

    Thank you.

    Zenon Hamkalo · Ivan Franko National University of Lviv

    Hi Portia

    This is true. All the details in our article on file.

    Estimation of oxidizing ability of organic matter of forest  and arable soil

     Zemdirbyste-Agriculture, vol. 97, No. 1 (2010), p. 33–40

     Abstract

    The unique method of multi-stage chemodestruction (11 fractions) of soil organic matter (SOM) for the estimation of its quantitative-qualitative composition of forest and arable soils was applied. Substantial differences in oxidative ability of organic matter in the 0–40 cm soil layer of old oak wood and arable land were determined. The forest soil distinguished by more resistant to oxidation and thus more stable SOM as compared with the soil of arable land. A small content of medium-oxidative part up to its complete disappearance in the 31–40 cm layer is the feature of arable soil. The differences in quantitative-qualitative composition of SOM enable the use of the method of multi-stage chemodestruction for the estimation of resistance of SOM to the destruction at different land use.

    Thank you for your attention.