Q&A

ResearchGate Q&A lets scientists and researchers exchange questions and answers relating to their research expertise, including areas such as techniques and methodologies.

Browse by research topic to find out what others in your field are discussing.

Browse Topics

A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
  • Which sociologist in classical term (1700-1900) was interested in natural sciences like ecology?

    Is there any study has been done related this issue?

    Rainer Egloff · ETH Zurich

    Patrick Geddes was an important influence on the early Sociology Department at the University of Chicago. Early W.I. Thomas was much impressed with physiology and biology, and the classical Chicago School with Park and his students was certainly much interested in ecology and other biological fields.

  • Nancy Van de Casteele asked a question in Reliability:
    Variable optical attenuator reliability?

    Hi,

    I am looking for data regarding the reliability of variable optical attenuators InGaAsP/InP?

  • Can someone help me with Protein Purification using Ni-NTA?

    I am working on a protein, that I tried to express in BL-21 cells. This protein is an integral membrane protein, so I tried harsh buffer conditions to take out this protein in soluble form. The gene responsible for this protein has been cloned in pET28 vector. I am using Ni-NTA to purify this protein, but I am not able to purify it. After purification, I am getting three more proteins of 45, 47 and 47 kDa, with my protein, that is 41kDa. I have used 500uM imidazole for elution, but I didn't get any protein, so I tried 250mM imidazole for elution. Please suggest me, what else I can do to purify it. I can not go for western blot, as we lost this protein primary antibody.

    Muralidhar Reddivari · St. Jude Children's Research Hospital

    1) change the tag position 

    2) clone a Strep tag along with the his tag and try N and C term and try TAP purification

    3) have the proteins identified to be absolutely sure that they are degradation products

    4) if you are able to refold the protein, then ion exchange chromatography or HIC should separate those proteins.

    5) Add AEBSF as a precaution and as mentioned above try at 4C

    6) try Guanidine HCl instead of urea for solubilization 

  • Yingyun Gong added an answer in Insulin:
    Which method identification do you prefer to normalize insulin secretion?

    Q1 When comparing islet or INS-1 insulin secretion capacity, it is usually calculated on a per islet basis or normalized to DNA or total protein. What's the difference between them? And which one is preferred?

    Q2 As for GSIS or KSIS, will the released insulin affect the total insulin content?

    Yingyun Gong · Nanjing Medical University

    Dear Jonathan Barlow,

    Thanks for your delicate explanation, Your words, "It is important to recognise that pancreatic islets display heterogeneity in their ability to secrete insulin, so much so that some islets will not secrete any insulin at all in response to a high glucose concentration", really remind me of the others' finding that among all the beta-cells in a single islet, the response varies from cell to cell. Some cells are sensitive and  others may be slow. Will this also be possible for islets? And how to make it out? During GSIS processing, 8-10 islets per well. Is it necessary do pre-stimulation to recognize unresponsive islets? 

    Best wishes,

    Yingyun Gong

  • S. Curtze added an answer in SAED:
    What are the limitations of TEM-SAED in terms of phase discrimination?

    As a non-TEM user, I just came accross the following question: Assuming I have a phase that can be either space group 161, i.e., trigonal (-3m) crystal symmetry, or SG 176, i.e., hexagonal (6/m) crystal symmetry, can I differentiate between them based on SAED reflexes? Are there particular orientations of the zone axes where I can, and others where I can't?

    An additional question: If you were to performe phase ID, what technique(s) would you use in case that high spatial resolution is required, i.e., bulk diffraction techniques cannot be used?  

    S. Curtze · NACON - nanoANALYSIS CONSULTING OY

    Hi Volker,

    That's what I thought. The data shown is not mine. The indexed electron diffraction pattern shown above stems from a publication in a high profile magazine, where it was commented that the pattern has been indexed as hydroxylapatite. I'm having trouble to follow that arguing, or is that anything that requires arguing? 

    I don't see from the pattern that it is hydroxylapatite, and I don't think the indexing can be correct, or is there some way of notation where lattice space and reciprocal space are interchanged, transformed or anything I don't understand? 

    I rather don't want to mention the paper on a public forum as I don't intend to discredit the authors, especially since it is a fantastic piece of work that I wish I had written myself. It's rather for me to see how my, mostly not too good quality EBSD and EDS data compares with that.

  • Michael Brückner added an answer in Protege:
    Is there any other software except eclipse (JAVA) which can be used to retrieve data from protege ontology?

    I already used eclipse (JAVA) to retrieve data from internet and to extract the result from protege ontology. However, there is a limitation to perfectly retrieve the fuzzy ontology results. Can anyone tell me that is there any other software which can be easily used to retrieve ontology data.

    Michael Brückner · Naresuan University

    You may want to try a SPARQL application running a JENA Fuseki server described in the document linked below (see Section 4). It's from Noureddin Sadawi (Brunel University)

  • Jan Mischke added an answer in Ohmic Contacts:
    How can I achieve ohmic contacts to p-GaN core-multishell nanowires?

    I am trying to contact core-multishell GaN nanowires with a n-doped core and a p-doped multishell radial around the core via E-Beam lithopraphy. To characterize them I tried to realize ohmic contacts with Ni/Au to the p-doped GaN-shell. Because of the geometry of the wires I need to vapor deposit 30nm Nickel/300nm Gold to make sure, that the contact path doesn't ripp off the wire after the evaporation. Does anyone have experience with contacting p-GaN nanowires with Ni/Au and the formation of ohmic contacts? I tried several temperature steps in the RTA without any big impact on the results (up to 590°C). Thank you very much

    Jan Mischke · University of Duisburg-Essen

    Yeah we did the activation of the Mg-dopands before the metal deposition.

  • Aksel Seitllari asked a question:
    Can anybody provide info regarding CANFIS usage?

    Can anybody provide info regarding CANFIS usage?

  • What are the best performance measures regarding assessment of sustainability initiatives?

    I would like to investigate this further....

    John Hambrey · Hambrey Consulting

    Big question, short answer: A key indicator set (which may encompass e.g.carbon footprint but is more comprehensive) relates to resource use efficiency per unit value of product, or  (ideally) per unit value added. Its really important to use value as the denominator rather than volume, because value per unit anything, rather than volume (wgt) is what we should be aiming for. 

  • Maciej Pyrka added an answer in Absorption:
    Is it possible to calculate energy of vibrational excited states in GAMESS??

    Now, I just declare the number of states by using NSTATE flag. I supposse this flag concerns electronic states. What about vibrational?? The issue is about absorption, I try to determine wavelength of maximum of absorption

    Maciej Pyrka · University of Warmia and Mazury in Olsztyn

    Eugene,

    First, thank you for response.

    So, it means that all excitations energies originate just form electronic levels?? If it's true, there is one question: How the absorbtion spectrum is plotted on the base of calculations?? There should be shift between wavelengths from computation and experiment caused by not taking into account oscillations levels.

    Regards 

  • Is it possible to produce an 8-kDa recombinant protein(with His tag) in E.coli ?

    Hi

    Is it possible to produce an 8-kDa recombinant protein(with His tag) in E.coli ?

    Muralidhar Reddivari · St. Jude Children's Research Hospital

    Yes it is possible. Make sure you look at your gels carefully and use the correct size exclusion columns for purification

  • Why are we all so forgetful? Is the crisis of economics over?

    Only 5 years ago, most of economists questioned the present state of economics. See, for example, Victor A. Beker's analysis "On the Economic Crisis and the Crisis of Economics." http://www.economics-ejournal.org/economics/discussionpapers/2010-18

    Paul Frimpong discusses in his recent blog post "Crisis of economics or Economic Crisis?" Part 1 and Part 2 http://www.modernghana.com/news/573340/1/crisis-of-economics-or-economic-crisis-part-1.html  "what is the new economic thinking approach?" But this is rather an exception. Major scheme of economics did not change at all and we are beginning to forget the crisis which lies in the depth of economic science. Why are we all so forgetful? Is the crisis of economics over?

    Yoshinori Shiozawa · Osaka City University

    Jorge Moromisato,

    thank you for your information on the origin of political economy. You are as audacious as Nicholas Kaldor who stated that economics went wrong at the middle of the fourth chapter of Book I of Wealth of Nations. (Kaldor, 1972, The Irrelevance of Equilibrium Economics, Economic Journal § II)  

     I was also interested  in your career. What has driven you to study economics after a long research life in high energy physics? As a high energy physicist, how do you think of my discussion in the question "Is saving necessarily invested or not? How can this contradiction in Keynes be solved?" 

  • To determine the concentration of trace amounts of phenol in aqueous solutions, which technique is better: HPLC or UV-Visible spectroscopy?

    Thanks for the contribution in advance.

    Narong Chamkasem · U.S. Food and Drug Administration

    The question is to determine "trace" amount of phenol in water. The spectrophotometric alone cannot distinquish between the target and interference having the same absorbance spectra or close to it. If you do not substract blank matrix that has similar interference as the sample, most likely you will over estimate or would not have enough sensitivity becuase the analyte with small concentration is buried in the larger quantitity of interference. So, if you want selectivity and sensitivity, go for HPLC to get selectivity and may get enogh sensitity if you do SPE for sample prep to concentrate the analytes in the sample.

  • Is there anybody who can remember the name and the author of the book which developed the concept of Moment of Truth before it was used by P&G?

    In 2006, Procter & Gamble announced that they were focusing on the "First Moment of Truth". If I remember well, before P&G, there was a book which developed this concept of Moment of Truth but I can not remember it. Any idea?

  • Kelly Miller added an answer in Meninges:
    Why do protocols suggest the removal of meninges when isolating microglia?

    Almost all protocols that isolate cells from neural tissue suggest the removal of meninges from the brain. Yet none provide reasons for this.

    Anyone have any idea what effects meninges will have? I am interested more so in flow analysis rather than culture. Thank you.

    Kelly Miller · Charité Universitätsmedizin Berlin

    Unfortunately, there is nothing definitive as CD45 can be increased in activated microglia, thus also making them CD45hi, like the macrophages-especially if you're working in any kind of disease model.  The purinergic receptor P2Y12 is specific for resident microglia, but is not expressed when microglia become activated, so also only useful if you expect that you have no inflammation.
    If you don't anticipate a highly inflammatory reaction in your model and you perfuse your mice well, you'll probably only have a small macrophage population anyway.

  • Charalambos Neophytou asked a question in Netherlands:
    Can you help me get more informations about oak provenances from the Netherlands?

    Dear colleagues,

    Currently I'm working on provenance trials and progeny tests of oaks in Germany and I need more information about two pedunculate oak (Quercus robur) provenances from the Netherlands. Their names are: Nuen-02 and NL-3. They were used in a provenance trial established in 1996 in Germany and were characterized as "special provenances" (Sonderherkünfte) i.e. showing especially good phenotypic traits (growth, stem form etc.). In spite of an exhaustive search I did, I couldn't find more information. Can you provide me more info about this provenance or some tips how to search for it?

    Thanks in advance :)

  • Prasanth Kumar added an answer in QSAR:
    What is QSAR with COMFA and COMSIA ?

    QSAR with Comparative molecular field analysis (COMFA) and comparative molecular similarity index analysis (COMSIA)

    Prasanth Kumar · Gujarat University

    Comfa deals with electrostatic and steric fields to correlate activity. Comsia utilizes SEAL similarity fileds that also inegrates hydrogen bonding potentials to correlate activity. The form of Lennard-Jones potential is varied among these two QSAR methods.

  • Lakshmi Narayana Lavu added an answer in Taqman:
    Taqman probe PCR is failing to give fluorescence in qPCR. While the product is being amplified after cycling of same. Why?

    Dear All,
    I hope everyone is doing good.

    I got 2 sets of primers and probes for a duplex PCR to screen for CamVP35 promoter region and Nos Terminator region detection. (I attached an excel sheet-list of primers and probes) and mentioned below

    5’ FAM-CAAAGATGGACCCCCACCCACG- BHQ1 3’----P35 probe
    5’ HEX-ATGGGTTTTTATGATTAGAGTCCCGCAA-BHQ1 3’ ----Nos probe
    5’ GCCTCTGCCGACAGTGGT 3’------P35 Forward primer
    5’ AAGACGTGGTTGGAACGTCTTC 3’------P35 Reverse primer
    5’ CATGTAATGCATGACGTTATTTATG 3’------Nos Forward primer
    5’ TTGTTTTCTATCGCGTATTAAATGT 3’------Nos Reverse primer

    Both the probes were HPLC purified and primer sets were desalted.

    I request you to look at the list.

    When I received these oligos and probes. I made 100microM stocks with 1X TE solution. Primers are OK but two probe solutions are in dark ash color ( I thought BHQ1 might be the reason).

    I did the standard curve experiment as per an ISO method (the sequences were published in ISO: 21569 recent edition) for this system with known gDNA standards. I fell sick seeing the data... there is no reaction crossed the baseline (actually while monitoring the run the fluorescence was in -0.04 level and did not touch the 0 at all).

    I checked the PCR products (for P35 it is 84 and for Nos it is 82bp) on 4% agarose gel. all the reactions with known standards gave a clear specific amplification with a little primer dimer at bottom. NTC gave nothing. I did one more qPCR with them following kit recommendations (Promega A6102). Using 900nM primers and 250nM probes (gave no result)

    Thought to put a simplex PCR separately for two detection systems. Even then I dint see positive fluorescence. I observed Nos detection system with HEX (-0.1) gave lesser fluorescence than FAM (-0.04).

    I am sure about few things that
    1). gDNA standard I've used is perfectly alright (giving positive amplification with routine PCR and its quantification data shows that it is good with purity and quantity)
    2). Next is primer sets I ordered and used are working (+ve size with STD and no band in NTC on gel).
    3). Water I used is nuclease free water provided along with promega kit.
    4). My equipment is working fine (thermal cycling is OK proved my gel, but optical detection system was calibrated by factory for dyes Cy5, FAM, Green, Hex, ROX, VIC )

    I did not understand the problem, whether the qPCR probe mastermix is not performing 5’ exonuclease activity for probes (it is giving amplicons of desired size after cycling-proved by gel). Or The probes that I ordered are not good (I reconstituted them as per one document of ABI-life tech, using 1X TE solution to dissolve and 1X TE to dilute for both probes and primers avoided exposure to light by wrapping tubes with reflecting foil).

    As a newer to this technique, I am totally confused how to proceed and overcome if there is problem within the protocol.

    Dear all I am requesting your help in solving my problem. Kindly do this favor.

    Thank so much,

    Lakshmi Narayana Lavu · Spinco Biotech Pvt Ltd.

    The sequences of primers and probes that I mentioned above were published by ISO in ISO 21569 -2013 amendment 1. I did not change their sequence but altered the 5' dye of 2nd probe from Yakima yellow to HEX. Because illumina system was not calibrated for YY but for HEX. this was the only change i've done. 

    Once after receiving the vials from synthesizer I double cross checked the mentioned sequences in its data sheet against the order we released and that ISO. everything was fine but no fluorescence after PCR.

  • Islam Saadeldin added an answer in Stem Cells:
    What are the factors affecting stem cells differentiation in vivo or in vitro?
    There are several factors affecting stem cells differentiation during embryonic development stage. I would like to discuss these factors together through your research and your experiences. Either in vivo or in vitro .
    Islam Saadeldin · Zagazig University

    From my experience; using feeder cells maintain the normal morphology of oligopotent ESCs (trophoblasts) however using Matrigel (basement membrane matrix) stimulate differentiation into elongated spindle like cells. 

    I would like to share a time-lapse video I captured during my experiment.

    https://www.youtube.com/watch?v=laLia1RVmEc

  • Bernard Maroy added an answer in Neuropathic Pain:
    How does a spontaneous neuropathic pain become a spontaneous ongoing neuropathic pain?

    Could somebody explain to me how a spontaneous neuropathic pain becomes, step by step, a spontaneous ongoing neuropathic pain?

    I found a very good explanation of the first type of this spontaneous condition, below:

    "Ectopic hyperexcitability may occur in neuroma endbulbs, regenerating or collateral sprouts, patches of demyelination, and the cell soma in the dorsal root ganglion, as well as perhaps in neighboring “uninjured” neurons. It is reflected by spontaneous firingin some neurons". Devor, 2013 in Textbook of Pain p. 861.

    In fact, the first problem is to understand why "neuropathic, spontaneous pain " occurs.

    If the cause fails to be traeted, it is'nt surprising that it goes on.

    In my experience, the main cause of neuropathic pain is depression, which is a neuro-biochemical illness with plurisystemic features.

    Details in the joined english abstract of my book in frech, precising the neuro-functionnal mechanisms of the type of pain.

  • Robert Miller added an answer in Psychology:
    Does anyone know psychologcial / cognitive stress induction task?

    Does anyone know any psychological / cognitive stress induction task? Or maybe some review paper. I mean any other than TSST.

    Robert Miller · Technische Universität Dresden

    Well, there is a large number of stress tests available, but their appropriateness really depends what you are trying to achieve. Physiological stressors, for instance, mostly drive activity of the sympathetic nervous system, whereas socioevaluative stressors are also capable to induce HPA axis activity. Moreover, one might consider the tradeoff between utility and ressources that are required to implement a specific stressor.

    I attached two recently published articles that compared different stress protocols.

  • Do you think the Big technogies such as Social media, Mobile, AI, Cloud and Analytics is going to affect education?

    Recent IT technologies such as Social media, analytics etc is affecting and going to affcet the way we think, the way we imagine and the we way analyse. The higher education is going to get affected. Open learning platforms such as Moocs are creating waves and affecting the way we look at teaching learning process.

    Daniel Tan · Taylor's University

    The traditional paradigm was that schools develop curriculum (that is, content, at what ever levels) to meet specific and immediate needs of eventual employment in industry.

    The emerging paradigm is that schools design pedagogies of the curriculum to ensure employment for jobs yet to be invented. In other words, the shift is towards not what they learn, but how they do so.

    This is reflected obliquely in the world by Levy and Murnane (see Fig 1 of link and pdf file) in which there is a downward demand for skills which are routine. Students which such outcomes are usually taught in the traditional instructivist teacher-centric way.On the other hand, the skill sets where employers are demanding are the experts (analytical non-routine, complex, expertise). What is insightful is not what content is taught but how, and how students are learning towards lifelong learning.

    Today, we read of rising undergraduate unemployment. Some attribute this to structural changes in the economies, with slow growth and hence low demand. When asked, employers are saying that they are looking for graduates, but they lack the skills needed.

    So, to get to my point, what will affect education is not so much the technologies, but how we train our students to think, analyse and be lifelong learners with abilities to look for information, gain insight, make sense and communicate or apply that effectively. It will be such soft skills that they develop as outcomes of learning that will make education useful, relevant and purposeful. This is central, with technologies in the peripheral, supporting and enabling students to become thinkers and master users of what technology can empower them.

  • Jinlong Li added an answer in Simulink:
    How to make an interface between Matlab/simulink 7.9 and PSCAD X4?
    I am trying to make an interface between matlab/simulink 7.9 and PSCAD X4, but all user’s manuals for PSCAD from Manitoba describes how to make that interface with older versions of matlab and PSCAD. Does anybody made any interface between these versions and had any success in it?
    Jinlong Li · shihezi university

    My answer to the question is presient in the attachment

  • Matthias Bönisch added an answer in Vegard's law:
    Is anyone familiar with the Vegard's Law?

    I am replacing Ti in place of Zr in Zr3Al. For example I have replaced two Zr atoms by Ti in Zr3Al and I found ZrTi2Al is found to be in hexagonal structure where as Zr3Al is cubic structure. How do I calculate the lattice parameters of ZrTi2Al using Vegard's law. The general formula I am adopting is AlTixZr3-x  and x values are from 1.6 to 2.  If someone can give me the correct formula for finding the lattice parameters for all the compositions, it will be helpful for my research activity. 

    Matthias Bönisch · Leibniz Institute for Solid State and Materials Research Dresden

    @ A.U. Daniels

    Thank you for the hint. I expanded the Wikipedia entry:

    http://en.wikipedia.org/wiki/Vegard%27s_law

  • Does the 16S rDNA gene have introns and would the cDNA of 16s rRNA gene be amplified using primers designed by the DNA gene sequence?

    Im doing a qPCR for bacteria 16s relative quantification. Im have primers design using the DNA sequence, would thay work to amplufy the cDNA?

    Martina Schrallhammer · University of Freiburg

    You are right, i should have used the precise term (as the authors called it): internal excised element (IEE). But i expected that people will not be familiar with this expression.... Any case, the fragment is present in the gene sequence and excised from the mature ribosomal RNA.

  • Sumit Maskey asked a question in Flac:
    How can I assign the shearing rate in a direct shear test for rock in FLAC?

    I have been bit confused on assigning shearing velocity in FLAC for the direct shear test of rock joints.

    For Example:

    In my direct shear test experiment,

    total shearing distance (say, a): 10 mm = 0.01 m
    shearing rate applied (say, b): 0.10 mm/min = 0.0001 m/min

    Time step applied in FLAC: 8000

    So, I was confused whether the, velocity assigned would be; [a/8000]=[0.01/8000] or [b/8000]=[0.0001/8000] in FLAC?

    Moreover, I was also concerned whether I can apply the real shearing rate i.e., 0.1mm/min as in my experiment in FLAC.

  • Vladimir Farber asked a question in Upconversion:
    Can anybody answer a few questions on nonlinear optical process?

    Since I have a little understanding of nonlinear optical processes, then I want to develop some expertise about them. My knowledge about  nonlinear optical processes is mainly based on the book "Nonlinear optics" of the Boyd 2ed, and my questions are around this book:

    1)Which model of the nonlinear susceptibilities is more precise, one which derived from Maxwell equations or one which based on Quantum-Mechanical Theory?

    2) If we want to perform upconversion, for example with proustite crystal, I need to use d_eff, in the table 1.5.2 ("Nonlinear optics" of the Boyd 2ed) we have two parameters d_22 and d_15, how we obtain from them d_eff?

    3) If we enter in the non-linear crystal (with second order susceptibility (kay2)) with two waves, how we (from the physical point of view know ) know which nonlinear process will be dominant: sum frequency generation, difference frequency generation or second harmonic generation?


    Thank you in advance!

  • Ravi Lokwani added an answer in Freeze Drying:
    What is the color of glycosaminoglycan crude mixture after freeze drying?

    After obtaining pellets by centrifugation of ethanol precipitated mixture, I dissolved it in de-ionized water and done characterization studies by using colorimetric assay from Blyscan the data confirmed the presence of glycosaminoglycan both O-sulfated type and N-sulfated type and then I placed the sample in -80 degree for two days and then I placed the tubes for drying in freeze dryer. I got very less amount of brown color sticky material in my tubes. I want to know, that the brown color obtained after freeze drying signifies what?

    Ravi Lokwani · Universiti Malaysia Pahang

    Thanks Ana, your answer is very helpful for me.