Q&A

ResearchGate Q&A lets scientists and researchers exchange questions and answers relating to their research expertise, including areas such as techniques and methodologies.

Browse by research topic to find out what others in your field are discussing.

Browse Topics

A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
  • Afaq Ahmad added an answer in Philosophy:
    Can ethics be measured objectively?
    Ethics, ethical committee, ethical approval and other ethical related words are extensively used on Researchgate and other places. How to define and measure ethics in objective bases?
    Afaq Ahmad · Sultan Qaboos University

    Dear Dr. Ahed Jumah Alkhatib,

    Ethical values differ from system to system. If even possible to measure those need different measuring scales. Further, in measuring systems we need accuracy and benchmarks.  

  • Justin Morgenroth asked a question in Fusion:
    Fusion GroundFilter parameter optimization

    Hi all,

    I'm toying around with the GroundFilter tool in the USDA Forest Service software Fusion. The GroundFilter tool specifies that the default parameter values for the gparam and wparam switches are adequate for las files with point density greater than 4. But my files are low density las files, so I'm trying to optimize the gparam and wparam values in order to get an output with only ground points. I've verified (using lasview) that the default gparam and wparam values are inadequate for my low density las files...there are a lot of outliers remaining above the ground points.

    Are there any rules of thumb or best practice techniques for altering these parameters in order to get the best possible result?

  • Khaled Hussein added an answer in Graphene Oxide:
    Can any one tell me a simple method for Graphene oxide preparation ?

    I need simple chemical method for graphene oxide preparation with short time ...

    Khaled Hussein · Mansoura University

    Thank you very much ....

  • Steve Faulkner added an answer in Nature:
    What evidence would be needed to prove Nature is intrinsically mathematical?

    As opposed to mathematics being an invention, what evidence would convince us that mathematics is there already in Nature?

    Steve Faulkner · Logical Independence in Physics

    Thank you for your contributions.  Do you not think the mathematics of apples is distinct from the mathematics of space or water, and these different entities possess different mathematical behaviours and so mathematics is a behaviour not language?

  • What is the best method for tuning PID controller parameters?
    I want to find PID parameters to regulate my system.
    Kouba Nour El Yakine · University of Science and Technology Houari Boumediene

    thanks Alina

  • Does anyone knows of studies on the concept of Infinite from an anthropological point of view?

    Metaphysical conceptions of the Infinite in particular cultures or in a cross-cultural perspective; interdisciplinary studies on this theme, between Philosophy and Cultural Anthropology.

  • Thierry Mikaël Cornu added an answer in FLUENT:
    How can I estimate uncertainty in the predicted result of CFD?.

     I have done a steady simulation of an optimized case using K-Omega SST turbulence model .I have an optimized model for a low speed application and the operating condition is fixed.The benefit, as predicted by Ansys FLUENT, is encouraging but how can I compute the uncertainty?

    Thierry Mikaël Cornu · École Polytechnique Fédérale de Lausanne

    By the way, do not forget that your case of reference is also subject to uncertainties (even if validated), as well as the experiments.

  • Faik Hamad added an answer in Conservation Laws:
    What is the difference between differential and integral forms of Navier-Stokes Equations and their usage ?

    Hello everyone,

    I am reading CFD by John D. Anderson. I understood the derivation of different forms of Navier-Stokes equations. But it is still unclear for me what is the fundamental difference between Integral and differential forms of the Navier-Stokes equations. It is also not clear for me where are these forms used ?

    I always see all the explanations based on the Differential forms so I am wondering if the integral forms are used ?

    Another thing : Please correct me if I am wrong ::

    The conservative and non-conservative forms are called like that because, the conservative forms are derived from a conservation law and the non-conservative forms are not.

    Faik Hamad · Teesside University

    The differential form mean to divide the control volume into a large number of small elements and apply the continuity, momentum, energy ...etc as in CFD software.

    The integral form consider the control volume as one element and apply the  mass, momentum and energy equations. 

  • Robert Polk asked a question in Enaction:
    Empirical studies of enactment?

    I am looking for studies describing how others have empirically studied human enactment in natural settings.  Any recommendations?

  • Vincent Brechin added an answer in Senescence:
    What is the best positive control for senescence?

    I'm looking to detect senescence in Zebrafish embryo and I need a robust control positive (and negative).

    Kishi Shuji suggest BHP but exists a better control?

    Vincent Brechin · Claude Bernard University Lyon 1

    Thanks all for your answer.

  • Are students grade-seeking or competence-seeking?
    Are the students in your program more concerned with developing professional competence or are they focused on getting the points they need to get a grade? Are we doing all we can to foster self-directed learning or do we reward 'load and dump' behavior with honors at graduation?
    Gregory L Alston · Wingate University

    Hana and Gloria are on point. The goal should be skill  development using what Carol Dweck refers to as a growth mindset. Only through failure do we learn what we don't know.When we are confronted with our own shortcomings and recognize this deficit is the moment we are inspired to learn to overcome. Typical lecture test strategies are educationally unsound if the goal is to develop skill.

  • Vladimir D. Ilyin added an answer in Copyright:
    What are the disadvantages of the current system of copyright protection the most detrimental to the development of science?

    With which of them you had to face? Please share with us your experience.

    Vladimir D. Ilyin · Russian Academy of Sciences

    Dear @Ljubomir, 

    Thanks for the answer and links.

  • Yin Li added an answer in Carbon Nanotubes:
    How to explain the Raman intensity enhancement of multi-walled carbon nanotube after functionalization ?
    I have compared Raman spectra of pristine MWCNT with MWCNT functionalized by carboxylic group. Both of them were purchased from one commercial supplier. I found that the Raman intensity of the functionalized MWCNT was significantly enhanced with respect to pristine MWCNT. Interestingly, the RBM becomes visible in MWCNT-COOH. Anybody could explain these observations?
    Yin Li · University of Pécs

    Hi, Ana! Thanks for caring about this issue! The presence of amorphous carbon or other impurities in raw materials could have a shielding effect on the Raman intensity of CNTs. I think both G/D ratio and D/G ratio are usable. But I prefer to use D/G ratio since it is easier for me to understand the amount of defect. The increase of this ratio represents the increase of the structural defects of CNTs.

  • Dominique Ectors added an answer in XRD Analysis:
    How do I prepare a powder sample to calculate the lattice parameters by XRD analysis exactly?

    Lattice parameters calculated by XRD analysis.

    For example, how to eliminate the effect of sample position or powder density on the calculation results?

    Dominique Ectors · Friedrich-Alexander Universität Erlangen-Nürnberg

    Blend your sample with some standard material like Nist SRM 640d for exact measurements. You can however use some cheaper lab standard with well known lattice parameters of high purity e.g silicon. 

    Regards

  • Jagpreet kaur Gill added an answer in Alginate:
    Encapsulation in calcium alginate beads

    Hello I am currently working with the encapsulation of laccase in calcium alginate beads. I am also following the optimised conditions of my previous graduate collegue. So she optimised the highest encapsulation yield using 1.5% alginate(w/v) with a protein loads of  1.5mg/mL (1:10w/w, protein:alginate ratio). Now the protein that we get from our ultrafiltrate enzyme, we  obtain  from 1g of  lyophilised enzyme-15mg protein. Therefore, according to my understanding i should add 0.1g (containing 1.5 mg protein) powder to 1 ml of 1.5% alginate (to get a ratio of 1:10 w/w-protein to alginate). The problem with this is that it is not a homogenous mixture, even if i dissolve this 0.1g in 1 ml water and then add it to the 1 ml alginate, it is very viscous and has numerous lumps. I really need  help with this. Thank you

    Jagpreet kaur Gill · McGill University

    Hey Enrique, the problem with changing the temperature  and  ph is that we are working with enzymes (sensitive). So i dont think i can change the ph. And if i change the percentage, i may get a final concentration of 1.5% but i wont get an enzyme to alginate ratio of 1:10 (w/w). Thanks anyway :)

  • Has anyone used the inducible RNAi vector pSingle-tTS-shRNA to knock down a gene in mouse cell line?
    I have constructed shRNA sequences into this vector and am trying to get a single stable colony which can be used for an inducible knockdown, but with no success. I tried 4 different shRNA targeting a gene's 3'UTR and screened totally 12 stable colonies so far and observed neither basal knockdown nor inducible knockdown. I used 3T3 cell for this purpose and used 1 ug/ml doxcycline for induction for a period of 48 hours.
    1) Is their any way to test the knockdown efficiency of each different shRNA constructs in a transient experiment without using siRNA?
    2), How difficult is it to get a stable expressing cell line which can be induced for nice knockdown? The manual says typically they have to screen roughly 30 stable cell lines to get a good one, is this true?

    Any suggestions will be appreciated.
    Neeraj Agarwal · University of Colorado

    I used pSingle tTS shRNA vector with Neo selection

  • Roberto Bruna added an answer in Steel:
    What is the sequence of addition of Al, ferro-manganese and ferro-silicon in steel melt during the deoxidation process?

     The correct sequence is to add weaker to stronger deoxidizers. Accordingly,  the ferro-manganese is added first followed by  ferro-silicon and  then Al  in  the last.

    Roberto Bruna · Ternium

    I agree with Mr. Madias: "The usual meltshop practice for aluminum killed steel is to ad aluminum first, then ferroalloys". The addition of a strong oxide forming element is the most commonly used method of reducing the oxygen content of liquid steel.
    Use the Ellingham diagram to help you decide which of the following may be suitable (cheapest) choices for this. In a process route including a VOD (vacum oxigen decarburaztion), some industrial practices intend to reduce the alumin consume (and cost) by decarburization reaction but this require (at least) to adjust the initial oxigen content and to adequate the slag properties

  • Detlef Brem added an answer in Cultural Studies:
    What is the history behind Cultural Sensitivity?
    Required for a paper.
    Detlef Brem · Evangelische Bahnhofsmission Fürth e.V., Germany

    Dear Anya,

    your topic "the history behind Cultural Sensitivity" is quite general. In my opinion there are several levels or lines and a "history behind Cultural Sensitivity" can be reconstructed for each level.

    For example: You can use a special situation of a continent, nation, country, region or town, characterised by concrete social, political, cultural or historical frame conditions and ask about the meaning of "Cultural Sensitivity". If you analyse the changes or transformations along the time line, you can reconstruct the special history of Cultural Sensitvity relating to a continent, nation, country, region or town. In West Germany actually, for instance, "Cultural Sensitivity" is an ever growing ability, because there are more migrants with their own cultural, social or political backgrounds. So you have got since about 10 to 15 years a multi-cultural society (before it was one unique cultural area). So the members of this society are now in need, how to live together with the new fellow citizens, respectively they have to learn it. Often people with a foreign background release fear, anxiety or threat amongst the indegenous people.That's the ideal culture medium for the development of prejudices. So you need interventions / programms like interculturell trainings or cross-culture assimilators, in order to acitivate mutual understanding sympathy, compassion, empathy between foreign and indegenous people, so the can live together in a good way (see social-psychological studies).

    If you are using Canada, the United States, Japan or France as example, you will discover, that "Cultural Sensitivity" plays different roles and there are different historical development contexts. For example, in U.S. racial segregation was an important topic after World War II; so many social-psychologicial interventions were worked out.

    Another example: Based on the term "Cultural Sensitivity" you can ask: "What is the history of this term? When was it used first? Who used it first? How was it used first? (and so on...) In my opinion "Cultural Sensitivity" is a young term: social-psychological reasearch on prejudice began in the fifties (Allport, 1954, The nature of prejudice) and cultural studies began in a similiar period.

    Last example: You choose the phrase "the history behind Cultural Sensitivity". Perhaps you consider "Cultural Sensitivity" as an ostensible term and you want to know the subtext behind the term. In my opinionthe subtext behind the term Cultural Sensitivity is the appearance of stereotypes, prejudices and discriminations.

    If the phrase "the history behind Cultural Sensitivity" has got another meanings for you, please tell me.

    Good luck and kind regards

    Detlef

  • Which Sensors are useful to develope an Electronic Tongue?

    N

    Cristhian Manuel Duran · Universidad de Pamplona

    Thanks

  • Is logical independence of the square root of minus one a consequence of arithmetic's incompleteness?

    In a formal arithmetical system, axiomatised under the field axioms, the square root of minus one is logically independent of axioms.  This is proved using Soundness and Completeness Theorems together. This arithmetic is incomplete and is therefore subject to Gödel's Incompletenss Theorems. But can it be said that the logical independence of the square root of minus one, is a consequence of incompleteness?

    Steve Faulkner · Logical Independence in Physics

    The predicament I am faced with is this.  In a paper I am writing I am following up the work of Toamasz Paterek et al.  I give the reference below.  The authors of that paper use a formal system involving logically independent statements.  The authors say that their system is not incomplete and is therefore not subject to  Gödel's Incompletenss Theorems.  In the paper I am writing that follows their work, I am using an arithmetic that is incomplete and I wonder if I can make any claims regarding incompleteness and the independent statement I use. 

  • John Grehan added an answer in Fossils:
    Why Australopithecine type hominids are missing in South Asian fossil record?

    Because environment was becoming colder and ecology turning to grasslands unfavorable for the later hominoids and hominids

    Marc,

    I agree that Ramapithecus/Sivapithecus is apparently closer to orangutans than honinids, but that does not mean that it had nothing to do with African hominids. I would be interested in what you cite as evidence (other than incongruence with molecular phylogeny) that thick (molar) enamel is primitive. Also, the characters we cite for australopiths being related to Homo are as follows and I would be interested in any refutation you would offer (numbers refer to ref numbers in our publication).

    9 pubic ramus long, 10 ilium superoinferiorly short, 11 ilium expanded posteriorly, 12 iliac crest (tubercle) thickened, 13 anterior inferior iliac spine, knoblike, 14 anterior inferior iliac spine near acetabulum, 15 linea aspera present, 16 spiral line connects to linea aspera, 17 femur condyles unequal, 18 femoral neck thickened inferiorly, 19 femoral shaft outwardly angled, 20 two tibial tubercles, 21 lateral tibial facet concave, 22 lateral prox. tibial facet level with medial facet, 23 distinct angle at L5-S1.

  • Jiesi Luo added an answer in iPSC:
    Anyone differentiated ESC or iPSC into cardiovascular progenitor cells based on the protocol published on Cell Research by Huang-tian Yang's group?

    Hi, has anyone successfully reproduced the protocol for CVPC differentaition by Huang-tian Yang's group? I am thinking about the CVPC differentiation and it seems that it is a nice protocol but we just failed to reproduce the cardiac differneatition part. So anyone tried that before?

    Jiesi Luo · Yale University

    Saleh, thank you so much for summarizing this, very helpful.

  • Can anyone help with analysing the curing stress and displacement fields in a composite sandwich structure using ABAQUS?
    Hi,

    I'd like to apologize in advance if this topic is too long/verbose for this forum, this is actually my first post and I haven't been around for too long so I don't really know what's appropriate to post and what's not around here. But hopefully someone can point me in the right direction, here's what's troubling me:

    I'm analyzing the residual stress and displacement fields in a sandwich structure under thermo-mechanical stress using Abaqus. The structure is made of 5 layers, from bottom to top: an ultra high molecular weight polyethylene layer, a fiberglass/epoxy [0/90] composite layer, a wooden core, a fiberglass/epoxy [90/0] composite layer, and a non rigid thin polymeric top layer. This sandwich is rectangular with width, w, length, L ~= 15*w, and height h ~= w/15 such that I'm modeling each layers as a shell in Abaqus.

    The sandwich is initially put between 2 layers of steel to create a slight curvature in the structure (curving radius of about 20-30 meters) when the epoxy is not cured yet. A few dozen bars are then applied on the top steel layer and the structure is heated up to about 80 degC on the outsides of the top and bottom steel layers for 15 minutes before being cooled down to 35 degC once the epoxy has cured. The excess epoxy can freely escape the sandwich during curing process from either sides in the lengthwise direction of the sandwich (there are no obstructions on either of these sides).

    I'm having trouble modeling the change in mechanical properties of the composite layers from before the epoxy is cured until after it is. I'm assuming that when the sandwich structure is put between the steel plates that causes it to deform, there are stresses that appear in all the layers of the structure except for the composite layers since they are not rigid at this point. Then the pressure is applied on the top steel plate and I'm still not considering any significant stresses in the composite layers. The heat flux is then applied on the top and bottom steel plates which cures the composite layers and changes its properties to that of a very stiff material. Finally, the structure is cooled down and the pressure is released such that the sandwich is now slightly curved at rest, as opposed to being flat like it was before the curing process.

    Is there anyway I can model the composite layer as a non-rigid material with no thermal expansion** up until the heat addition step, at which point I give it the glass/epoxy cured properties until the rest of the analysis without having any convergence problems (since there is a large change in properties of the 2 composite layers throughout the analysis) ? And if there is no method to model this change of properties using Abaqus in a single analysis, what would be my other options in order to get accurate results ?

    Hopefully that wasn't too long of a post, and again I apologize if it was. Thanks to anyone that goes through the trouble of reading it and thinking about it, and feel free to ask me for any additional information you might need,


    Regards,

    Thomas


    **I consider no thermal expansion when the epoxy isn't cured up until it is fully cured since the epoxy will freely escape on either sides of the sandwich structure and removed in a later process. However, I am not entirely sure about the accuracy of this assumption. Moreover, I'm assuming the thermal expansion coefficient of the cured composite layers to be constant since it seems to only vary slightly over the [35,80] degC range from the few graphs I could find online. Could someone comment on the validity of this assumption?


    P.S. For the curious, I'm trying to calculate the curing stress and displacement fields in the manufacturing of a ski.
    Costanzo Bellini · Università degli studi di Cassino e del Lazio Meridionale

    I've faced a similar problem with msc marc: I've analysed residual deformation of an L-shaped epoxy laminate taking in consideration the compaction of prepreg plies and the squeezing of resin. You can find more details in the attached link.

  • Artur Burzynski added an answer in Primer Design:
    Is this hetero-dimer acceptable?

    Delta G: -6.68 kcal/mole Base Pairs: 3

    5' AAGGAACATAGCTTCAACCGCAG
    : :: |||
    3' CCAACGGTAAAGGCAGTTTTACT

    Is this hetero-dimer acceptable?

  • Carolyn M. Aldwin added an answer in Path Analysis:
    Is there a good primer/introduction to SEM?

    Hello.  I am a third year PhD student and am considering using SEM for one of my projects.  I have not had any exposure to SEM, though have been exposed to basic path analysis.  Essentially, I'm looking for a "quick-n-dirty," straight-forward introduction to the basics of SEM before I dive into the textbooks.  Does anyone have any recommendations?  Thanks.

    Carolyn M. Aldwin · Oregon State University

    Try Alan Acock's book on SEM in Stata. .

  • Joseph George asked a question in Scientific Community:
    Do plants have feelings like animals?

    I would like to get the opinion of scientific community about my interesting question “Do plants have feelings like animals”? Do you think plants enjoy a rain shower, plants enjoy sun light?

  • Under what circumstances does desorption of SiOx species occur?

    Hello!

    Does anyone know under which conditions desorption of SiOx species occur?For example, heat induced desorption of SiOx species from a Si substrate. Is there any specific temperature that should be achieved?Or maybe laser induced desorption?

    I would appreciate if someone had any information, preferably with a reference.

    Thank you in advance.

    Best,

    Sofia

    Sofia Sevastidou · Universiteit Twente

    Dear Mr. Saulius, fortunately I have access, so I was able to read it.

    Thank you again all for your inputs.

  • How would you define the facilitation of learning through an Emergent Curriculum approach?
    How would you define the facilitation of learning through an Emergent Curriculum approach?
    Franz Kasper Krönig · Cologne University of Applied Sciences

    Dear Robert,

    from my perspective, the emergent curriculum approach seems to be a half-hearted attempt to reconcile the (constructivist) idea of self-determination of the individual and self-organization of the group (or interaction system) on the one hand with the "facilitator's" desire to retain a minimum of control on the other hand. If we speak of a curriculum there is still the idea that we have an insight into the actual state of the pupils' learning processes and, even more: that we have an idea concerning his or her next steps which we can assist or scaffold (Vygotski's "zone of proximal development). 

    From a systems theoretical perspective, I do not believe in the transparency of learning processes and thus, it makes no sense for me to plan the next steps – even if this planning proceeds participatory and situative. 

    Kind regards, 

    Franz

  • Marc Cowling added an answer in Estimation:
    Has anyone seen studies considering endogeneity in the innovation-performance estimation?

    See above

    Marc Cowling · University of Brighton

    Hope it's useful.... Let me know how you get on. Cheers, Marc 

  • Faik Hamad added an answer in Joining:
    I have ploted experimental data on xy plot. Can I joint the point to draw graph from them or I have leave the results as points without joining them?

    if the answer I can't joint them  to draw a line, why?

    Faik Hamad · Teesside University

    Thanks Daniel,

    Use the data to plot graph to use them in papers,

    the main concerns: can I join the experimental points to plot graph.

    Example is attached.

    can I used figure 1 or figure 2?

    or I have to use figure1 only?

    Is there any explanation for not joining the points as suggested by one of my colleague.