Q&A

ResearchGate Q&A lets scientists and researchers exchange questions and answers relating to their research expertise, including areas such as techniques and methodologies.

Browse by research topic to find out what others in your field are discussing.

Browse Topics

A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
  • Ivica Blažević added an answer in Terpenes:
    How to isolate terpenes and sesquiterpenes from methnolic extract
    How to isolate terpenes and sesquiterpenes from methnolic extract
    Ivica Blažević · University of Split

    Just add any non-polar (such as hexane), or polar (diethylether, or dichloroethane) solvent, do that at least 2 times and evaporate using rotary-vapor or normal distillation.  Do not worry about partial solubility of these solvents in each other...this should not be a problem! If you worry add some NaCl dissolved in water. This will help to obtain visible border of two layers as NaCl is more soluble than organics in polar solvents, so organics should be pushed toward organic solvent!

  • Glenn Bingham added an answer in English Language:
    Can particles of transitive particle verbs in English be fronted and if so what is the canonical reference for this?

    I am looking for a discussion of examples like (1) if they are possible in English:

    (1) Out he kicked the ...

    What I am after is cases in which the particle of a verb that takes an object is fronted.

    Thanks!

    Glenn Bingham · Rowan University

    @Mark

    You suggested that we need to agree on a definition of particle and more specifically verb particle so we can distinguish them from adverbs, prepositions, and the like since the same words--or things that look like the same words--are used among these categories.

    I am sure this is kindergarten work for Stefan (and maybe the rest of us, too), but what would serve our purpose? I harvested this group from the internet, fully knowing the danger.

    Wikipedia: In grammar, a particle is a function word that must be associated with another word or phrase to impart meaning, i.e., does not have its own lexical definition.

    Cambridge Dictionary Online: a word or a part of a word that has a grammatical purpose but often has little or no meaning: In the sentence "I tidied up the room", the adverb "up" is a particle.

    grammar.about.com: A word that does not change its form through inflection and does not easily fit into the established system of parts of speech.

    Many particles are closely linked to verbs to form multi-word verbs, such as go away. Other particles include to used with an infinitive and not (a negative particle).

    Oxford Dictionaries: Grammar. A minor function word that has comparatively little meaning and does not inflect, in particular.

    EXAMPLE SENTENCES

    (In English) any of the class of words such as in, up, off, over, used with verbs to make phrasal verbs.

    Summer Institute of Linguistics (SIL.org): A particle is a word that does not belong to one of the main classes of words is invariable in form, and typically has grammatical or pragmatic meaning.
    A verbal particle is a member of a closed class of particles which co-occur with some verbs to form phrasal verbs. In some languages, verbal particles are identical to certain adpositions. Example (English)

    The item give up is a verbal particle, as in the following:

            He gave up smoking.
            He gave smoking up.

    ----------

    Of these five definitions of particle, I think the Oxford Dictionaries hits it closest to the mark. My vote for the worst job of defining the term is a tie between SIL and Cambridge Dictionary Online. SIL offers an example of a verbal particle, but erroneously uses the entire phrasal verb—verb plus particle—as the example. Cambridge calls the adverb “up” a particle. So is it an adverb or a particle? If adverbs and particles are the same, then the claim is that adverbs “have little or no meaning.”

  • What are the advantages of email therapy?

    What are the advantages of email therapy from the therapist's perspective? From the patient's perspective?

    Marković G. Đoko · University of Montenegro

    Dear all,

    In this alienated world, man can not change the world, but perhaps he can change himself, his interests, and therefore his minds.

    Đ.

  • Lynn Shepler added an answer in Blood Culture:
    What is the appropriate time to keep hospital blood cultures if the goal is to rule out bartonellosis?

    Do standard hospital blood cultures, kept for only 6 days, rule out bartonelllosis, or more precisely, bartonella bacteremia?

    Lynn Shepler · University of Chicago

    Thank you to everyone for these insights -- they are invaluable. 

    Best,

    Lynn Shepler, MD JD, Chicago

  • What are the differences between self-regulated learning and approaches to learning?

    I am wondering, if i would like to look at how the way a course is taught can influence student's self-regulated learning, and their approaches to learning, should I seperate the two studies? Or they can be integrated? Can someone with the knowledge of what factors in learning and teaching influence self-regulated learning point me to some key literature?

    Mark E Gould · Education Queensland

    Thanks for the great link. Just read the article and liked it. As I said SRL is more akin to a mind set, invovling motivation and self-efficacy through which students manage their approach to learning.

  • Ljubomir Jacić added an answer in Graphs:
    How is Graph Theory related to different areas of Mathematics and other Basic Sciences?

    Please share your remarks regarding the relation and applications of graph theory in the your areas expertise. Your remarks will be highly appreciated.

    Ljubomir Jacić · Technical College Požarevac

    This is very good article dear @Krishnan, bringing the application of graph theory in fast searching algorithms.

  • If the Oragutan-Austraolith theory is correct, which South Asian hominoid was their last common ancestor? Was it Asian or African or European?

    See above. 

    Marc Verhaegen · Study Center Anthropology

    If there is an orang-australopith hypothesis (Jeffrey Schwartz?), it's wrong according to anatomical evidence (see e.g. my Hum.Evol.papers).

    Sivapith, Lufengpith, Gigantopith & probably Ankarapith are probably pongid (Asian great apes), but australopiths are hominid (African great apes-humans), although both groups (pongis // hominids) probably partly evolved in parallel, e.g. African // Asian apes got longer arms & hands, longer iliac blades, larger canine teeth.

    Whereas both hominids (incl. ausralopiths) & pongids (in //) generally became more apelike, one hominid branch (Homo) took a very different evolutionary direction, evolving much large brains, external noses, much longer legs etc. (probably during the Pleistocene, when archaic Homo dispersed intercontinentally along African & Eurasian coasts & rivers, see file attached).

  • Gino Marioni asked a question in Salvage Therapy:
    Salvage therapy after RT failure for glottic SCC. Any significant differences between North American and European surgical approaches?

    Laryngologists, head neck surgeons

  • What are new technologies to design buildings that will give a good answer to climate change?

    I am working in a research to study resilient buildings. I would like to know if is possible develop a new technology that gives buildings some resilient property.

    Owajionyi Lysias Frank · Rivers State University of Science and Technology

    1) Try out some passive approaches; depending on your climatic region, artificial or natural water bodies at the windward side of building can help reduce your dependence on energy for cooling, adequate openings can allow in sufficient daylighting and in turn reduce your dependence of energy for lighting in the day. A lot more strategies abound.

    2) Adopting the active systems which will require your use of an appropriate technology, will need to be carefully done. One aspect building designers often neglect is asking ourselves how these technologies will be operated, what the operational challenges are? How they could be maintained and how often? Maintainability is an issue we cannot ignor if we must reduce the anthropogenic effect on the climate. 

  • Must all questions (for questionnaires and interviews) originate from the literature review?

    I need to know if it is a strict academic requirement for all questionnaire/interview questions to be developed from an earlier reviewed literature? For instance, after creating some questions based on what come out of the literature review, will it be academically right to add additional questions related to the research topic, but not highlighted in the literature review section?

    Collins Osei-Poku · University of Portsmouth

    Hi Han,

    That was really helpful.

    Thanks a lot.

  • What are the typical values of biomass boiler's efficiency and the biomass fuel heating values?

    I am currently conducting thermodynamic analyses of a small-scale ORC with a biomass boiler as a heat source. To get reasonable and realistic results, I need the typical values of the biomass boiler's efficiency with the heating values of its fuel. It is known that the heating values differ from kind to another (woodchips, wood pellets, logs or agricultural materials such as straw), but the most used ones are ok. I found some providers through the web with efficiency up to 90-92%, however, articles what I need as a source of these information. 

    I highly appreciate your reactions

    Khaled Hossin · Northumbria University

    Thank you Carlos for you contribution. But without supported reference to any used parameters, it will make a doubt.  

  • Peter T Breuer added an answer in Dropbox:
    Can anyone help in installing Zotero standlalone and dropbox in Linux Ubuntu 14.04 LTS

    I am trying to install Zotero standalone and dropbox in my Linux OS Ubuntu 14.04 LTS. I have not succeeding doing it. Kindly if someone know please share the steps.

    Peter T Breuer · Birmingham City University

    See my post and the referenced forum post. Add the zotero repository to the apt-sources list. Please use Ubuntu and/or zotero forums.

  • Hocine Remini added an answer in Polyphenols:
    Is it preferred to use microwave assisted method for extraction of polyphenolic compounds in plants?

    Usually maceration of plants is used for extraction of polyphenolic compounds in plants. But some researchers used microwave-assisted method (MAE) . what is the pros and cons of MAE.

    Hocine Remini · Université de Béjaïa

    Dear Dr. Fuad,

    To answer your question and for more details, please check out these works:

    https://www.researchgate.net/publication/275355020_Comparison_of_Microwave_Ultrasound_and_Accelerated-Assisted_Solvent_Extraction_for_Recovery_of_Polyphenols_from_Citrus_Sinensis_Peels

    https://www.researchgate.net/publication/269981986_Monitoring_oxidative_stability_and_phenolic_compounds_composition_of_myrtle-enriched_extra_virgin_olive_during_heating_treatment_by_flame_oven_and_microwave_using_reversed_phase_dispersive_liquidliquid_microextraction_%28RP-DLLME%29-HPLC-DAD-FLD_method

    https://www.researchgate.net/publication/263463770_Optimization_of_Microwave-Assisted_Extraction_of_Polyphenols_from_Myrtus_communis_L._Leaves

    https://www.researchgate.net/publication/263856662_Pistacia_lentiscus_leaves_as_a_source_of_phenolic_compounds_Microwave-assisted_extraction_optimized_and_compared_with_ultrasound-assisted_and_conventional_solvent_extraction

    Best regrads

    Hocine

  • Pascal GALON added an answer in Fluid Mechanics:
    Can Bernoulli's equation properly be derived from the first principle of thermodynamics?

    Usually Bernoulli's equation is well known  as a first integral of Euler's equations which can be read in standard textbooks on fluid dynamics. Hence, this equation can be derived within the framework of mechanics, only.

    Recently, I got notice about a different approach which starts from the first principle of thermodynamics. Having spent much time in literature research, I only found some very short and imprecise-looking statements but no convincing precise derivation. Coming from fluid mechanics, it looks like a different world to me!

    Does anybody know about a precise derivation in literature? Can Bernoulli's equation deduced from the first principle at all?    

    Pascal GALON · Atomic Energy and Alternative Energies Commission

    A more general form can be found, in the following course with Special cases of Bernouilli's Theorem

  • Do collegiate athletes view their coaches as a parent?

    In other words, I wanted to see some research on this topic about how researchers conducted their results, findings, and literature.

  • Glory Onyema added an answer in Biopesticides:
    Hello, i need help understanding results of my PCR gel images, who's willing to help?

    hi, i recently just did my first PCR assay to characterise fungi species used as biopesticides. i used coniothyrim minitans and trichoderma virens. the reaction was fine, but i had extra bands formed and i don't quite understand what it means or what could have caused it. i have attached the gel image, the extra bands were formed in the trichoderma virens specie. 

    Glory Onyema · University of Bedfordshire

    thanks everyone

  • Eric Lord added an answer in Special Relativity:
    Is relative simultaneity a misinterpretation of Special Relativity?

    I really need a lot of feedback on this particular issue.

    I think that relative simultaneity is a computational effect of no consequences to real temporal relations. This is based on my analysis of simultaneous trajectories.

    My claim of apparent nature of relative simultaneity is based on the assertion that relative lengths of rigid objects or points moving at a constant relative distance to each other in a stationary system are not conserved (in general ) in the moving system after Lorentz transformation when expressing multiple points trajectories in terms of common time of the moving system.

    More details in the linked document and relevant draft article available from my RG profile

    Eric Lord · Indian Institute of Science

    Dear Valentin ~

    I said “you must have made a mistake”. I see clearly from your most recent remarks precisely what that mistake is. You imagine I’m “defending” relativity by using it wrong. I’m not “defending” anything! I’m simply seeing your attempts to “debunk” relativity by using it wrong (in this and some of your earlier comments) and I’m trying to point out where you are going wrong.

    If you follow the logic of the situation as described below step-by-step I think you will see the logical error in your analysis (unless your resistance to being proved wrong prevents you from seeing it). As they say “it’s not rocket science” ;-)

    There are two inertial frames K and K′. The space and time coordinates in K are (x, t). The space and time coordinates in K′ are (x′, t′).

     K is the frame in which London and Paris are stationary. That is, the x-coordinates of London and Paris are constants. The t-coordinate is the time measured by the clocks in London and in Paris, which are synchronized.

     K′ is the frame in which the plane is stationary. That is, the x′ coordinate of the plane is a constant. The t′-coordinate is the time measured by a clock in the plane.

     The flight begins in London. That "event" can be chosen as the origin (0, 0) for both K and K′. This means that x = 0 for London and x′ = 0 for the plane. These values are constants. They do not change. It also means that at the start of the flight the clock in the plane and the clocks on the ground are synchronized: t = t′ = 0.

     The question is whether they will still be synchronized when the plane reaches Paris.

     Since the observers on the ground see the plane traveling with velocity v and arriving over Paris at time t1, the distance from London to Paris is vt1. That is, according to the frame K, Paris is at x = vt1.

     We can now forget about London. London has served its purpose of fixing the origins of K and K′. We are interested only in comparing the time t1 registered by the clock on the ground in Paris with the time t1′ registered by the clock in the plane, as the plane reaches Paris.

     We can use K (Paris is stationary and the plane is moving with velocity v) or we can use K′ (the plane is stationary and Paris is moving relative to it with velocity −v). It makes no difference, we must arrive at the same conclusion. And, indeed, we do. That’s what the equivalence of inertial frames means. That’s what “the principle of relativity” means.

     I’ve already clearly shown you how both Lorentz transformations (K → K′ and K → K′) lead to the same conclusion t′ = t/γ. So it’s astonishing to me how you can say “you use the displacement of K' seen from K − you refuse to use the displacement of K seen from the K′. " (!!!)

     Anyway, if even this attempt to clarify fails to convince you, there’s no point in our arguing further. Putting equations into RG input boxes very time-consuming; I’ve been neglecting more important things and I’ve had enough  :-)

  • Can anyone help me with molar absorptivity coefficient, ε for methane at 3300cm-1 and 1600cm-1?

    To estimate concentration of methane dissolved in water, I obtained FTIR spectrograph with peaks at 1500-1600 cm-1  and at 3300 cm-1. Now to calculate methane concentration in ppm through Beer lambart law i.e. A = Ԑ l c, value of molar absorptivity coefficient Ԑ is required which is specific for each wavelength. I am unable to find its value from anywhere. Please any body guide me what is Ԑ value for methane gas at 1500-1600 cm-1 and 3300 cm-1 wave numbers?

    Ahmad Gharaibeh · Jordan University of Science and Technology

    Molar absoptivity is better determined experimentally by constructing a calibration curve and calculating the molar absorptivity from the slope, because molar absorptivity is a function of slitwidth as well as wavelength.

  • Kåre Olaussen added an answer in Fluid Dynamics:
    Please. help! Is there any method to solve this nonlinear PDE using similarity?

    I stumbled upon equation j and l in my research.

    I found some books related to fluid dynamics, it says solution to j is the formula k

    (it didn't give the procedure, just solution)

    as you can see j and l looks similar. and similar boundary condition and mass balance.

    Assuming that solution to j is k, Is there any method to solve l and get the formula of h2?

    I tried to solve j analytically by using separation of variables, but it gives second order nonlinear ODE; and I made Wolfram Alpha solve it. but still it didn't respond. 

    so I decided to circumvent reaching the solution by using the similarity

    Kåre Olaussen · Norwegian University of Science and Technology

    Note that your equation for h_2 is of first order in r, hence much easier to solve. It may be that assuming R time independent is consistent with the equations, and all conditions. Hence, to solve the equation for h_1, I would make the ansatz h_1(t,r) = t^(-1/4) f_1(x), where x= (r/R)^2. That should lead you to a solution f_1(x) = C_1*(1-x)^(1/3), where C is a constant (probably the one you found in the textbook, whose solution would be wrong if R depended on time -- I think). 

    Next make the ansatz h_2(t,r) = t^(-1/4) f_2(x). That gives you a first order equation in x for f_2(x). The only worrysome thing is that you may have too many boundary conditions for the poor f_2(x), so you will need a little bit of luck to find a solution.

    If this simple strategy does not work out, you will need to assume that R is t-dependent, and proceed in a similar manner. I would still try to use x=(r/R)^2 as one variable, but not forgetting the t-dependence of R.

    And I honestly don't think you will get any closer to the solution if you start by studying 3 semesters of group theoretic methods ;-)

  • Joshua Renfroe added an answer in Amplicon:
    Hi I have the 2 following primers with extremely far apart Tm. Could someone advise on the protocol for the PCR reaction? Thanks!

    fwd primer 85bp: CTCGAGATG GAC TAC AAG GAC CAC GAC GGT GAC TAC AAG GAC CAC GAC ATC GAC TAC AAG GAC GAC GAC GAC AAG TGA GATGATG

    reverse primer: CTAGAATTCCGGATGTCCAGGTCACAC

    expected amplicon size: 953bp.

    Joshua Renfroe · Georgia State University

    If you suspect amplicons from non-specific binding in addition to your expected band size from TD, you could try isolating the DNA from your expected band and using this as template for a second PCR reaction. For this second PCR reaction, design a shorter forward primer near the terminal end of your inserted epitope. 

    Another option would be to do a ligation of your two products, have a forward primer on the terminal end of your epitope (as above) and your reverse primer on the other piece. A successful ligation would serve as a template. Since the ligation event might be rare, your template would sparse so you may work this up with an addition PCR reaction if your first product is faint. 

  • Luisiana Cundin asked a question in Ontology:
    From whence does Order come?

    There are two main threads of thought in science concerning Order, the first is decidedly deterministic in nature and claims Order is prescribed or preordained, as if All things emanate from a prime mover; the second ontology celebrates the perception that all things are completely arbitrary, meaningless and random, specifically, a more or less statistical explanation for Order, which summarily states that Order is the product of system constraints and that alone.

  • Marc Lichtman added an answer in Spectrum Sensing:
    Can anyone share MATLAB code for spectrum sensing for cognitive radio?

    Specially I need code pertaining to energy detection and a brief explanation on the relationship between threshold and probability of detection.

    Marc Lichtman · Virginia Polytechnic Institute and State University

    Thanks!

  • Juste Rajaonson added an answer in Urban Mobility:
    Can anyone help me find papers or reports about sustainable urban mobility plans?

    I search particullary about how we can evaluate this plans. Thanks

    Juste Rajaonson · Université du Québec à Montréal

    Dear Laura,

    Please take a look at this report written by Lopez-Ruiz et al. (2013). Quantifying the Effects of Sustainable Urban Mobility Plans. URL: http://ftp.jrc.es/EURdoc/JRC84116.pdf

    You may also want to check the mobility plan of the following city: Vancouver, Chicago, Seattle, and Portland.

    Regards,

    Juste

  • Can anyone solve this Diophantine equation?

    Let C a constant positive integer. Has ever this Diophantine equation x y+x+y=2C positive integer solution {x, y} for C> Co?

    Can anyone construct a solution?

    Sincerely

    Sebastián Martín Ruiz

    Nikos Dimitrios Bagis · Aristotle University of Thessaloniki

    I have proven that the number of solutions r(n) of x^2+x y+y^2=n, with x,y,n integers, n>0 is

    r(n)=6 Sum[1,{d|n,d=1mod3}]-6 sum[1,{d|n,d=2mod3}] and r(0)=1.

    Dear S.M. Ruiz I asking sorry I mixed up I thought that

    the eq. was x^2+x y+y^2=n.

    It is instead x+y +x y=n.   

  • Florian Porzer asked a question in Decision Making:
    Can someone provide an example for each MADM and MODM?

    I am still struggling to understand the exact differences between Multi-attribute Decision Making (MADM) and Multi-objective Decision Making (MODM). From what I know a major difference is the solution space (discrete vs continuous).

    Could someone provide me with a practical example to illustrate that difference? An (project) portfolio selection example would be even more helpful.

    Thanks a lot!

  • Banglong Fu added an answer in Aluminum Alloys:
    I am looking for a supplier of 8xxx aluminum series in north america?

    I am looking for a supplier of 8xxx aluminium series in north america?

    Banglong Fu · Shandong University

    Maybe you can search for some publications about 8XXX Al alloy in the recent years by google scholarship and contact the authors directly to ask them the supplier.

    I think Dr. T. S. Srivatsan http://www.uakron.edu/engineering/ME/people/profile.dot?u=tsrivatsan could help you.

    Best regards,

    Banglong Fu

  • Khalifa Shallouf asked a question in Spin Coating:
    How can I achieve a PMMA layer with thickness in range of 3 - 8 µm?


    What is the best spin coat settings I should use to get a  about 5µm thick uniform layer of PMMA on a pva (Poly(vinyl alcohol) ) layer deposited on 4 inch Si wafer?
    How many steps and spin RPM and time have to use to achieve this layer?

    Which solvent and what solution concentration that I have to use for this purpose?

  • Monir Ahmed asked a question in Financial Development:
    What is the better indicator of financial development in this countries?

    Developing countries are in the absence of forward market as well as better financial markets. What is the better indicator of financial development in these countries?

  • Anita Timmons added an answer in Virtual Machine:
    How do I test my framework against a reputable cloud service provider?

    I need to collect empirical data from cloud storage customers such as Bandwidth, Files Size, Virtual Machine Image, Virtual Random Access Memory, Processing Elements.  I need a lot of data to conduct statistical analysis.  I need data ASAP.

    If you can assist, me contact me.

    Thanks in advance.

    Very Respectfully,

    Anita

    Anita Timmons · George Washington University

    Thank you both....I am researching your recommendations