Q&A

ResearchGate Q&A lets scientists and researchers exchange questions and answers relating to their research expertise, including areas such as techniques and methodologies.

Browse by research topic to find out what others in your field are discussing.

Browse Topics

A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
  • Eman Naboush asked a question in Islamic Banking:
    Is there Islamic Banking in your country? If so, does it attract the clients of the conventional banking?

    There are significant differences in many parts of the operations of the Islamic banking and the conventional banking. Do you have any statistics on the comparison between the two types of banking, in particular, figures relating to the number of clients of both types of banking? Did you notice any change in the operations of Islamic banking since the recession of 2008?

  • Jack Denur added an answer in Gibbs Free Energy:
    Is the differences between Gibbs Free Energy and lower heating value of a fuel ascribed to the combustion irreversibility?

    Is the differences between Gibbs Free Energy and lower heating value of a fuel ascribed to the combustion irreversibility?

    Thank you for your attention and help.

    Jack Denur · University of North Texas

    Thank you for your thoughtful reply.

    All the best.

    Sincerely yours,

    Jack Denur

  • Ioannis Samaras added an answer in Zno Thin Films:
    Why nature of stress for ZnO thin films has changed from compressive to tensile with increased annealing temperature ?

    Why nature of stress for ZnO thin films has changed from compressive to tensile with increased annealing temperature ?

    Ioannis Samaras · Aristotle University of Thessaloniki

    the stress sign change may be due to Si uptake (a corrosion like mechanisms) from the substrate into ZnO, so you have a tensile stress at a critical temperature Tc (can you give a rough value about Tc?). Check for Si in ZnO with one of the techniques :X-ray refl. mode, Tem, Sem etc. .

  • How mono-layer graphene could have XRD pattern?

    Mono-layer graphene is a one atom thick layer of carbon, so how it could have XRD pattern? and what is it representative for? 

    Evgeny Alekseevich Smirnov · École Polytechnique Fédérale de Lausanne

    It was a small joke)
    Actually, the problem is how to measure. Of course, from Brag's Law there is no peaks for free-standing single layer graphene, however, you never work with one-layer free stnding graphene, right?! So you usually have a galo for very large d or very small theta.

  • Any recommendations for resources on botanical pharmacology for someone new to the field?

    I am a research assistant looking to learn a bit more about the pharmacology of compounds found in medicinal plants in my spare time. My goal is to find few journals to read regularly and see what I can learn from there. However since this is not my normal field of study I'm having a hard time figuring out where to start. Does anyone have any recommendations for good journals (or textbooks) on plant pharmacology?

    Sisubalan Natarajan · Jamal Mohamed College

    Hi Jack,

    You are looking for journal means just go through "Journal of Ethnopharmacology, Fitoterapia, Pharmacological Reports, Pharmacological Research, Pharmacology & Therapeutics, Pharmacology Biochemistry and Behavior, Pharmacology Package - Option 1, Pharmacology Package - Option 2, PharmaNutrition etc.

    All the best.

  • Paolo Scarpelli added an answer in Gene Runner:
    Please, I would like to know if it is a problem to have a positive dG in primer self dimer?

    5' GGCATGTAACGAATTTCTTC 3'
    +++ |||
    3' CTTCTTTAAGCAATGTACGG 5'
    dG: 1.5

    Data from Gene Runner

    Paolo Scarpelli · Università degli Studi di Perugia

    Here attached you can see the most efficient dimer structures for your own primer. Not the best kind of structures but I saw perfect primers working bad and bad primers working well. Definitely worth the try.

    good luck

  • How can a wireless channel business or occupation time ratio be measured practically and in real time?

    For hand-over proposals and for communication distributed system such as Vanet, What is the method and procedure to predict the channel occupation time by any node in the network, and is it a theoretical proposal or there are real practical methods to calculate the occupation time in real time.

    Francisco Falcone · Universidad Pública de Navarra

    Hi, I think you need to employ some sort of tracing device in order to analyze network traffic and from there, obtain channel traffic and channel occupation values. In the case of VANETs, you will probably use 802.11 (probably p/n) in combination with WPAN (802.15), so you will require network sniffers, which can later on be analyzed with the aid of wireshark (for example, you can check http://www.sewio.net/open-sniffer/     or      https://www.kismetwireless.net/)

    In the case of analyzing PLMN (UMTS/HSPA/LTE), Wireshark has dissectors implemented, but you need to get an appropriate tracing element, on a more professional side. You can check for example Ascom TEMS (previously Ericsson TEMS) here: http://www.ascom.com/ws/en/index-ws/

    Hope it helps!

    All the best

  • Sandeep Singh added an answer in Antimalarial:
    Screening of Antimalarial peptides?

    Please suggest, how to test isolated bacterial peptides against malarial parasite???

    Sandeep Singh · Institute of Microbial Technology

    an important database for antiparasitic peptides (also includes antimalarial peptides)

    crdd.osdd.net/raghava/parapep

    http://database.oxfordjournals.org/content/2014/bau051.full

  • Arindam A. Ghatak added an answer in Food Chemistry:
    Can anyone help me calculate Phenol content of Plants extracts.

    I need to calculate equivalent of phenols contents from plants extracts. But confusing after reading related questions on this site.

    Kindly provide me possible the solution to below query:

    I have taken 0.1ml of extract to final volume of 2ml. Performed TP contents followed by  McDonald et al. Phenolic content and antioxidant activity of olive extracts. Food Chemistry, 2001; 73: 73-84.

    How to calculate TP from OD obtained and is there formula for it? Does it matter extract volume taken?

    Arindam A. Ghatak · Padmashree Dr. D.Y. Patil University

    Please go through this publication

  • Tue Hvass Petersen added an answer in Surface EMG:
    Does anyone know how to interpret/ troubleshoot odd EMG waveforms from an MEP study?

    My study is measuring MEPs of the thenar eminence muscles of the thumb (Abductor pollicis brevis/ Flexor pollicis brevis). When I was piloting this study I was getting nice clean MEPs with a reasonable peak to peak amplitude and went ahead testing other subjects. Now I am finding an odd result with the EMG waveforms. I have attached an example below. I am seeing the TMS artefact followed by an immediate signal at 0 m/s and peaking at 5 m/s and then followed by a small MEP in the usual window. This is happening across multiple subjects and I am not sure if there is a problem with the equipment, electrode placement or something else? I am using surface electrodes with a Brainsight 2 EMG device. 

    Tue Hvass Petersen · Copenhagen University Hospital Hvidovre

    To me this looks like a filter issue. What kind of filters are you applying to the EMG signal?

  • I Need Help on DOE Analysis. Why there is no significance factors among them?

    I had design an experiment and it is a 2k matrix approach, 2^4(4 factors,2levels) x 3 replications = 48 runs. Total output is my response in study. The range of output falls in between 5000-8000. The analysis using minitab shows that there is no significance factor among each combination and individual factors. Any way I could change the situation ?

    Juan Manuel Belda Lois · Polytechnical University of Valencia

    You can have a problem of statistical power. The model seems two complex.

    Are you having any clues about what factors are influencing the output?

  • Hareendra Dissabandara added an answer in Sri Lanka:
    Can some one give us a comprehensive list of performance measures?

    In our latest study we thought of further investigating level of corporate governance and performance in Sri Lanka. So we are going to consider optional performance measures.

    Hareendra Dissabandara · University of Sri Jayewardenepura

    Many thanks Umar,

    In literature those are the common measures. We would like to hear about a different approach...

  • Piotr J Quee added an answer in Cluster Analysis:
    When should you use cluster analysis or k-mean cluster analysis?

    I am comparing two different groups, and going to use EFA, t-test, and ANOVA test

    After Exploratory Factor Analysis, 

    Do I also need to run cluster analysis? (such as k-mean clusters) 

    Thank you for your opinions ! 

    Piotr J Quee · Universitair Psychiatrisch Centrum KU Leuven

    Hi Ann,

    Cluster analyses are an option if you wish to investigate separable subgroups within your population. So, rather than studying which of your variables can be grouped together, a cluster analysis gives you insight into which of your subjects can be grouped together. This is normally a different research question.

    If you want to know more about the statistical analyses in clustering, there´s a paper on my page called ´cognitive subtypes in non-affected siblings of schizophrenia patients´, in which we used hierarchical and k-means clustering.

    Hope this helps!

    Kind regards

    Piotr

  • Florian Heilmann added an answer in HRV:
    Do you have any suggestions for HRV software/MATLAB codes in mice.

    I would like to measure HRV in mice. Is it doable with following setup: ECG with sampling rate of 1000Hz and in lightly anesthetized mouse 2% isoflurane? If yes, what are your experiences with analysis software? Thanks.

    Florian Heilmann · Johannes Gutenberg-Universität Mainz

    There are results for your second question about the effect of isoflurane:

    Spectral analysis of heart rate variability during isoflurane anesthesia.
    (PMID:1416163)

    I think Kubios is a good Software for such questions.

  • Which is the most suitable simulator to study routing in for wireless sensor networks : ns2 or ns3?

    implementing and evaluating a routing protocol for wireless sensor network can be made by ns3 ?

    Shubham Gupta · Indian Institute of Technology Kanpur

    Only NS-3 results are accepted in journals. I am also trying NetSim from Tetcos, and it  is definitely much easier to use and get results when compared to NS

  • Mie Kikuchi added an answer in Caribbean:
    What is the best way to ask study participants about race & ethnicity?

    I have been making a question to identify a ethnic group for my PhD research. 

    Could you suggest what the best way to make participants to feel like answering in a questionnaire to categorize the groups?

    I have divided it into so far:

    □    White/ Caucasian

    □    Latino/Hispanic

    □    Middle Eastern

    □    Black African

    □    White African

    □    Black Caribbean

    □    White Caribbean

    □    South Asian

    □    East Asian

    □    Mixed multiple ethnic group(white and black Caribbean, white and Asian,      

         white and black African)

    □    Other__________________________________

    □    Would rather not say

    Mie Kikuchi · University of Lincoln

    Dear Georgina and Jan,

    Thank you very much for your opinion and advice. My research is Internet survey about the perception of public towards human directed aggressive behaviour in dogs. It is for people who would access the questionnaire, all over the world. I would like to identify the cultural difference as well, so the ethnic groups are quite important items. As you say that I should think about  the Census categories as well.

    I will reconsider it deeply what the best way is. Thank you again. 

  • Paola Bernardo added an answer in Wool:
    Hi, how/where can I find some mechanical properties of some the materials?

    would you please tell me how/where can I find some mechanical properties ( e.i Young's modulus, Poisson's ratio and bulk modulus) of some the materials like polyurethane foams, rock wool and slag wool except doing related test? I would be so thank full if you guide me and give me a response to my question.

    Paola Bernardo · National Research Council

    Some mechanical properties of commercial PU foams are available in the attached paper (P.SD Patel et al., Compressive properties of commercially available polyurethane foams as mechanical models for osteoporotic human cancellous

    bone, 2008).

  • Chiara Pascolini asked a question in Primer:
    Could someone tell me why I get too small bands (primer dimer) for my PCR results, please?

    Could someone tell me why I get too small bands (primer dimer) for my PCR results, please? I try to change  all parameters (also diferents primer that I know that are tested) but.. nothing. I have always primer dimer also in my control sample. thank you for your answers

  • Daniel Lundberg added an answer in Boron:
    How can i get the cif files of all allotropes of boron?

    I have cif file of alfa-boron only which I got from this link" https://github.com/cryos/avogadro/blob/master/crystals/elements/B-Boron.cif"

    but I need the cif files of all allotropes of boron .Is there any method for this ?

    Daniel Lundberg · Swedish University of Agricultural Sciences

    Hi, Priyanka!

    Bartosz is correct that the Cambridge Structural Database (abbreviated CSD; maintained by Cambridge Crystallographic Data Centre, CCDC) is a good source for crystallographic structures, but the crystallographic information for strictly inorganic compounds is collected in the Inorganic Crystal Structure Database (ICSD), another a commercial product.

    A free/open access counterpart to the two sources listed above is the Crystallography Open Database (COD). There are a fair amount of structures in this one, but it does not include everything in CSD and ICSD. (see link)

    As for boron, there are currently 32 boron structures listed in ICSD and 18 in COD (with multiple overlaps). These may or may not cover the more than 20 allotropes of boron described to date. To retrieve the ones in COD, simply enter B for boron as the only of up to eight elements possible and restrict the search to one element (distinct elements min = 1 and max = 1). If you are missing one allotrope structure in particular, let us know.

    regards,

    Daniel

  • Michele Lustrino added an answer in Petrogenesis:
    What does alumina saturation tell us about petrogenesis of granitic rocks?

    There are three degrees of alumina saturation in rocks:

    Peraluminous (= alumina oversaturated): Al2O3 > K2O + Na2O + CaO
    Metaluminous (= alumina saturated): K2O + Na2O + CaO > Al2O3 > Na2O + K2O
    Peralkaline (= alumina undersaturated): K2O + Na2O > Al2O3. 

    What can we infer from these degrees of alumina saturation about the genesis of granitic rocks? 

    Michele Lustrino · Sapienza University of Rome

    I mean that isotopes are geochemical concepts that cannot be authomatically transported into geological features. Isotopic ratios used in igneous petrology (above all Sr-Nd-Pb) are very useful toos, but they must be ancillary and cannot be the base over which a tectonic or geodynamic model is built.

    Unfortunately many geochemists or igneous petrologists believe much more to isotopic ratios than to the geological evidences.

  • Daryn Dyer added an answer in Privatization:
    Do you think this is true?

    Dear collegues.

    In the world there are such people devoted the to a life only to a science and has forgotten private life.

    Thank you in advance

    Daryn Dyer · York University

    Hello Shafagat,

    Science is important and that the foundations of our society should be based in reason. Having said that, there is always the tendency to obsess and therein forgetting about the needs of those who require your attention. Family for instance.

    Daryn

  • Markus Freick added an answer in Ketosis:
    What is the highest observed value for BHBA in cattle?

    what are your personel observations about highest value of NEFA in Ketosis or other negative energy related disease. I came across a publication reporting the value of BHBA as 473 mmol/L (in abomasal ulceration).  could it be 473 or could it be typing error. 

    Markus Freick · Tierarztpraxis Zettlitz

    Do you refer to NEFA or BHBA?

    We measured BHBA in serum samples from dairy cows with left abomasal displacement at day 0, 1 and 3 post operation (n=71) by using Precision FreeStyle/Abbott. The highest value was 7,3 mmol/l, followed by 7,1/6,6 and 6,4 mmol/l.

  • Shubham Gupta asked a question in NetSim:
    Help reg cognitive radio simulation in NetSim?

    When we add more than one incumbent, and changing it's parameters such as x-y coordinates and operating band and simulating, it generates the various metrics. The CR channel matrix only shows channel 1 freq. 54-60 and spectral efficiency. It doesn't show channel no. 2, freq 60-66 and spectral efficiency. Please assist.

  • Is relative simultaneity a misinterpretation of Special Relativity?

    I really need a lot of feedback on this particular issue.

    I think that relative simultaneity is a computational effect of no consequences to real temporal relations. This is based on my analysis of simultaneous trajectories.

    My claim of apparent nature of relative simultaneity is based on the assertion that relative lengths of rigid objects or points moving at a constant relative distance to each other in a stationary system are not conserved (in general ) in the moving system after Lorentz transformation when expressing multiple points trajectories in terms of common time of the moving system.

    More details in the linked document and relevant draft article available from my RG profile

    Stefano Quattrini · Ordine degli ingegneri della provincia di Ancona

    Dear Eric,

    "Gravitation is far weaker than the other “forces of nature” (strong, weak, electromagnetic). "

    No doubts..

    "Its effect is cumulative, making itself felt in the neighbourhood of very massive bodies and in cosmological situations. In many physical situations it is a reasonable approximation to regard the curvature produced by the energies involved as negligible. "

    yes Eric outside objects I agree with you.

    But inside the mass the stress tensor exists anyway thoug with no significant effect outside is registered.

     Its value should increase with increasing the kinetic energy of the object. In a accelerator for example, where the kinetic energy is referred to the rest frame of the laboratory the value of the stress tensor should increase inside a mass.

    "In those situations Special Relativity (physics in flat spacetime) gives an excellent approximation."

    yes gives an excellent approximation of what happens outside also because it is a natural extension of the newton's II law with the relativistic energy momentum.

    "I can’t see why that should be any more puzzling than the fact that Newtonian physics is applicable and highly accurate in situations where the velocities involved are very much less than the velocity of light."

    Here nothing puzzles me..

    The thing that puzzles me is that while it has been made a big effort in order to put gravitation inside the theory with tensors, the same effort should have been  put in modelling the inertia of masses . Since no mass  is a point mass, otherwise collapsing in a black hole, all the masses have finite extension and can be treated in a accurate way with SRT only to a certain extent.  

    The flat version of GRT with negligible effects of gravitation which is SRT, has to respond to Geometrodynamics as well, but it cannot since the space is flat and cannot act on objects in that case. The Geometrodynamics has to act on everything inertia and gravitation at the same time, the space-time has to play a role in any case.

    It is like the space-time is a mediator of the gravitation only, it is a mediator of all the interactions and gravitation is a mediated interaction too.

    I don't know if I explained myself in a proper way.

  • What are the types of characterization need for a polymeric hydrogel to act as a drug delivery system?

    & how can I confirm it's suitable for drug delivery system?

    I have prepared polymeric hydrogel now I would like to proceed for drug delivery system I have confuse that what are the characterization need for a polymeric hydrogel to act as a drug delivery system?

    Qingshen Sun · Heilongjiang University

    It depends on the types of applicaions. For oral administration, the in vitro simulated gastraintestinal tests will be needed, plus stability tests.

  • Hamza Areekkan asked a question in DNA Markers:
    Why does the genomic DNA from Arabidopsis leaves showing different bands on agarose gel when isolated using CTAB protocol?

    I am using CTAB method for isolating genomic DNA from Arabidopsis leaves. After dissolving the DNA in 0.1X TE buffer, it is visualized in EtBr agarose gel. The DNA showing 5-7 different bands like a DNA marker. Can anyone tell the reason for this?

  • Milan Kabac added an answer in Big Data:
    Can we have a graph based solution for big data?

    Big data is huge in content and dimensions and graphs are computationally expensive. Is there any possibility where a big data problem could be addressed with a graph based solution by keeping the complexity manageable. 

    Thanks

    Milan Kabac · National Institute for Research in Computer Science and Control

    Hi Taimoor,

    Take a look at Pregel, Apache Giraph and Microsoft Dryad.

    http://googleresearch.blogspot.fr/2009/06/large-scale-graph-computing-at-google.html

    http://fr.slideshare.net/shatteredNirvana/pregel-a-system-for-largescale-graph-processing

    http://dl.acm.org/citation.cfm?id=1807167.1807184

    http://giraph.apache.org/

    http://research.microsoft.com/en-us/projects/dryad/

    Good luck !

  • Mubasher Hussain asked a question in Entomopathogens:
    Isaria fumosorosea (entomopathogenic fungus)?

    Can anyone point me in the direction of a good resource (book, paper, website) on culturing techniques for Isaria fumosorosea (entomopathogenic fungus) under lab conditions?

  • Kareem Emarah asked a question in Retinitis Pigmentosa:
    What is the best animal model of retinitis pigmentosa ?

    we are conducting a lab research to test a type of stem cells in the retinitis pigmentosa. I want to know which animal model is the most suitable for the research.
    I know it may depend only upon the choice of the research team but I need to know which aspect should I look for in the model?like what would make the research process less problematic. What will give the same result that will be in human ? etc

  • Carlota Gómez added an answer in Parasites:
    I can't identified this parasite or something else?

    I have collected from lizards

    Carlota Gómez · Universidad San Jorge

    In my opinion In this extension we  see blood erythrocytes (in reptiles are cells with nuclei) and the labeled cells would be white blood cells.