Q&A

ResearchGate Q&A lets scientists and researchers exchange questions and answers relating to their research expertise, including areas such as techniques and methodologies.

Browse by research topic to find out what others in your field are discussing.

Browse Topics

A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
  • Abdessamad Sekkal added an answer in VASP:
    Why does the total magnetic moment differ between OSZICAR and OUTCAR file in VASP?

    I am trying to calculate total magnetic moment of Co2FeSi system with different U value. The total magnetic moment is constant in OSZICAR file for different U value but in OUTCAR file total magnetic moment is increasing for different U value.

    Total magnetic moment for different U value has given below.

    OSZICAR      OUTCAR
     6.0004            6.052
     6.0003            6.064
     6.0002            6.076
     6.0000            6.088
     6.0002            6.100
     5.9986            6.112
     5.9995            6.123

    So, if I want to report total magnetic moment, what value(OSZICAR or OUTCAR) should I take?

    Abdessamad Sekkal · Abou Bakr Belkaid University of Tlemcen

    I think you did not relax the crystal structure (ionic relaxation and volume) with the introduction of the coupling term.

  • Cyril Mechkov added an answer in Circuits:
    Whats the real behavior of rc circuits?

    In series RC circuit with dc power supply the maximum capacitor voltage should be equal to power supply but in my experiments it's less than expected value and it's proportional to resistor, while in theory it's not reasonable. Please tell me your opinions.

    Cyril Mechkov · Technical University of Sofia

    Dear Abdelhalim,

    You advise Farzane to use a perfect voltmeter (electrometer). In addition to this relatively conventional solution, I would add another more sophisticated and a little extravagant solution - to improve the imperfect voltmeter (or capacitor... or the both) by eliminating the equivalent resistance Rc||Rv. She can do such a magic by connecting a negative resistor (INIC) with negative resistance -Rc||Rv in parallel to the capacitor. Here is the idea:

    https://en.wikibooks.org/wiki/Circuit_Idea/Revealing_the_Mystery_of_Negative_Impedance#Compensating_resistive_losses_by_N-shaped_negative_resistors

  • Elena Yu. Filinova added an answer in Transfection:
    Can I loose the protein of interest from a stable clone?

    hi,

    Iam facing a weird problem after transfection. I am using C3H10 meschencymal cell line which is a stable clone expressing a protein which is GFP tagged. Iam using this cell line to transfect another protein having a red tag. both the protein has G418 resistance. After a month, I have few colonies. But when I see it under the fluorescent microscope the resistant cells neither have GFP or red tag.

    1 . How is this possible,  when I have used a stable clone with a GFP protein ( I did check the cell for fluorescence before the experiment.) for transfection.

    2. Do the cells loose the protein for any reason.

    Suggestions are welcome

    Elena Yu. Filinova · Advanced Biomedical Research Laboratory, RF; Vidipharm Gmbh, Austria

    Dear Jaya,

    You SHOULD LOOSE your protein in at least 95 colonies from 100 after 3-6 weeks of cultivation in case you use plasmid vector with CMV or similar promoter. CMV plasmids transfection provide 95-99 percent of so called transient expression which is not genomic one, so it cannot be stable. To obtain stable transfected cell lines it is better to use lentiviral vectors. However they have their drawbacks in selection process and are not very presentative because of target protein relatively low expression.

    One thing like vector construction is also important. Fusion of fluorescent protein and your target one under the same promoter normally supress the target one production significantly compared to FP you see under microscope which is cloned first in vector.

  • What's the interpretation of single photon interference in a double slit experiment?

    I want to know what are the reasons of this interference.

    How does quantum mechanics look for this interference? Does the photon interfere with itself or are the waves accompanied with it interfering with each other?

    What's the relation of wave particle duality with this experiment?

    What are the most acceptable interpretations of this experiment?

    Charles Francis · Jesus College, Cambridge

    It's not a matter of whether I am able to explain it I have already explained it on my website, and if you were interested you would find the answers there. It is a question of why I would want to. Remember, the only reason I even talk to you is because you are an amusing buffoon. 

  • How does the content of flowers monoterpenes (CxHy structures, i.e., non-oxygenated moieties) increase with storage time?

    Is there a clear explanation for the increasing of monoterpenes content (hydrocarbon forms) through storage of flowers at -20ºC?

    Biswapriya Biswavas Misra · University of Florida

    I can have a thought if you let me know how the "measurement" was done, using GC, GC-MS, Spectrophotometry, or anything else ? As individual peaks or as total peak area of everything in the chromatography run and so on ? Look forward to more details. I believe it is a systematic error based on quantification methods as of now, but then the logical interpretation would come from further details of quantification

  • Can a QAA external reviewer with an accounting background conduct an effective external review of some other program, say chemistry, for example?
    A key part of the Quality Assurance Agency's (QAA) role is to review whether universities (as institutions or programs) maintain their academic standards and quality.
    Saleh FA Aloraibi · King Saud bin Abdulaziz University for Health Sciences

    We have to differentiate between institution accreditation and   program accreditation

    For institution accreditation external reviewers should be  experts of the process and of the national standards while for program specification external reviewers should be expert in both process and contents.  

  • James Doran added an answer in Algorithm Design:
    Can anyone suggest an algorithm that, given an arbitrary interacting pair of production systems P1 and P2, ENLARGES the rule set of P1 to MAXIMISE?

    To MAXIMISE certain specified input to P1 from P2? [NB this seems hard!]

    In this context, a production system comprises a set of IF-THEN rules, a working memory, and an execution process including a conflict resolution convention

    A working memory is a set of variable/value combinations with each variable appearing at most once

    Here an IF-THEN rule is of the form {IF A/x & B/y & C/z … THEN write K/t to <specified wm>}

    Execution process for a PS – REPEATEDLY, each rule in the PS  is simultaneously tested -- if the IF part of a rule fully matches in the working memory then the variable/value combination of its THEN part is written to the specified working memory.

    Two production systems interact if the rules of each sometimes write to the other. NB rules always match only on the working memory of their own PS.

    A conflict resolution convention is needed when contradictory variable/value combinations (i.e. same variable, different values) can be simultaneously written to the same working memory. In this context an equi-probable random choice is to be made between the alternatives

    To “MAXIMISE the input to P1 from P2” means to maximise the frequency with which any rule in P2 writes some particular variable/value combination (e.g. K8/0) to P1

    Note that the algorithm to be designed (call it MECE) can read P2 but NOT alter it. All MECE can do is to add additional rules to P1 (possibly with new variables and values in consequence)

    James Doran · University of Essex

    Another relevant point, I think, is that since everything is finite, MECE can merely perform an exhaustive search of all possible rule set additions to P1, trial them itself, and simply return the winner. Of course this makes MECE look more like an AI learning program than an algorithm in a formal sense.

    So you lose your bet?

    The foregoing observation suggests to me that the problem specification needs to be extended to:  specify a MECE that EFFICIENTLY finds an optimal rule set to be added to P1.

  • Is it possible to analyse glucose or other sugars using GLC?
    Please recommend suggestions on the possibility of analyzing sugars using GLC instead of HPLC.
    Steven Schoenfeld · Innova

    I think I may have found the answer to my ketose quandry.

    http://pubs.acs.org/doi/pdf/10.1021/jf3053862

    This paper uses 1-methylimmidazole to apparently lock the sugars in their pyranose or furanose form. They use some DMSO to solubilize and then do the acylation with acetic anhydride in an aqueous,DMSO,4MeI solution and extract with methylene chloride. They do aldoses, ketoses, sugar alcohols, and disaccarides together.

    IF you need to do trisaccarides they make high temperature db-5 columns that go up to 450 deg C. monosaccaride acetates come off at ~200 disaccarides at 320 and I would predict trisaccarides probably arround 400.

  • Jonathan T Ting added an answer in Viral Vectors:
    Has anyone used Virabind columns from Cell Biolabs for purification of AAV produced with a hybrid capsid, e.g. AAV2 + AAV(any) capsid?
    I know it is only advertised to work with AAV2 or AAV-DJ (but not with AAV-DJ/8). I believe the matrix is composed of agarose beads conjugated to anti-AAV2 capsid monoclonal antibody. Thus, only pure AAV2 or a hybrid virus with at least some AAV2 capsid composition can be purified. I want to find out if 50/50 mix of AAV2 and AAV(any) capsid during packaging is enough for a efficient capture in the column. Has anyone tried this already? Will the titer be dramatically reduced compared to pure AAV2?

    This is a similar approach to the JOVE article (below) that shows purification of AAV with hybrid AAV2 + AAV1 capsid using HI-TRAP heparin columns. However, the Virabind seems easier and less costly (and the HI-TRAP columns are not available from Sigma at present).

    McClure, C., Cole, K. L. H., Wulff, P., Klugmann, M., Murray, A. J. Production and Titering of Recombinant Adeno-associated Viral Vectors. J. Vis. Exp. (57), e3348, doi:10.3791/3348 (2011).
    Jonathan T Ting · Allen Institute for Brain Science

    Hi Caroline,

    Thanks for your comments.  Do you have any sense of what would produce a greater effect on spread....(1) co-injecting with heparin to reduce super-infection, as you mentioned, or (2) pre injection (i.p.) with mannitol?  Have you ever actually tried either of these tricks?  Consistent with your comments, and as expected, I also find a major benefit of using the serine and tyrosine mutant capsid variants that are purported as "proteosome resistant."  This also works great when packaging mosaic capsids.  I would also propose that the heparin column based purifications can capture more viral particles when you have a mosaic 2/8 capsids, simply because there are fewer AAV2 capsids and thus less rapid saturation of the binding sites in the column.  However, it is also true that too few AAV2 capsids would result in failure to capture the viral particles, so I generally try to load higher volumes of crude lysate into the purification column than if I were purifying a straight serotype 2 viral particles.

  • Donald Myers added an answer in ArcMap:
    How can we determine the error of interpolation by the natural neighbor with ArcMap 10?

    With several boreholes localited, we could determine a spatial interpolation of different geological layer. Would it be possible to determine the errors associated with the interpolation. I used ArcMap 10.0

    Donald Myers · The University of Arizona

    Two observationse

    1. Nearest neighbor interpolation is not based on any theory so you can't derive any  error results

    2. The suggestion to use a form of cross-validation is reasonable but it is based on a number of unstated assumptions. There are a variety of ways to split the data set but no theory to justify a claim that one is better than another, the results you get will depend on the original data set, the same technique with a different set of borehole data could be very different, any claims you might make about errors are likely dubious.

  • Mukesh Pimpliskar added an answer in Antimicrobials:
    How I do I use my dermal film for antimicrobial studies?

    I have prepared the dermal film, please tell me what will be appropriate to take film as it is or film in solution for the antimicrobial study?

    Please give your suggestions for method of antimicrobial study and type micro-organisms for the study.

    Hi Sandeep,the dermal film can be directly used to check the dermal microflora as it is on Muller-Hinton agar plates,it matters what kind of antibacterial compound you are using is it disinfectant or actual surface antibiotics

  • Barbara Sawicka added an answer in Happiness:
    What are your greatest achievements, both personal and professional in 2014?

    The end of the year is the time when we turn around and calculate our achievements, the time of regretting what we have missed out, the time of planning, being happy and being afraid.

    we can always strive for more and better. The ranking lists of the richest, the most influential, most successful come out this time of the year.

    How about You?

    Barbara Sawicka · University of Life Sciences in Lublin

    My greatest achievement is that it helped several young people to realize their dreams

  • Max Stanley Chartrand added an answer in Audiology:
    What does the term "contralateral reflex" mean?

    What does the term "contralateral reflex" with respect to the right ear in the case of acoustic stapedial measurements in routine clinical situations mean?

    Since there are two different views regarding which ear is to be the stimulus ear and probe ear, please specify.

    And while testing reflex decay in the right ear, which contralateral reflex threshold is to be taken?

    Max Stanley Chartrand · Northcentral University

    Yes, the sensation is tactile, rather than auditory, but as you know auditory signals are also tactile. I see your clarification on stapedial reflex--some would say TT is also a tactile reflex, I among them. But acoustic energy transfers into mechanical energy when encountering a surface, as you know. My reason for brining this in was to show that these reflexes are primarily contralateral in neuro pathway, but under some conditions (binaural, for instance) ipsilateral fibers are also incited.

  • Marcel M. Lambrechts added an answer in Concrete:
    Would you please name some examples of lost or forgotten knowledge?

    Example:

    Ancient Roman concrete has withstood the attack by elements for over 2,000 years. 

    Marcel M. Lambrechts · Centre d'Ecologie Fonctionnelle et Evolutive, Montpellier, France

    Is an ancient language forgotten knowledge when it repeats what is explained in another still existing language?

  • Mohammed Lezrek added an answer in Urethritis:
    Do you know what is this bizarre urethral lesion might be?

    I followed this case some years ago for 2 or 3 years, and I haven't elucidated the problem. I was going through my video archive and I found it, I was hoping that someone can recognize it.

    Mohammed Lezrek · Military Hospital Moulay Ismail, Meknes, Morocco

    Dear Manouchehr,

    Thank you for your answer. I thought some thing like that in the begignning. However, the patient had just a try of urethral catheterization, which was impossible, then a percutaneous cystostomy catheter was placed.

    Also, in the follow up the same lesion was present at urethroscopy.

  • Could someone explain to me what might have caused the sudden change of water to red colour in a volcanic crater lake?

    We have been monitoring this crater lake for about five years, it is suspected to be the youngest among a series of volcanoes. We have never encountered this phenomenon. We are yet to send samples for hydrogeochemical analysis but suspect the stirring of the water as a result of a sudden release of trapped gases beneath the lake caused this colour change, since there wasn't any torrential rainfall. Some physical parameters recorded indicate a drop in the pH of water (6.71 from 7.0). Also a slight increase in Temperature 26.3 degrees centigrade. Others include EC= 0.25 and TDS=0.12. Has this phenomenon been observed elsewhere? Lets allay our fears before the chemical results.

    Joseph. Kerekes · Environment Canada

    It is said before, use optical microscopy to decide is it alga or inorganic.

  • B. Sathyamoorthy added an answer in Perovskites:
    Can anyone explain the negative conductivity of the materials?

    I am working on rare earth perovskites. When I measure the electrical conductivity (dc) of my samples at low temperatures (below room temperature) it is linearly increases with respect to temperature. After a particular temperature (Nearly RT), the material shows negative value of conductivity (i.e. -1.3E-3) again it follows the same trend. Actually I don't know how to interpret this behavior. I have used Broad band Dielectric Spectrometer (BDS) Make:  NOVOCONTROL Technologies GmbH & Co. Model : Concept 80.  The temperature range is from 120 K to 473K and the frequency range upto 1MHz.  So please explain this behavior.  I am waiting for your valuable suggestions.

    Thanks

    B. Sathyamoorthy · Pondicherry University

    Dear Stephen R. Boona I have modified the question. Please find it

  • How should a hypothesis be formulated in a publication?
    If 1000 people would observe the same phenomenon 'C' and be asked to formulate a hypothesis 'C' to explain phenomenon 'C', what fraction of the observers would formulate hypothesis 'C' in exactly the same way, for instance with the same words expressed in the same order? Can the same hypothesis be represented with different oral or written expressions in a given language? This is apparently the case when different publications dealing with the same science topic (e.g. phenomenon 'C') are compared. Liberty in writing is advisable from an aesthetic point of view, but should it be allowed from a scientific or philosophical point of view?
    Marcel M. Lambrechts · Centre d'Ecologie Fonctionnelle et Evolutive, Montpellier, France

    People that produce hypothesis Z with education background Z might think that finding Z supports hypothesis Z.

    Will people with education background X and willing to test hypothesis Z reject hypothesis Z after observing finding Z?

  • Can you recommend protocols for removing bound RNA that may co-purify with recombinant proteins?

    Nucleic acid enzymes and binding proteins expressed in E. coli can have bound RNA as well as DNA. Are there specific methods for removing RNA versus DNA?

    Taran Khanam · Central Drug Research Institute

    Hi John

    During the lysis or post lysis of cells expressing the recombinant protein, one can add a step for RNA removal by adding RNAse upto  5 to 10 microgram/ml followed by incubation with mild shaking for additional 30 minutes at room temperature. Since RNAse will not cleave DNA so it is specific for RNA removal. I hope it works for you 

  • What concentration of Streptozotocin should be used in rats to induce diabetes?

    Can anybody help me to make rats diabetic in 2-3 days using Streptozotocin. I need to know what concentration I should use and how to make it out of a bottled powder from (S0130 SIGMA, ≥75% α-anomer basis, ≥98% (HPLC), powder) Streptozocin?

    Thank you

    Sanket Niranjanbhai Patel · University of Houston

    60 mg/kg/mL, once i.p., in 10 mM citrate buffer pH 4.5, for Sprague Dawley rats work just fine for type 1 diabetes; for type 2, you need to provide animals high fat diet along with multiple low STZ doses. I get STZ from A. G. Scientific.

  • Xinhua Cai asked a question in Dam:
    How to predict the service life of concrete in abrasive condition?

    Hi everyone, I'm doing some work for predicting the service life of concrete in abrasive condition, such as sediment laden flow with high velocity in high dam, the abrasion of pavement, etc. I can get the data of abrasive depth of concrete from accelerating test, but I dont know how to transform it to real life prediction. Can you give me some suggestions? Thank you.

  • Do you think whether it is proper to connect gravity exclusively with the speed of light?

    Since the beginning of the twentieth century the speed of light is thought to be fundamental to gravitation and its transmission effectiveness. Mathematical physics seeks whether this idea is sufficient for explanation of all phenomena related to mass attraction. Is a change of position needed? What is your opinion?

    Arno Gorgels · Principia Naturae

    I don't know who downvoted you, dear Manuel. The one who did might want to give the impression it was me, but it was not me. He may step forward and try to utter an argument.

  • Does anyone know how long 10mg/ml doxycycline solution will keep functioning if stored at -20°C without going bad?
    I am doing induction with Tet-on system. However, both of the tetracycline and doxycycline solutions I used failed to act as an inducer. I don't know how old the solutions are, but I'm suspecting that they are too old to function. Does anyone know how long they will last if stored in dark at -20°C?
    Yang Liu · Stony Brook University

    Hi Laura,

    Here is the sequence you may want for TetR primer:

    GGCGAGTTTACGGGTTGTTA
    5' end of tetracycline resistance gene, reverse primer

    Please find this website: http://www.addgene.org/mol-bio-reference/sequencing-primers/

    BTW, I just bought new Doxycycline to solve the problem...

  • John Tainer asked a question in Protein Purification:
    What are the easiest detergents to remove after protein purification?

    Are there some detergents that often help solubilize proteins for purification etc that can be completely removed efficiently afterwards?

  • Is the clock rate of free falling clocks the same?

    In a gravitational field of a homogeneous spherical mass M, a sufficiently small mass B, compared to M,  is left free in the gravitational field of M at a certain distance H from the center of mass, outside his surface. B gains speed, relative to the center of mass M, because of gravitational attraction. Many small objects like B free fall from different heights or from the same height at different instants.

    Every object has an atomic clock on board. Would these clocks have the same clock-rates during the free fall?

    A reference, master clock has to be adopted, otherwise the problem is ill posed. Clock-rates are refererred to an atomic clock on the surface of M for example (negligible M  rotation speed).

    The time elapsed for each body to go from the same starting and ending point counted by the atomic clocks on board is certainly the same (UFF).

    Their clock rate should be different, in general, unless they start from the same position and instant. Not because, , the speed of light takes less time to reach the closest, since they are in different positions, but  because of the  relation between the very small object and the massive object.

    I would like your opinion regarding this problem.

    Johan Frans Prins · Sage Wise 66 (Pty) Ltd

    @ Charles,

    Pathetic: "You can't blame me because you are not prepared to make an effort to understand anything, nor can you say it is an insult to say that you do not understand physics, as this is also already established."

    This statement proves without doubt that you do not understand what physics is all about. Physics is NEVER esablished!!!! The most basic rule in physics is to accept that what we believe today can be proved wrong tomorrow. If you do not apply this, you are too much of a F-up to be a physicist; THIS IS YOU!

    " expect you understand your own fantasy physics, but no one else wants to understand that."

    Wrong again: Only mainstream morons like you do not WANT to understand what I am sasying. It is YOU who are propagating "fantasy physics". If this were not the case you would be able to answer my SIMPLE questions about simultaneity!

  • Jing-Yuan Zhang added an answer in Fiber Optics:
    Is it possible to send electrical power through a fiber optics cable?

    Is it possible to send electrical power through fiber optics cable??

    Jing-Yuan Zhang · Georgia Southern University

    If you mean to deliver the electrical energy through optical fiber, then direct delivery of electrical power in optical fiber is impossible at this point, but you can convert the electricity into light by using semiconductor laser. The E/O conversion efficiency is about ~10%. After transmitting the optical energy through the fiber, you can convert it back to electricity using photo-diode or solar cell with an O/E efficiency ~10%.   The total conversion efficiency is in the order of ~1%. In addition, you need consider the loss of light in the fiber. 

  • Michael Peck added an answer in Cosmos:
    What is the resolution of the black hole information paradox?

    -According to quantum theory, information -- whether it describes the velocity of a particle or the precise manner in which ink marks or pixels are arranged on a document -- cannot disappear from the universe. But the physicists Kip Thorne, John Preskill and Stephen Hawking have a standing bet: what would happen if you dropped a copy of the Encyclopaedia Britannica down a black hole? It does not matter whether there are other identical copies elsewhere in the cosmos. As defined in physics, information is not the same as meaning, but simply refers to the binary digits, or some other code, used to precisely describe an object or pattern. So it seems that the information in those particular books would be swallowed up and gone forever. And that is supposed to be impossible. Dr. Hawking and Dr. Thorne believe the information would indeed disappear and that quantum mechanics will just have to deal with it. Dr. Preskill speculates that the information doesn't really vanish: it may be displayed somehow on the surface of the black hole, as on a cosmic movie screen.  (taken from http://www.oglethorpe.edu/faculty/~m_rulison/top10.htm)

    Otto,

    If using Einstein's field equations, an in-falling observer into an object without event horizon (but say at the critical point of forming one) would have their clocks freeze (relative to observers on Earth) at the limit of reaching the boundary. Since the vacuum solution to EFEs provides the solution external to the source (matter, energy, ect.), this boundary would initially arise at the physical surface. I haven't done the calculation so I cannot say which limit wins, but the other sources provided demonstrate that it wouldn't matter due to outgoing radiation halting the collapse. Thus there are several reasons why conventional black holes with event horizon could not exist relative to observers on Earth.

    Yet if you consider microscopic general relativity, it is possible to have regular objects over the Schwarzschild limit if the equivalence principles hold up at the quantum level. However, these would not be constricted by event horizon and such, but their substantial pressures would induce color superconducting states (explaining their large magnetic fields due to the London moment).

    "So astronomers were left baffled when they spotted powerful flashes of energy bursting out from the heart of a supermassive black hole at the centre of a galaxy 260 million light years from Earth. Measurements of this gamma ray 'lightning' showed it was travelling across the 'event horizon'"
    http://www.dailymail.co.uk/sciencetech/article-2853083/Scientists-lightning-sparking-supermassive-black-hole-appears-travel-faster-speed-light.html