Q&A

ResearchGate Q&A lets scientists and researchers exchange questions and answers relating to their research expertise, including areas such as techniques and methodologies.

Browse by research topic to find out what others in your field are discussing.

Browse Topics

A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
  • Dario Gaitan added an answer in Physical Chemistry:
    Why liquid water has much higher specific heat capacity compared to other simple liquids ?
    I understand that most of the interesting properties of water come from the three dimensional hydrogen bonding network. But, my question is very specific in this regards that how the structure enhances the heat capacity of water ?
    Dario Gaitan · University of Mississippi

    So, in summary, hydrogen bonds ARE responsible for the unusually high heat capacity of water?

  • Dan Roettger asked a question in Contamination:
    Fungal genomic DNA isolation issue? I am seeing low MW bands of contanination in my gels... ANY IDEA?

    Hello,

    My DNA isolation protocol seems to be working ok but I am seeing some low MW bands around 75-300 bps. Attached you will see my most recent gel. Gels (1% agarose) run for 30 minutes @ 130mV. Any idea what the low bands could be? I am looking for clean high MW DNA for sequencing this organism. 

    To give more background on my gDNA isolation protocol, I am running a phenol:chloroform extraction with both a RNase A and proteinase K digest. I am able to reproduce these results but everytime I isolate DNA I am seeing these smaller bands present in my DNA samples. I am working with a fungal cell whose cell wall is very difficult to disrupt. I am using a freeze-dry approach and mashing up cells into a fine powder. In my final steps, I am using a isopropanol and then an ethanol precipitation of DNA.

    When running nano-drop analysis, I am seeing a  OD (260/280) of around                  1.98-2.0. so I can assume there is some sort of contaminant. I know I should be seeing a reading closer to ~ 1.8. I have been told everything from "I have RNA contamination, to even having protein contamination." I am not sure what it is, but does anyone have any easy ways to clean these contaminants out?   

    Thanks for input!

    Dan Roettger

  • Can anyone help me to improve the following method for purification of acetylene using H2SO4 and NaOH

    Acetylene can be produced from the reaction of CaC2 and H2SO4:

    CaC2(s) + H2O ---> C2H2 (g) + Ca(OH)2

    Then, in the next step H2SO4 is used for the purification of acetylene to around 99%.
    I know if we produce acetylene according to the conventional method, using CaC2 and H2O, then we can purify the acetylene using different methods. There are different impurities in the produced gas. Moreover the N2 exists in the produced gas.

    May I know your suggestion for better purification of gas?

    Three columns were used for the acid wash step. In first column the weak acid is used for the washing at 45 C, in second column stronger acid is used at 45 C, and in the 3rd column NaOH is used for purification. During this procedure we are facing some problems as mentioned bellow. I need some suggestion to identify the following issues?
    1- The gelatinous brown material, in the top of the column that used for acid washing the gas.
    I think this was formed by the reaction of 98% H2SO4 at 40 to 60 degree C with acetylene.
    Under these conditions, I think the acetylene will polymerize forming tar like products.
    I am looking to confirm this theory- so is this jelly a mixture of polymerized acetylene and H2SO4? How can one prevent it?
    Is it correct to say that polymerization of C2H2 means longer chain hydrocarbons?
    As this is occurring in the presence of H2SO4, I guess there will be C4, C6, C8 compounds with SOx fragments. is it correct?

    What kine of characterization techniques can be used to confirm the existence of these products? FTIR, XPS, GC/MS are adequate for this purpose?

    2- The hard crystals
    These form in, and at the exit of, a tower containing 10% NaOH.
    I suspect they are the result of reaction of H2SO4 with NaOH. This crystal might be Na2SO4?

    I really appreciate your cooperation and guides.

    Best regards,
    Zahra

    Zahra Gholami · Universiti Teknologi PETRONAS

    Dear Professor Rastislav,

    Thanks for your advice and guidance.

  • Is there any standarised nomenclature for molecular vibrations?

    I've seen several publications and in many publications the abbreviations for the molecular vibration modes using greek letters don't match with others even if they refer to the same. The only exception seems to be the use of nu for stretching (both sym and asym). I've seen using delta with different subindexes for all deformation modes but in other they use gammaw for wagging mode for example.
    So, I was wondering if anybody know if there is any standarised or regulated nomenclature on this (IUPAC?) or if it just depends on the author.
    Thank you.

  • Andreas Neumann added an answer in Fish:
    How can we calculate/measure the daily food consumption rate of a fish from/using nitrogen budget?

    How can we calculate/measure the daily food consumption rate of a fish from/using nitrogen budget?

    Andreas Neumann · Alfred Wegener Institute Helmholtz Centre for Polar and Marine Research

    Regarding isotopes: you would have to use food/prey enriched in 15N compared to normal (less) enriched food/prey. Depending on the species that could mean you might have to raise a complete food chain with enrichment. When you have such, feed the isotopically labelled food/prey once or in short period and then monitor 15N enrichment in your target fish. But don't forget to monitor also 15N in excreted ammonia.

  • Jonghwa Chang added an answer in SRIM:
    How can I calculate the fluence and dpa (displacement per atom) in metal?

    I have done calculation with srim and I have vacancies data. I want to calculate fluence and dpa. also i have done an experiment of irradiation at different fluences.and i want to calculate vacancies at different fluence using SRIM.

    Jonghwa Chang · Korea Atomic Energy Research Institute (KAERI)

    For neutron fluence, you need to know the primary knock on atom (PKA) spectum as input to SRIM. PKA spectra per neutron can be obtained from NJOY. Check out my recent work for further details. http://www.kns.org/jknsfile/v46/3-13-51.pdf

  • What is diesel consumption per hectare or diesel consumption per tonne of grain ...
    ... at different soil tillage systems and in different countries?

    I would like to know how different the diesel consumption in different soil tillage systems or cultivation systems are in terms of the yield. Existence of differences between the systems and there are differences between different regions and countries?

    Thank you.
    Mauro Osaki · University of São Paulo

    Hello Stefan,

    You can consider soybean yield around 3,1 t/ha. Our corn is second crop, so the yield is lower than first corn crop, like USA. In Mato Grosso, you can assume 6 t/ha.

    king regards,

    Mauro

  • Diane Prashad added an answer in Examination:
    Which is better? Thesis or comprehensive exam?
    Many of my graduate students (in Master program) asked me which is better, thesis or comprehensive exam?
    Diane Prashad · The University of York

    I think in higher education (Masters/PhD levels) both areas are very important. However with that being said in my opinion a thesis is much more applicable at a postgraduate level as opposed to an undergraduate. In undergrad its still about testing the knowledge of a student in various courses that make up a degree (no new knowledge created here) At a postgraduate level there is a need that drives students to discover more about their research areas and this goes beyond being tested through written examinations. It is much more specific/specialised, therefore a written piece of work gives the student the avenue to create something valuable and add to the existing area of study. 

  • What are the ways to reduce energy intensity?

    By definition Energy Intensity (EI) is a measure of the energy efficiency of a nation's economy. It is calculated as units of energy per unit of GDP. High EIs indicate a high price or cost of converting energy into GDP. Low EI indicates a lower price or cost of converting energy into GDP.
    Current energy trends of the world are obviously unsustainable, socially, environmentally and economically. EI in Iran’s industry sector is more than 4.6 times greater than world average! (See the attached Chart). Yet, the share of industry sector in Iran is 21%, while the world average is 30%! What scenario would you recommend for her? What infrastructure would be necessary to reduce energy consumption? How your country is dealing with EI?

    Juan Leonardo Espinoza · University of Cuenca

    You should look at the energy mix: how your country consumes energy and what kind of energy it uses. For instance, the energy conversion efficiency is not the same for fossil fuels than for hydropower. The higher such a efficiency the lower the EI indicator (assuming the same GDP basis).

  • Simon Dillon added an answer in Culture Plates:
    What are ways to give UV radiation to bacterial culture plate for short time?

    I want to study the effect of radiation on bacterial cell, do i need to use some diode.

    Simon Dillon · University of Adelaide

    You will also need to place the samples in the dark for a time (cant remember how long) after exposure as visible light induces DNA repair mechanisms and makes UV mutagenesis much less efficient.

  • At what position does sgRNA cleaves in human or any organism DNA?

    SgRNA is a genome editing tool which has been predominantly used for genome editing and recently integrated with Cas9 system. It would be really great if you could tell me at what place site does sgRNA cleave the required DNA (it is necessary to know the position with the supporting reference).

    Benjamin E Housden · Harvard Medical School

    I'm not sure exactly what you're asking. Cas9 cleaves the DNA 3bp upstream of the PAM so an sgRNA targeting the sequence CGTAAGCTAGCTGTCGAATCCGG, would cut like this.... CGTAAGCTAGCTGTCGA   X   ATCCGG

  • Tomasz Molcan added an answer in NAMD:
    Can anyone tell the procedure to perform Gromacs and NAMD Molecular Dynamic Simulation in MAC OS X ?

    Dear Scientists,

    I have successfully installed gromacs and NAMD (VMD) in MAC os X but unable to perform simulation as given in gromacs tutorial.Is it ok to perform simulation in MACBOOK AIR with 4gb RAM ,1.4GhZ speed.Can anyone tell me the procedure and commands to run these simulations.

    Thanking You

    Regards

    Tomasz Molcan · University of Warmia and Mazury in Olsztyn

    What kind of error message You get from NAMD?

  • Cecile Hryhorczuk added an answer in Glutamate:
    What could be the cause of reduced mini-EPSCs amplitude?

    Is it less glutamate in the synaptic cleft? decreased receptor opening probability? less receptors? 

    Thanks!

    Cecile Hryhorczuk · Université de Montréal

    Thank you very much for the answer Steve. I was actually referring to the effect of a compound on mEPSCs amplitude. 

    So when you say a change in single channel conductance of ligand gated receptors, are you refering to mGLURs? Can modifications of those receptors affect the current amplitude of ionotropic channels? 

  • Susumu Morita added an answer in Publishing:
    Should professors jointly publish papers with students?

    At what point should/could a student be encouraged to publish a worthwhile, viable paper on his own vs. the professor adding his name?  Consider the academic level of the professor/student collaboration:  undergraduate, master's, doctoral.  What is the amount and value of the professor's contribution--a minor edit, a substantial rewrite, repeating an experiment, etc.--that determines when the professor and student should publish jointly?  Whose name goes first?  Is joint publishing a misuse of a student's work?  Should professors give students with potentially publishable papers all the help they need without requiring their names be used? 

    Susumu Morita · The University of Tokyo

    Fairouz- I buy your suggestion, totally. It's either way. No alternative. Either fix up a mechanism that can check, assess, stop if necessary by a third person or a party organization, or stop misusing a system that has no guarantee of the its' output (or say, a malfunctioning Product Liability code). Doesn't get any better than what Fairrouz pointed out.

  • Diane Prashad added an answer in Plagiarism:
    How much plagiarism is allowed for the acceptance of research paper?

    Does the research paper from own thesis is also considered as self plagiarism?

    Diane Prashad · The University of York

    In no way are deliberate forms of plagiarism acceptable in any research paper. However, you may have accidentally said something that sounds particularly similar to someone else's work in which case I think the most acceptable percentage is nothing more than 15%-20%. If the work you're planning to submit falls above that you may have a problem. Best Advice always pass your stuff through TURNITIN and try to achieve the lowest percentage of plagiarism as possible before you submit work. 

  • What is the purpose of using a 'J' tube during the fermentation of beer?

    Why does one use a "J" tube when transferring your wort and/or beer during beer fermentation? What role does this specific shaped tube play in the fermentation process?

    Simon Dillon · University of Adelaide

    The tube allows "racking" of the wort from trub and yeast/bacterial sediment after boiling or fermentation. It allows you to get a reasonably clear product out of a tank or other container by removing the clear product that sits above the sediment. In larger scale tanks this is usually achieved via a racking valve which sits above the base of the tank (above all the sediment hopefully!)

  • Chung Liang Lim added an answer in NMR analysis:
    Recently, I have isolated a novel compound with slight impurity. Shall I purify it or proceed to NMR to disclose its structure prior to purification?

    I have isolated a novel compound from fraction library and there is a slight impurity which is detected using LC/MS analysis, where a small ion peak is detected besides the molecular ion peak. Thus, I am hoping to get some opinion from RG members for whether purification work should be done now or shall I proceed to NMR analysis for structural disclosure before any further purification? As such minor impurity in the main compound might not have a significant effect on NMR spectra measurement. FYI, the amount of the compound I obtained is less than 2 mg.

    I would greatly appreciate for any advice, suggestions or comments. Thanks in advance. 

    Chung Liang Lim · RIKEN

    Thank you for all the helpful advice and suggestion regarding my question. I will try to go for 1H-NMR at first to get a rough idea about the nature of impurity which might contain in my compound and subsequently proceed to further purification if it is required to be done. 

  • David Alexander added an answer in Intelligence:
    Where is the intelligence in AI?

    Like many others, I am very enthusiastic about artificial intelligence, but the more I studied the AI, the less intelligence I found in it. What I found was classification, pattern recognition, and regression. Is there any hope for real AI to be developed in the future? Is it still correct to call AI AI?

    For AI that does not depend on neural networks, intelligence is in the programming.and in a data bae of rules.  There must be a knowledge base, plus a rule base (although sometimes these are considered one base.) An artificial intelligent agen must be able to translate a user;s query (or text input) into a form that will allow the rule base to operate on the knowlege base.  It the user makes a statement, the AIA would add that to the knowlege base, and if so programmed, determine if that statement is contradicted by information in the Kbase.  If the user asks a question, the AIA would seek and answer from the Kbase and Rule Base.  It should also be able to report a failure if it cannot come up with an answer.  The way that information is stored in the Kbase is problematic, generally it is heiracttical, but in our own brain, it appears to be stored in a multidimensional network.  To understand what I mean, tThink of a word or a concept, and a whole chain of words will come to your mind; and then you will select the ones that are appropriate for your concept.  One thing that is missing from many available Kbases is the duration of a fact.  Force - Mass x acceleration is true from the big bang to the infinite future.  Bill is married to Hillary is onlyt true from the time they got married till the time them either get divorced or one of them dies.  Tis could be import in responding to a query because the birthdate of a child could indicate that it was concieved before the marriage. 

    This is a very sketchy response to a very complicated question, but it should help you condsier answers to your question.

  • N. Dean Pentcheff added an answer in Moths:
    Does anyone know of a test of LED lamp efficiency to attract moths comparing to mercury bulbs or fluorescent lamps?

    LED bulbs are at the edge of the current lighting technology presenting high energy efficiency and long durability. Comparing LED bulbs to mercury or fluorescent bulbs may be an important technological breakthrough in moth sampling as it would reduce energy expenditure enabling better sampling schemes.

    N. Dean Pentcheff · Natural History Museum of Los Angeles County

    For spectral sensitivities of insects, start here:

    Briscoe, A. D., and L. Chittka. 2001. The evolution of color vision in insects. Annual Review of Entomology 46:471–510.

    There are definitely UV LEDs:

    http://www.digikey.com/Web%20Export/Supplier%20Content/Lumex_67/PDF/Lumex_UV_LEDs_TechNotes.pdf

    http://www.phoseon.com/technology/led-uv-wavelength.htm

    http://www.philipslumileds.com/products/luxeon-uv

    https://www.sparkfun.com/products/8662

  • What are the effects of religion on art and architecture?

    Religion has a big effect on art and architecture in civilizations. We can see this in the remaining buildings and works which are founded all over the world. But what about other civilizations?  

  • Manohar Sehgal added an answer in Trace Elements:
    How can I find the permissible limit of heavy metals and trace elements in fish tissue given by WHO and FAO?

    I actually tried my best to get the standards of WHO and FAO for fish tissue and was unable to find it as I browsed WHO and FAO Websites. I will be very thankful if somebody can help me out.

    Manohar Sehgal · DAV College Jalandhar

    Permissible Limit of heavy metals in fish tissue of L.rohita[Table-3] and C.striatus[ Table-4] as given by FAO(1983) and WHO(1985) SEE ATTACHED FILE[ZOOM200]

    The heavy metals were accumulated at varying levels in different tissues of L. rohita and C. striatus. The concentration of heavy metals in different organs of fishes followed the decreasing order Pb > Cd > Zn > Cu >Cr > Hg.

  • Can anyone recommend literature on "ethnic knowledge"?

    I am doing research on migrants' social mobility in labour market and educational-occupational mismatch in migrants' population. Some of my respondents attain social mobility in  labour market by using their "ethnic knowledge" e.g. mother tongue, cultural knowledge of their country of origin, ethnic social networks etc. Can anyone recommend literature, research on that?

    Thank you very much in advance.

    Diane Prashad · The University of York

    Thats a very interesting topic, These should be helpful

    1.) The social mobility of immigrants and their children: Papademtriou et.al.(2009)

    2.) The Impact of Social Networks on the Occupational Status of Migrants : Mullan (1989)  

    3.) Social Mobility and Ethnic Minorities: Heath and Ridge  (2011).

    4.) The Economic Sociology of immigration: Essays on networks,ethnicity and entrepreneurship: Portes (1995)

  • Do you have experience in and are interested in a possible collaboration in research on "approaches to learning"/ "approaches to teaching"?

    Dear colleagues, 

    I am interested in conducting research on the "approaches to learning" (SAL, Students' Approaches to Learning, Biggs, Marton, etc.), or "approaches to teaching" (Trigwell, etc.) line of research  with international partners, or maybe participating in a project already underway. So far I have analysed the approaches to teaching of secondary education trainee teachers in my home country (Spain), but would like to broaden my horizons. Would anyone be interested in a possible collaboration?

    Abílio Afonso Lourenço · University of Minho

    Olá colega

    O grupo de investigação GUIA (Grupo Universitário de Investigação em Autorregulação), do qual faço parte, tem muita investigação feita nessas áreas que indicou. Por favor consulte o site:  www.guia-psi.com

    ... e caso esteja de acordo contacte-me ou pode responder diretamente para o investigador principal, o professor Pedro Rosário.

    Obrigado e sempre ao dispor

    Abílio Afonso Lourenço

  • lu Wang asked a question in Micropropagation:
    Media for UCB1 pistachio micropropagation?

    Hi, i started working with UCB1 pistachio micro propagation. I made some media according to Parfitt, D.E. and A.A. Almehdi. 1994.(i've attached the link to the paper).  The media is composed of DKW supplemented with 30g sugar, Garmborg's vitamins, 85.5mM Zn, 156mM B and 9.9mM KNO3. Although the plants managed to grow, they don't callus properly. The stem above the media become swollen and the stem below the media just turn black. Over time, the stem just become woody/hard and turn reddish. The leafs also looks vitrified to me. I've tried to culture the plants on MS and 1/2 MS with no success. Can anyone suggest any papers or protocols i can follow to micro propagate them? Thanks!

  • Do you agree that diffusion of the blood elements in plasma is the essence of the blood circulation?

    A diffusion of the blood elements in plasma is caused by differences in concentrations of substances that are transported.

    Islam Saadeldin · Zagazig University

    Dear Sir,

    The circulation of blood depends mainly on the heart as it is considered as a suction-pump; arterial supply and venous return. The circulation of the plasma within the capillaries depends on 2 forces as described by Starling's law; the hydrostatic pressure and the oncotic pressure which affect the fluid movement within the capillaries by 3 mechanisms; diffusion, filtration and pinocytosis + a recent addition to Starling's law which is "glycocalyx" http://dx.doi.org/10.1093%2Fbja%2Faer515 

  • Hossein Abedi asked a question in Shock:
    Applications of the concept "Anti-fragility" ?

    Something is called "anti-fragile" if it benefits from some shocks/attacks/pressure etc upto a certain point and these shocks could make it stronger, for example humans build muscle if work out and have to lift weights for a period of time so their muscles are anti-fragile against physical pressure and work-out. 

    Some things are merely robust or resilient, these are only capable of being strong against shocks upto a point without getting stronger like a glass or a washing-machine. 

    This concept is introduced by Nicholas. N Taleb in a book, I wonder how  we could  make/design/create "anti-fragile "things and apply this concept in various fields.

    Thanks in advance. 

  • John Macken added an answer in Epistemology:
    What epistemologies currently exist for the notions of space and time?

    I am designing a study on the nature of space and time from the point of view of relativity and quantum mechanics.

    John Macken · Saint Mary's College of California

    Ruben,    As you probably know, the largest discrepancy in all of physics is the 10120 difference between the average energy density of spacetime obtained from general relativity (GR) and the vacuum energy density required by quantum mechanics (QM) and quantum electrodynamics (QED). For example, the "critical density" of flat spacetime from GR is roughly 10-9 J/m3. The energy density of zero point energy and vacuum fluctuations is roughly equal to Planck energy density (about 10113 J/m3). As John Archibald Wheeler said "Empty space is not empty... The density of field fluctuation energy in the vacuum argues that elementary particles represent percentage-wise almost completely negligible change in the locally violent conditions that characterize the vacuum". This discrepancy between GR and QM is usually assumed eventually to be resolved in favor of the GR because the energy density from QM seems ridiculous. However, I have written a paper that will be published in December that argues that the GR and QM energy densities are compatible because they represent different types of energy density of spacetime. A link to a preprint of this paper is available below. This model of spacetime leads to some predictions about gravity and the electrostatic force which were previously unknown but demonstrably correct. Also a description of the effect on spacetime produced by an electric field is given and subject to tests.   

  • How will co efficient of friction change with respect to the change in contact area ?

    Does the co efficient of friction depend only on materials in contact?

    In frictional clamps the co coefficient of friction plays a major role, as co efficient of friction directly depends on the material which are in contact kindly provide the relation between the co efficient of friction and area of contact

    Check out the the Society of Tribologists and Lubrication Engineers> http://www.stle.org/. (Trboligy is the study of friction and wear)  They publish books on the subject.  My experience is way out of date, but there have been many papers at society meetings that deal with the sujbect.  As Tanzeel Areeb says, it is a very complex subject, and a to think in terms of a single coefficient of friction is a gross simplification.  In dry metal friction, friction s caused by the interaction of asperities on the two surfaces. As such, it will depend on the hardness of the two materials, to some extent on the surface roughness.  .The reason that the friction is relatively independent  on the load is that is that the load is trasferred from one surface to the other by the junctions between asperities.  It some cases, if the martiarl are similar, there can actually be welding and tearing between the asperities. The worst case for this is when both surfaces are the same material, like steel on steel.  Much better is steel on bronze.  As for coatings, there are many available, the most common being lubricating oil or grease.