Q&A

ResearchGate Q&A lets scientists and researchers exchange questions and answers relating to their research expertise, including areas such as techniques and methodologies.

Browse by research topic to find out what others in your field are discussing.

Browse Topics

A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
  • Saber Nankali added an answer in Weka:
    can anybody help me with weka algorithms in matlab?

    I'm working on machine learning and I want to find a way how to be able to call weka algorithms in Matlab! it's very difficult to make all computations in matlab and then exporting them in appropriate arff file for weka and afterwards I have to import them again in matlab! It would be great if I can do both the computation and learning task in Matlab!

    Thanks,

    Saber Nankali · Kerman Graduate University of Technology

    how can i find the codes for calling packages like EvolutionarySearch.jar?

  • Is there any relationship between rhizosphere associated microbial community and accumulation of heavy metals by mangroves?

    Great symbiotic association was found by investigators between rhizosphere of mangroves and microbial community in past few decades. But do the microbial community help in the process of bioaccumulation of certain heavy metals by mangroves from ambient water and sediment?

    Hashem Adnan Kilani · University of Jordan

    I am not in this field. thanks

  • Daniel Osorio added an answer in Docking Software:
    Is it logical to use Cu2++ ion as receptor and a protein as Ligand, assuming the protein is rigid ?

    I am using hex as docking software, which assumes the ligand to be rigid. When I am trying the reverse, my protein as the receptor and the Cu2++ the final complex does not show any interaction, which should be.

  • Jan-Erik Raitanen added an answer in Esterification:
    How can I remove the DCU after an esterification catalyzed by DCC ?

    Hi all ! It is difficult to get rid of the DCU completely after a esterification  catalyzed by DCC. Is there a simple pathway to remove it? Thanks!

    Jan-Erik Raitanen · Åbo Akademi University

    Hi,

    DCU is indeed tricky to remove, but you could try to following:

    a) removal by filtration: dissolve your crude reaction mixture in cold ethyl acetate or acetone as this should precipitate DCU.

    or

    b) removal by column chromatography: this works for some reactions. However, there is a risk you will end up with DCU in all your fractions if you use certain eluent systems (e.g., ethyl acetate-hexane).

    or

    c) use another coupling agent: depending on the nature of your compound, you could use N,N'-diisopropyl carbodiimide (DIC) as its urea derivative is easily removed by extraction with dichloromethane OR you could use the hydrochloride of 1-Ethyl-(3-dimethylaminopropyl)carbodiimide (EDCl) as its urea by-product is water soluble and, thus, easy to get rid of.

    ---

    Somewhat off-topic: I've used DCC in amidation reactions and although it's effective, I switched to other coupling agents (CDI, DIC and Deoxo-Fluor) due to the "DCU issue" as well as the fact that DCC can cause allergies.

    best regards,

    JR

  • Why is it that my methanolic extract of Ajuga distills at 25mbar?

    I want to evaporate an Ajuga methanolic extract until complete dryness. I am almost at the end and I have evaporated most of the methanol at around 300-337 mbar, but I don`t understand why it started to distil also at 25 mbar - such a low pressure? Is it because the residue is thick and it`s more difficult for the methanol to evaporate? I don`t understand the phenomenon. The vegetal material used was dry and I only used methanol for the extraction.

    Thank you very much!

    Josep Coll-Toledano · Spanish National Research Council

    Most likely the extract contains residual water, coming from the "dry" material, and/or partly from "wet" methanol. At this point the only trouble is to have a residue weight slightly oversized. Depending on your next step it would not matter

  • Ivan Lefkovits added an answer in Immunology:
    Are there any artificial peptides that do not react with IgG from human serum?
    Does anyone have experience in working with artificial peptides that do not react with any IgG from human serum? If so can you provide the product name and the supplier?
    Ivan Lefkovits · Universitätsspital Basel

    The dogma says that the available repertoire of an individual contains all non-self specificities (i.e. specificities diected to foreign epitopes). The repertoire refers both to the heterogeneity of cells, and to the products they synthesize. Thus serum Ig repertoire is a “reflection” of the cellular repertoire. The repertoire might include ten million of specificities or more. This in turn means that there are maybe ten millions combining sites of antibody in the serum, covering all shapes of tertiary structures that fit with high or low affinity to shapes of all kind of existing molecules, and also shapes that have not yet been synthesized.

    Please read: Burnet, Jerne, Coutinho etc

    Be aware that each molecular species of antibody is present in the serum in millions of copies.

  • Anubhav Sharma asked a question in JAIPUR:
    Is there anyone who can help me in writing a MATLAB code?

    Hello everyone,

    I am doing a research in signal processing but I am facing problem in writing MATLAB code of computing AM & FM bandwidths of analytic signal.

    Is there anyone in this community who can help me with the same. Please refer point no. D on page no. 3 of the research paper attached herewith.

    Thanking in advance.

    Anubhav Sharma,
    MNIT, Jaipur

  • Adam Klimont asked a question in Gallium Arsenide:
    Heat conductivity in Gallium Arsenide - theoretical model?

    I am trying to reproduce the heat conductivity plot originally reported by Carlson (http://dx.doi.org/10.1063/1.1714018), see attached "Carlson data.png". There is a review article by Blakemore (http://dx.doi.org/10.1063/1.331665) in which he discusses Carlson's data. I'm looking for hints about fitting the data points with curves, like Carlson did, but it seems that heat conductivity in semiconductors is a complex phenomenon. Blakemore only says that between 50K and 150K k=A*exp(B/T) (fit.png), but how would you go about fitting the other parts of the data? I'm most interested in 30-250K range.

  • Mikus Dubickis asked a question in Spin-Offs:
    Dear all, could you please recommend some fundamental literature available online about innovation and tech. transfer, start up, spin-off, spinout?

    Fundamental literature about history and development of innovation and technology transfer (TT), factors affecting innovation and TT and/or any related literature you think might be useful to study to better understand how start up, spin-off, spinout companies could be developed. Thank You all very much!

  • What does mean by dispersion and distribution of the filler into polymer matrix ?

    Or why good dispersion and bad distribution of filler is good for electrical conductivity ? Thanks in advance 

  • Bhairavi Srinageshwar asked a question in iPSC:
    What is F12 stand for in DMEM F12 media?

    What is F12 stand for in DMEM F12 media? Is F12 required for iPSC growth? Does it have high/low glucose concentration?

  • Marcel M. Lambrechts added an answer in Chimpanzee:
    What makes us human?

    Just looking at our DNA won't tell us – the human genome is 99% identical to a chimpanzee's and, for that matter, 50% to a banana's. We do, however, have bigger brains than most animals – not the biggest, but packed with three times as many neurons as a gorilla (86bn to be exact).

    A lot of the things we once thought distinguishing about us – language, tool-use, recognising yourself in the mirror – are seen in other animals.

    Marcel M. Lambrechts · Centre d'Ecologie Fonctionnelle et Evolutive, Montpellier, France

    Dear Roland,

    To stimulate more discussion:

    - Do you think that humans are more spiritual than animals?

    - Is there a human versus animal soul?

    - How to physically define the human soul as mentioned in religion-based or medium-based frameworks (e.g. through physical vibrations varying between biology-based and non-biology-based entities?)? ....

  • Venugopal N added an answer in Metal Nanoparticles:
    Can anyone tell me if metal's dielectric constant is negative or positive? Is the metal nanoparticles dielectric constant negative or positive ? why?

    can anyone tell me metal's dielectric constant negative or positive? why? metal nanoparticles dielectric constant negative or positive ? why?

    Venugopal N · Indian Institute of Technology Roorkee

    Simply........metal dielectric constant  is complex quantity...

    the real part of dielectric constant is -ve and it represent reflection or transmission depends on frequency.

    the imaginary part of dielectric constant is +ve and it represent absorption

  • Michael Davis added an answer in Green IT:
    I am having trouble with getting a good PCR result, my expected PCR product is 2355 bp , what should I do?

    I am using the promega green master mix 

    and the program I used:

    1- 94C for 5 min

    2- 45 cycle of 94C: 1:30min, anealing at 60.5C :30s , extetion at 72C : 2:30min

    3- 72C for 10 min

    I tried to change the anealing temperature but still, no good result (sometimes sear is only a very faint band or no band at all)

    my primers are:

    1- GGAGGTCCCTAGAGTCATCAG

    2- GCTTCTTCCATGGAGCACAG

    Michael Davis · University of Washington Seattle

    First, what is the purpose of your amplicon?  Are you subcloning it, or is this only for detection purposes?  If you are subcloning, I would keep your cycle count low and make sure you are using a very high fidelity enzyme. (I am not familiar with the one you are using) to prevent PCR based mutations.

    I would second the use of different enzymes.  Phusion has worked very well for me.   Though you could try PFU Turbo as well. 

    Also, do you know that your target sequence is wild type?  Are you using primary cells/tissue or are you using a cancer derived cell line?  If you are using cancer cell lines, the sequence may be gone or altered.

    Finally, have you blasted your primer sequences?  If you are trying to prime off of a repetitive sequence, there may not be enough primer left for specific amplicons.  If this changing your oligos is not an option, you could try a nested PCR or using a Bacterial Artificial Chromosome as your template.

    Moving forward:

    1) Get a positive control so you know you can amplify other sequences off of your template.

    2)  Lower your cycle count

    3) Lower your Ta to 55 - 60 (based on your specific oligos)

    4) Add 3% DMSO to your reactions (this may help with secondary structures)

    5) Try different enzymes (these will have their own protocols)

    6) Try a nested PCR or a BAC based chunk of gDNA

    Good luck!

  • Can geometry have no definite dimension?

    Presentation of the Riemannian geometry begins sa follows: "Let us consider a manifold, where there is a coordinate system, and dimension of the manifold is equal n. Does it mean, that the dimension is a fundamental concept, which cannot be expressed via another more fundamental geometric concepts?

    Á. G. Horváth · Budapest University of Technology and Economics

    In mathematical point of you the answer for your question is yes.  Dimension, geometry, manifold etc. are only words. In mathematics, the word "dimension" has at least  three independent usage:

    1. It means a concept which is defined in an axiomatic structure (in topology, in linear algebra, in measure theory, in a finite structures e.g. in a matroids ...).

    2. The axioms of a structure contains such informations from which we can think to an apriori concept of dimension. (Axiomatic building up of the "3-dimensional" Euclidean geometry.)

    3. In the definition of the structure we use a concept of dimension defined in an other structure. (topological manifold of dimension n, Remannian geometry of dimension n, n-dimensional Euclidean space etc..)

    In 1. the concept of dimension is a tool, only. In 2. it is an inner property of the structure which we can call "dimension" however we can define another number as "dimension" if we want. In 3. on the borrowed concept of "dimension" determines the properties of the structure and it is not deduced for the other properties of the structure.  

  • Yousaf Saeed asked a question in Fuzzy Logic:
    Why the final output of Fuzzy Logic, that is SURFACE, does not shows the correct range?

    In fuzzy logic, i am using sugeno fis and have given the input range from 1 - 100 and output range from 0 - 1. When the final output comes i.e. creation of surface, it shows the incorrect range of output as from 0 - 0.5 instead of 0 - 1. The input range is indicated fine.

    Encircled in attachment.

  • Jordan D Clark added an answer in Ego:
    Do you have any experience in online Ego Depletion tasks?

    I am looking to manipulate self-regulation by running the cross-out-letter task (Baumeister et. al, 1998) - do you have any experience in running this as an online task, outside the lab?

    Any info/thoughts/comments would be highly appreciated!

    Thank you

    *attached link of the only source of info I found so far

  • Pablo G. Goicoechea added an answer in Anopheles:
    Is negative correlation between the FST and geographic distance possible in nature?

    My data revealed a non-significant but high negative correlation between the FST and geographic distance using microsatellites in Anopheles population. Should I consider it as no correlation? 

    Pablo G. Goicoechea · Neiker-Tecnalia Basque Institute for Agricultural Research and Development

    Dear Arvind: That is the purpose of significance tests. Significance depends not only on the correlation values, but on the number of samples etc. Anyhow, if the test is non-significant, you can not assume there is correlation.

    Hope this helps

  • Ehsan Manouchehri added an answer in IL-27:
    Does anybody have experience with blocking Fc on PBMC without a kit?

    I working on IL-27R (R and D system ) but it does not stain well.

    Ehsan Manouchehri · Semnan University of Medical Sciences

    Thanks all for your help

  • Jonathan Edwards added an answer in Epistemology:
    Is there a role for sense-data in epistemology of modern physics?

    It is known that physics is empirical science, in the sense that all propositions should be verified by experiments. But Bertrand Russell once remarked that the principle of verifiability itself cannot be verified, therefore it cannot be considered a principle of science.

    In a 1917 paper, Bertrand suggested sense-data to replace the problem of verifiability in physics science (http://selfpace.uconn.edu/class/ana/RussellRelationSenseData.pdf), but later he changed his mind. see http://www.mcps.umn.edu/philosophy/12_8savage.pdf

    So what do you think? Is there a role for sense-data in epistemology of modern physics?

         
    Jonathan Edwards · University College London

    I agree, Edwin, but the quotes in the Savage paper definitely indicate that what is called a foundational view of knowledge equates the incorrigible elements of experience with the   only source material for knowledge. But I think we agree that what is incorrigibly present in experience, like the sense of some patch of blue, is not the source material, but something derived from source material that is processed unconsciously. When I 'see a word' there must have been a mass of processing before I see it because I see it just as the word, I do not see it gradually being built up. And all those priming studies show that even if I never notice the word processing has gone on that may affect my later knowledge of something. 

    So I do no think Hume can have been right.

  • Issam Ashqer added an answer in Environmental Noise:
    Is there a techical standard about noise emissions from export/import pipelines?

    I'm interested in Industrial noise, I need to model the export and import pipelines.

    Issam Ashqer · An-Najah National University

    you can read the osha Regulations which gives some suggestion about your problem

  • What is a reliable QRT-PCR reference gene for serum-starved cells?

    I am performing qRT-PCR experiments to study stress-responsive genes that are induced when primary human fibroblasts are exposed to low serum conditions (0.1%) for 24hrs. I am hoping to find a reference / housekeeping gene that is not affected by serum starvation. So far I have tried using three different reference genes (ACTB, UBC and B2M) and get quite different results depending on which one I choose to normalize my data to. Any suggestions?

    Holger Fey · University of Illinois at Chicago

    I agree with Sönke in giving HPRT1 (http://www.ncbi.nlm.nih.gov/gene/3251) a try. You might also consider SDHA (http://www.ncbi.nlm.nih.gov/gene/6389). If all else fails there are always GAPDH, β-Actin and 18S rRNA of course but depending on the expression level of your target genes you end up chasing changes in expression levels 0.00000xyz times lower than your housekeeping gene. Have a look at the Vandesomepele paper from 2002 and the Invitrogen brochure (table on page 6) from 2003. There are a number of suggestions for housekeeping genes and their respective expression levels.

  • Venkateshwarlu Bandi asked a question in Journalism:
    Is there any defined criteria to consider a journal as an international one?

    is there any defined criteria to consider a journal as an international one?

  • Aldo Dall'Osso added an answer in Fortran 90:
    Hello all, does anyone know how to define Sign(x) and its derivative Sign(1,x) in Fortran 90?

    I am new to Fortran 90. I intend to define the "Sign(x)" function and it's "derivative" in Fortran 90, which will later be used by AUTO-07p(Bifurcation Analysis Software). In addition, the variables used in my subroutines (the variables inside Sign function), are not "x". For instance, in some sections of a specific subroutine, it is "i", in another section of the same subroutine it is "f", and so on and on. I need to define the "Sign" function that it could be used for all my variables. Also, there are no specific values assigned to my variables in the Fortran code, they are computed by AUTO. Thanks in advance for your attention.

    I am transferring my equations from Maple, in which the derivative of signum(x), is signum(1,x). The derivative of signum(x), is 2 times Dirac delta function (as mentioned by Professor Mittal). It is described in Maple that this function, is always zero except for x=0, in which it's not defined (Which gives the less precise description of Dirac Delta function). I don't know how to write a function in Fortran for the derivative function.

    Aldo Dall'Osso · AREVA

    Sorry, I entered my answer at the same time of the one of Simon Schröder .

  • Ire Agaz added an answer in DNA Gel Electrophoresis:
    Can anyone suggest how I can improve my DNA Gel Electrophoresis experiment?

    I have performed multiple gel electrophoresis in the past few weeks with similar results. Please see the attached picture. Does anyone have a suggestion of what I may be doing wrong here?

    1% agarose gel

    1x TAE

    5uL EtBr

    100ng - 1000ng DNA trials

    120 Volts

    concentration of DNA samples vary (PCR product) - 262ug/mL to 997ug/mL (gene isolation using forward and backward primers).

    100bp DNA ladder

    1uL - 2uL dye + TAE (depends)

    Thanks

    Ire Agaz · Georgia State University

    I used 0.5ug/mL EtBr i.e (5 uL of EtBr in 100mL of 1x TAE to prepare the gel)

    Thanks everyone for your suggestions. I will reduce the concentration of EtBr, use a fresh buffer, check pH, lower voltage, and see what happens.

    Thanks once again!

  • Michael Young added an answer in Laser:
    Is it possible to make a simple optical set-up to reduce the spectral width of a laser source?

    Laser light is not fully monochromatic so is it possible to reduce its spectral width without using any monochromator?

    Michael Young · Colorado School of Mines

    Sibasish,

    The thought that occurred to me is that you could use a pulse-shaping device to access the spectrum of your laser and then simply aperture out the undesired frequency components in the Fourier domain.  Even though it is called a pulse shaper, this will work for pulsed or cw lasers.  However, this is essentially a monochrometer and so you may not like this idea.

    If you look for papers on spectrum narrowing or line narrowing you can find articles on methods to reduce the spectral bandwidth of the laser.  Now we're wandering into the realm of laser construction but if you want to maintain power and reduce your spectrum I think that is primarily a function of the laser construction like Aleksandr said.

    Here is one example I found on opticsinfobase for spectrum narrowing:

  • Mahdi Kadivar added an answer in Food Safety:
    How to dissolve/disperse yeasts or fungi into edible oil?

    We are working on simulation of fungi contamination in edible oil. But during the preparation of samples when adding the fungi into oil, the fungi are not dissolved or dispersed in oil. How can we make the fungi disperse into the oil?

    Please clear my query. Thanks.

    Mahdi Kadivar · Isfahan University of Technology

    Just attach them to a partly hydrophobic compound such as surfactant or even emulsifiers with low HLB. I assumed that there is no water in the media and system will be something like a physical suspension. However you should consider the answer of Robert. Oil is not a appropriate substance ror micobial growth. Still wish you all the best  

  • Benjamin P Martin added an answer in FID:
    I need help. I am analyzing FAMEs on GC-FID. Can anyone offer some advice?

    When comparing my results with those from other labs, I am finding that my results are more heavily weighted toward polyunsaturated fats. I was hoping to fix this by calibrating with theoretical response factors (TRF) but AOCS Ce 1h-05 has TRF increasing with a degree of unsaturation. So that ResponseFactor=(Actual/FID Response), or Actual=FID*ResponseFactor, would only serve to more heavily weight my results toward polyunsaturated.

    I have the Supelco 37 FAME mix and my chromatogram offers slightly inflated values in the region of interest, is there a way to calibrate using only this mix?

    Benjamin P Martin · University of Colorado Colorado Springs

    Thank you for your replies.  I am using SP-2560.  100m x 25mm x 20micron.  I get excellent separation, and I have more than just that standard so it is not a peak identification problem.  It seems to be a calibration problem.  

    I will try an IS and see what happens.  

  • Ivan Lefkovits added an answer in Cell Count:
    How many macrophages can be found per cm2 in a healthy (!) human small intestine?

    I can find absolute counts for mice and piglets, but only relative information for monkeys and humans (but without indication of total cell counts for instance). Otherwise, does anybody know how comparable the intestine might be between these species regarding mononuclear cells?

    Ivan Lefkovits · Universitätsspital Basel

    First we settle the issue of the surface of the small intestine in a healthy individual. The surface, due to the foldings and stretchings is close to the size of a tennis court, say 300 m2.

    300 m2 = 3 x 106 cm2 . Adult human has some 1012 lymphocytes, and maybe 1011 macrophages. If we assume that 10% of all macrophages are in the small intestine (this would be an upper limit, the true number is probably less), then there are 1010 macrophages in the small intestine, which in turn gives 3,000 macrophages per cm2 . If this seems for the reader a too large number, than one could say that each an area of 3 mm2  is patrolled by a macrophage. One square mm is a huge area for a macrophage. But of course the topography is such that they crowd where they are needed. Due to uneven distribution there can be area where a hundred fold “crowding” occurs.

    Answer: 3,000 macrophages per cm2 small intestine

  • Can you troubleshoot my transwell invasion assay for a highly invasive colon cancer cell line?

    I have been struggling for days with the transwell matrigel invasion assay using a highly invasive colon cancer sell line. The stock concentration of matrigel is 9.5mg/ml and I dilute it to 1-2 mg/ml conc with serum free medium and coat the inserts with 100 ul of the diluted matrigel. I leave the matrigel to polymerize for 5-6 hours at 37 deg C. I have seeded different cell densities ranging from 50,000 to 500,00 and left the cells to invade across a chemotactic gradient of 10% FBS containing medium in the lower well. I tested 24 h as well as 48 h. My cells start aggregating and clumping at high cell density (500,000) at the periphery of the insert, but tend to move more evenly in the centre of the insert at both time points, more at 48 h. But the number of cells in not enough for me to count or analyze :(. In a separate migration assay using the inserts, I found that at a higher cell density (500,000 cells) more number of cells had migrated across after 24 h compared to only 50,000 cells. Hence, for my invasion assay, I was always seeding 500,000 cells on top of the matrigel, which unfortunately started aggregating and remained non-invasive.

    Questions- What could be going wrong? Is it the matrigel coating, or the matrigel concentration/volume, or the cell density, or the time permitted for invasion?

    Any inputs and help will be highly appreciated!

    Steingrimur Stefansson · HeMemics Biotechnologies Inc

    Hi Katyayni, I have done many transwell assays and at the concentrations of Matrigel that you are using, you are asking the cells to migrate through a > 1 micrometer thick Matrigel ECM and migrate through the transwell pores and colonize the bottom side of the insert in 24-48 hours.

    Even if your cells are highly invasive, they have to be armed with laser weapons to make it through the ECM in that amount of time.

    In these transwell assay, you are looking at how fast the cells applied to the top well are able to migrate through the pores and emerge on the bottom side of the insert. Adding another obstacle, like a thick ECM will complicate any interpretations on invasiveness.

    I coated the transwells using 1 ug/ml of Matrigel, because I wanted to see the effect of these adhesion proteins on cell migration.

    Plus, Matrigel is mostly laminin and type IV collagen. Cultured cell lines express integrins that adhere to vitronectin and fibronectin. If these cell lines do not express integrins that allow them to adhere to laminin, then they will clump together just to stay alive.