Q&A

ResearchGate Q&A lets scientists and researchers exchange questions and answers relating to their research expertise, including areas such as techniques and methodologies.

Browse by research topic to find out what others in your field are discussing.

Browse Topics

A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
  • How does the implementation of a low temperature regime (60/30 or lower) affect heat source in district heating?

    What might be necessary investments in the heat source to adapt it to low temperature regime?

    Maddali V S Murali Krishna · Chaitanya Bharathi Institute of Technology

    This information may be useful for your research

    DH is a cheaper and more efficient technology for high heat density areas, such as cities. While onthe other hand, heat pumps result more beneficial in lower heat density areas, as rural areas .

    Case studies;Belgium does not count with supporting measures for DH neither at national nor at regional level.However, some cities are taking the lead in finding the way to create and promote the heat marketin their jurisdiction while some regional initiatives have been taken to support green heatgeneration. This will, hopefully, set the example and provide the framework for the general energy planning of the region, or preferably, the country.

    Ref:Market model heating networks: Benchmark of DH markets in Sweden, Denmark, and Belgium

    www.stepupsmartcities.eu/.../Flanders%20district%20heating%20updates

  • Have I found a new way to the concept of DERIVATIVE?

    Given an algebraic system based on polarities on the sphere. A pair of opposite points and their equator constitute a basic element. (Add the equator to Riemann's unification of opposite points in elliptic geometry.) Two elements determine a resulting element of the same set. This is a partial binary operation with two axioms: ab = ba; (ab)(ac) = a. I call any set of this type a projective sphere. (Cf. Baer's finite projective planes and Devidé's plane pre-projective geometries.) From these axioms a number of important properties can be deduced. For example, if the set has at least two elements a and b, then xx cannot be properly defined for the whole set, because (ab)(ab)=a=(ba)(ba)=b contradiction. This means that in the general case xx must remain undefined, as with the case of division by zero in fields. However, if a smooth curve is given on the sphere, or an oval in a finite set, then the xx operation CAN partially be defined for the elements of the curve or of the oval as the tangent to the given point. Example: given the oval of the four reflexive (self-conjugated) elements in a 13-element finite sphere; the derivative consists of the same four elements. Another example: Given the basic elements on the sphere with homogeneous coordinates. Take the circle with center (1,0,0) and radius pi/4, given by elements (1,√(1-c^2 ),c); its derivative is the curve given by elements (-1,√(1-c^2 ),c). In this interpretation, the derivative does not represent the number indicating the slope of a straight line, but a set of the same type of geometric objects out of which the original curve is made. Also, this gives that every smooth curve evokes a geometry of its own, defined specifically for the given curve.

    István Lénárt · Eötvös Loránd University

    Dear Friends, thanks for encouraging comments from different corners of the round world... As I tried to expand in another conversation on center of mass of a spherical triangle, my approach to these questions comes from my four-decade-long experience in drawing and constructing on spherical surfaces. This experience makes certain geometric concepts more "natural" for me than for those without such background. Besides, my abilities, if any, enable me to invent basic ideas rather than elaborate their connection to past results. Lack of relevant knowledge is also a hindrance in several cases. However, extension of a concept to unexpected areas is a real challenge, and I will try to legalize, so to speak, the extension of "derivative" as referred to above. Merry Christmas and enjoyable research to all of you!

  • Sethu Saveda Suvanam added an answer in Band Gap:
    What is the relationship between a material color and its band-gap? How can we estimate the band-gap by color?

    What is the relationship between a material color and its band-gap? How can we estimate band-gap by color?

    Sethu Saveda Suvanam · KTH Royal Institute of Technology

    I agree with both Dr. Ravi and Tsvetanka that it may not be possible to estimate the bandgap by the colour of the material. And one such example is SiO2 on Si which has a thickness dependence as mentioned above.

  • Is Normality of data necessary for regression analysis?

    I am wondering is it really necessary to have normally distributed data for Enter or stepwise regression? Also if its not normally distributed than do we have to transform it before running regression? 

    Elmer Villanueva · Xi'an Jiaotong-Liverpool University

    I'm assuming that you're talking about LINEAR regression here.

    Formally, linear regression does not assume that the data (by themselves) need to be normally distributed. Rather is assumes that the errors need to be normally distributed. In practice, run a linear regression and plot the line of best fit. Then, we look to see if the scatter of points about this line is normally distributed. It seems strange that in order to test whether linear regression is a good model to run is to run linear regression, but there you go.

    This is what you do in practical terms: 

    1. Regress your dependent variable on your independent variable(s) using your favourite statistics program.

    2. Ask your program to produce residuals.

    3. Check the distribution of the residuals using visual means (eg., normal quantile plots, normal probability plots, kernel density, etc.) or more formal tests (eg., Shapiro-Wilks, Kolmogorov-Smirnov, etc.).

    If you find that there are violations to this assumption, then this may derive from a number of issues, such as

    0. There are errors in the data such that a small subset of observations have large errors. This should have been picked up during the cleaning step.

    1. The distributions of your dependent or independent variables are significantly non-normal. To be fair, if this is the case, it should come as no surprise because it would have been uncovered during exploratory data analysis.

    2. A straight line may not be the best fit to the data. That is, the assumption of linearity is violated. You may want to try using non-linear regression models.

    3. Your data may be composed of distinct subsets that require you to approach it more subtly, because you need to distinguish between or among the subgroups and fit individual regressions to each one.

    Anyway, these are just a few thoughts early on Christmas morning.

    Good luck!

  • What is and how the psyche works?

    While this is not a question, in 'PSYCHE - Structure and Function', there are many answers to questions that are commonly made in RG.

    Dear friends,

    It is my proud to present to you the first translation of PSYCHE. A hard work, that surely suffers from many imperfections, but has the sole purpose to get my ideas reaching to the large scientific community where English is current language. Beyond the errors, of which I am fully responsible, I have tried to communicate my theory in a simple way, including changing some text in Spanish, to have any chance of being discussed at other levels.
    I want to thank you for allowing me to share with you this achievement, and take the opportunity to wish you a Merry Christmas in the company of their own, and hope that all your expectations are met in the coming year.

    An affectionate hug, Dante.

    PD. The text is available on RG

  • Can anyone give me any advice about which parameters of operation I have to take into account to select a steam turbine?

    I mean, properties like temperatures, enthalpies, pressures or manufacturers are needed? I really appreciate any advice.

    Maddali V S Murali Krishna · Chaitanya Bharathi Institute of Technology

    The following information may be useful for your research

    1) Range of power in MW

    www.energy.siemens.com/hq/en/fossil-power-generation/steam-turbines/

    2) Type of the turbine like Back Pressure Controlled Extraction,Back Pressure Un-controlled Extraction,Straight Backpressure,Controlled Extraction Condensing,Straight Condensing with bleed  and ,Straight Condensing

    www.triveniturbines.com/en/products/...turbine/selection-criteria.html

    3) Pressure and temperature of main steam

    4) Tempeature range of reheat steam

    5)Details of Exhaust areas 

    www.energy.siemens.com/hq/en/fossil-power-generation/steam-turbines/

    6) Type of energy available that is imulse turbine or reaction turbine

    7) Type of compounding adopted that is pressure compounding, velosity compounding and pressure-velosity compouning

    You can also refer

    Power generation hand book; Selection and hand book

    accessengineeringlibrary.com/.../power-generation-handbook-selection-

  • What is your next step when you have a patient with an incomplete colonoscopy in the absence of large intestine stenosis?

    Considering that all the conditions for the test are fine.

    Kamal Eddin Bani-Hani · Hashemite University

    Dear All,

    Wishing all of you a Merry Christmas & A Happy New Year

  • Is there such a phenomenon as non-contact sport?

    In the literature it is quite common to see references to non-contact injuries eg anterior cruciate ligament strains/ruptures. Contact often occurs between athletes contest for or retaining possession of the ball say soccer, but are there other  factors involved?

  • B.A. Padder added an answer in Agarose Gel:
    What is the best gel to detect small dna fragment?below 250bp?

    Im doing DNA digestion and using 3% agarose gel in my experiment . Failed to get any band .Any suggestion or recommendation of what type of gel best use to detect small dna fragment?thank you very much

    B.A. Padder · Sher-e-Kashmir University of Agricultural Sciences and Technology

    Since you are digesting the DNA I will suggest you to use PAGE (6%) to resolve your fragments. If fund is available then go for metaphor agsrose and use it at 3% as such or you can combine sgarose with it At a ratio of 2:1.

  • James F Peters added an answer in Graphs:
    How graph union has more effect if there is a change in smaller graph? Could any one explain it with set theory example?

    Please Relate the set theory to graph theory.

    James F Peters · University of Manitoba

    This is a very interesting question with many possible answers.

    To get started, consider

    G. Bacak, Vertex Coloring of a Graph, M.Sc. thesis, Ismir Institute of Technology, 2004:

    http://library.iyte.edu.tr/tezler/master/matematik/T000416.pdf

    Let $\Chi$(G) (also written X(G), the chromatic number of a graph) be the minimum number of independent subsets that partition the vertex set of G.   Put another way, the chromatic number of a graph G is the minimum number  of colours for a proper colouring of G (p. 11).   Let H be a subgraph of G.   Then X(G) >= X(H), Prop. 11, p. 12.

    More to point, let G and H be  disjoint graphs.   Then $X(G\cup H) = max(X(G),H(G)$, p. 17.   From this, it is clear that a change in the smaller graph (either G or H) will change the chromatic number of the union of H and G, provided

    H = G (the smaller graph is augmented to the size of the larger graph) or

    X(H) < X(H') for the smaller graph H augmented so that $X(G \cup H) < X(G \cup H')$.

    For experiments with vertex colouring, see Section 4.4 (using webMathematica) and Section 4.5 (generating unions of graphs with webMathematica).    This gives you another way to answer the question for this thread.

  • Can I combine waves of the ELSA to look at different cognitive measures that are not asked on each wave ?

    I want to use some of the cognitive measures from the English Longitudinal Study of Ageing but many of the measures I want too look at (e.g. self reported memory) are not asked in wave 6 they are only asked in earlier waves . As I want to look at wave 6 to give the most up to date cross section, but doing so will limit me to looking at the 3 cognitive measures that were asked, I want to know is there any way I can use the self report scores from the older waves of the ELSA? or is the fact that they're data from older waves going to create too much noise? Any help or insight would be really appreciated, many thanks

    Henare Broughton · Trinity College Dublin

    I have no expertise in that area however you may wish to undertake a longitudinal study. If you do that you can compare your data from the extant literature on ageing.

  • Jason W. Moore added an answer in Geography:
    Is the anomalous status of geography helpful for the geographers in their professional field?

    Geography is not science. Nor it is an art. Geography is science and arts both. Some time I personally see it nowhere. Is it wrong justification for the discipline or discrimination in the classification of knowledge??

    Jason W. Moore · Binghamton University

    At its best, geography speaks to the potential for transcending the Two Cultures -- of the "natural" and "human" sciences -- and allows for the development of knowledges that understand humanity in the web of life. This is the thrust of world-ecology and other perspectives clustered around space, nature, and power -- and their constitutive inter-relations.

  • Paul R. Yarnold added an answer in ARIMA:
    Are there good papers to model survival data using time series methods like ARIMA/ARMA etc?

    I am looking for a way to model survival data using time series methods. Basically I have 100 patient and each of them has around 10 attribute variable for each patient we have observation time let's say t which event might happen or data is censored. One way to do prediction having few information is doing Cox PH model. I am thinking about any time series model that also can handle this kind of problem.

    I appreciate your help and comment.

    Paul R. Yarnold · Optimal Data Analysis LLC

    To obtain the most accurate model (normed against chance), use maximum-accuracy classification tree analysis with binary outcome = class variable; ten independent variables = attributes; number of time periods = weight (no censuring required). One theoretical advantage of a non-linear approach is that it is NOT necessary to assume that the phenomenon you are modeling is inherently linear, especially since most phenomena are NOT inherently linear...

    http://odajournal.com/2013/09/19/62/

  • Vladimir Farber asked a question in Optics:
    Can somebody recommend alternative to the beam splitter?

    If I need perform some experiment, where I need to use beam splitter, but I don't have it. Is it possible to construct something what can be used as beam splitter?

  • Ahed Jumah Alkhatib added an answer in Philosophy:
    Can ethics be measured objectively?
    Ethics, ethical committee, ethical approval and other ethical related words are extensively used on Researchgate and other places. How to define and measure ethics in objective bases?
    Ahed Jumah Alkhatib · Jordan University of Science and Technology

    Thanks Dr. Kamal for warm feelings. I also wishing A Merry Christmas and a happy new year for the all.

  • B.A. Padder added an answer in Primer:
    An economic method for the fluorescent labeling of PCR fragments?

    I have a trouble with my pcr reactions and i want to ask you where is my fault.
    I designed six primer pairs according to Schuelke's M13 methods but I did not get any reaction.
    One of my primers sequences is there;
    Reverse;CAGACCTTCACACGCTTGAT
    Foward with M13;TGTAAAACGACGGCCAGTAGAGTTGCGGAGAACAGGAT
    and FAM labeled M13.
    My PCR master mix content is there;
    2ul template DNA (50ng)
    1,5ul MgCl (25mM)
    1,5ul Standart Reaction Buffer
    1ul dNTP mix (10mM)
    1ul Reverse primer (10mM)
    1ul M13-FAM (10mM)
    0,5 ul Foward-M13 Primer (10mM)
    ddH2O - and my final volume is 20ul.
    And add to 8 cycle end of my standart conditions with 53C annealing temprature. My final extension is 15 min.
    I tried this conditions number of times with gradient pcr and touchdown pcr but I did not get any results.

    B.A. Padder · Sher-e-Kashmir University of Agricultural Sciences and Technology

    As for 

  • Is there any possibility for HPMA monomer to get polymerized without adding initiator to the reaction medium? is it possible by heating?

    I just synthesized HPMA monomer under the condition that Ulbrich et.al. did. In the first run, I get crystalline monomer but in the second run, I just get a sticky mass...I wonder if the monomers get polymerized?

    the reference based on which I worked is:

    Ulbrich K, Subr V, Strohalm J, Plocova D, Jelinkova M, Rihova B. (2000) Polymeric drugs based on conjugates of synthetic and natural macromolecules I. Synthesis and physicochemical characterisation. J. Controlled Release 64(1-3), 63-79.

    Rajesh Krishnan Gopalakrishna Pnaicker · Polytechnique Montréal

    I think you followed the same procedure described in the reference. If that is the case, this anomaly may be associated with your re-crystallization/purification steps. Try to do the re-precipitation carefully at the described temperature. Make sure you always maintain low temperature during the synthesis and purificationé

  • Nay Zar Aung added an answer in Tensile Test:
    Is it appropriate to do a grid dependency test in order to simulate tensile test?

    As I know, grid depency test used when simulate CFD. So, I received requested to do grid depency test for structural analysis which is tensile test.

    Nay Zar Aung · Harbin Institute of Technology

    Grid dependency test is necessary to have confidence on the accuray of simulated results.

    1) Firstly, you can try to compare your simulated restuls with experimental resutls (your own or availabe from other) or results from analytical equations. If the error is in the tolerable range (according your criterion), you don't need to waste your time on grid dependency.

    2) If you are looking for the best mesh which can give the smallest error, you need to work on grid dependency.

         
  • Kamal Eddin Bani-Hani added an answer in Tea:
    What are the medicinal benefits of lemon tea?

    Some excerpts from the article: "Medicinal benefits of lemon tea" by Mala Srivastava:

    "Tea is a good calorie-free substitute for sugary beverages, according to the Harvard School of Public Health. If you add a squirt of lemon juice to your tea, it will not only enhance its flavor but will also provide multiple health benefits. For example, if you are experiencing nasal congestion, drinking lemon tea can help to decongest your blocked nose, reports the University Health Service of Rochester University.

    Vitamin C Benefits

    One fluid ounce of lemon juice contains 12 milligrams of vitamin C. Water-soluble, vitamin C helps fight free radicals -- rogue molecules that damage your DNA. Free radicals may contribute to the development of diseases such as cancer and heart disease, notes University of Maryland Medical Center. By counteracting the negative effects of free radicals, vitamin C helps decrease the risk of developing cataracts by 80 percent, according to the book "The Secret Benefits of Lemon and Honey: Secret Guides.” In addition to healing wounds, vitamin C helps maintain and repair your teeth and bones. Moreover, your body requires this antioxidant to form collagen, a protein used to build skin, blood vessels, cartilage and tendons.
    Bioflavonoid Quercetin

    Citrus fruits, such as lemon, are one of the primary dietary sources of quercetin. A flavonoid, quercetin protects the insulin-producing cells in the pancreas from the damaging effects of free radicals. In addition, quercetin has an anti-inflammatory effect, as it helps stabilize the cells that release histamine in your body. Histamines are chemicals that trigger allergic reactions. According to the American Cancer Society, quercetin can inhibit the growth of cancer cells and can help promote apoptosis, a type of cell death. Animal studies have shown that quercetin may exhibit a protective effect against certain types of cancer, especially colon cancer.


    Blood Sugar Control

    High blood sugar occurs when your body produces inadequate amounts of insulin or when it cannot utilize insulin properly. Hesperidin, a compound in lemons, can modify the function of enzymes that affect your blood sugar levels, according to a study published in the January 2010 issue of the “Journal of Clinical Biochemistry and Nutrition.” This not only shields your body from the early stages of diabetes but also helps avert diabetes complications if you already have high blood sugar. Additionally, hesperidin has cholesterol-lowering effects.
    Powerful Limonoids

    A study published in the “Journal of Nutrition” in April 2005 revealed that lemons contain compounds called limonoids that have the potential to impede the growth and development of cancer cells. Not only did limonoids decelerate the growth rate of cancer cells, but they also enhanced cancer cell death when tested against human cancer cells. The study further states that these anti-cancer agents have free-radical scavenging activities."

    Your views are welcome! Thank you - Sundar

    Kamal Eddin Bani-Hani · Hashemite University

    Dear All,

    Wishing all of you a Merry Christmas & A Happy New Year

  • A.K. Singh added an answer in Analytical Statistics:
    How can quality characteristic be achieved by any speed between the given range of rmin and rmax that is normally distributed with a fixed mean ?

    Please kindly supply relevant journals or material that can help in better understanding of the concept.

    A.K. Singh · University of Nevada, Las Vegas

    I don't understand your question, could you please be more specific?

  • Carlin Nguyen asked a question in AMOS:
    My structural model has good fit based on model fit stats. However, when I add control variables, the model has poor fit. Why does this happen?

    I constructed a structural model using AMOS. The model has "good" fit based on model fit statistics (e.g., CFI, RMSEA, RSMR). However, when I add three control variables (e.g., age, gender, experience) into the model the model has poor fit - i.e., CFA < .9, RMSEA > .05, RSMR > .8. Why does this happen? What does it mean? Thanks. 

  • Can anyone help me to insolubility form of PAMAM modified carbonnanotubes?

    Hi everyone,

    I try to carry GFP trough to HEK cells by using PAMAM modified carbonnanotubes..

    My problem is the aggregation of carbonnanotubes on HEK cells. When i get a complex with GFP/carbonnanotubes and i applied on cells, Carbon nanotubes aggregate on cells so is there any advice for this situation?? And the note that i used sonication during 30min and there was no any positive results..

    What should i do? 

    Rajesh Krishnan Gopalakrishna Pnaicker · Polytechnique Montréal

    Can you describe more on the synthesis of PAMAM modified CNT.

  • Nebi Caka added an answer in English:
    Who can help me?

    Who can translate a text (about 1 Paragraph ) from English to Croatian?

    Thank You

    Nebi Caka · University of Prishtina

    Fatemeh Azizollahi:

    Tko mi može pomoći?

    Tko može prevesti tekst (oko jedan stavak) s engleskog na hrvatski jezik?

    Hvala Vam

  • Hocine Osmani asked a question in Fiber:
    I wonder if there is a separation technique of the different events of EA during crack propagation in a 2D composite fibre?

    In a 2D composite fiber
    there break:
    matrix, fiber, decohesion at the interface and the pull-out of fibers

    in the process area, several energy-absorbing mechanisms operate simultaneously. The monitoring of acoustic emission break records all events simultaneously.
    model allows testing of itentifier certain parameters. by cons in the real case, these mechanisms operate differently.

  • Daniel Yaw Fiaveh asked a question in Penis:
    Can anyone share materials on "Feminism and Penis"?

    How have or do [African] feminist scholars conceptualize penis?

  • Christopher J.S. Davis added an answer in AFLP:
    Is it possible to localize AFLPs on genomic sequence, given only the primers used to generate them? If so, how?

    I am trying to find the genomic locus (given its sequenced genome) of a morphological marker associated with a particular AFLP from an old linkage map. RAPD markers were also used, and seem just as impossible to find.

    Christopher J.S. Davis · Arizona State University

    Thank you Massimo. Yes, I tried to blast the primers, but didn't get any results. I imagine the size is rather typical of AFLPs (they were from a standard protocol), but I'm not sure how to "manually" align them.

    I have a good idea of roughly where it should be (within 1-2 Mbp). If I could narrow it down, I can compare different SNP haplotypes associated with the known phenotype differences (showing monogenic dominant/recessive segregation) linked relatively closely (3cM) to a known gene & chromosome.

  • Yunuen Tapia asked a question in Papers:
    Is anyone measuring phosphonatase activity in soil?

    Can anybody suggest a reference papers on phosphonatase activity? Thank you so much.

  • What is proper treatment for Rheumatoid arthritis?

    A friend suffers from Rheumatoid arthritis. Can I suggest him to use Voltaren gel, Cataflam or Cambia? Or is there other option?

    Victor Christianto · University of New Mexico

    @Subhash, Sourabh, Aleksandra, George, and Siddharth: thank you for all your answers. Best wishes

  • Imrana Aliyu asked a question in Landsat:
    How do you remove cloud from Landsat Images?

    I just want to know if there is any algorithms developed for this purpose. i will be glad to know that please.

  • Bernd Schmeikal added an answer in Mathematics:
    How do you explain mathematically the physical differences between two mango trees or between any two members of any living beings of the same type?

    The physical differences between two mango trees are not random. In what way can we explain such differences mathematically?

    Please note that this question is not about pattern recognition. It is about the possible mathematical explanation of the differences between two living beings of the same type.

    Bernd Schmeikal · University of Vienna

    Yes, I see. It is indeed a very challenging question. I see the case of homotopy similar like you do. We should be able to recognize the difference between a dead tree and a living tree. That should have to do with bioenergetic communication and flow patterns. A dead tree would not disclose such features, would it?