Q&A

ResearchGate Q&A lets scientists and researchers exchange questions and answers relating to their research expertise, including areas such as techniques and methodologies.

Browse by research topic to find out what others in your field are discussing.

Browse Topics

A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
  • Kaoru Aou added an answer in Spectra:
    How can I analyze FTIR spectra of Cu and CuO/Cu(OH)2?

    I reduced CuO and Cu(OH)2 separately into Cu and performed FTIR. I want to make sure no traces of Cu-O or CuO-H bond remains in the final material. How can I analyze the FTIR spectra (attached file) of final Cu sample?

    Kaoru Aou · Dow Chemical Company

    Metals should not show any FT-IR absorption, like Alain writes.  Infrared absorption is based on a nonzero transition dipole moment of vibrational modes. Metals certainly have vibrational modes, but light cannot activate it (the oscillating electric field at the right frequency will activate a vibrational mode of the same frequency when the transition dipole moment is non-zero).

    So that said, correct, it should not show any peak in the fingerprint region either.

    In Professor Elbagerma's link, Figure 5 appears to show FTIR spectrum of Cu(OH)2 - which is very similar to your own spectrum.  So it would seem that you still have detectable amounts of the precursor.  That said, FTIR is a very sensitive technique especially for functional groups with large transition dipole moments (such as the so-called O-H stretching mode).  So you would want to set a goal of purity / conversion, since if you want 100% purity, then you are basically looking for a flat FTIR spectrum.

  • David Boansi added an answer in Trade:
    What are some of the economic advantages and disadvantages of landlockedness (with reference to trade and growth)?

    It is generally perceived that due to lack of direct access to the sea, landlocked countries are primarily marginalized from major trade related networks and hardly benefit from trade opportunities due to their extreme reliance on their transit neighbors who may either have a weak or well-developed infrastructure (which have either detrimental or beneficial implications for trade and growth). Besides this usual perception most trade experts hold, what other advantages and possibly disadvantages are there for landlockedness?

    David Boansi · University of Bonn

    heheheheheh.....Interesting! Thanks a lot Perju for the interesting twist...Your point is well note and much appreciated

  • Articles on the formation of traditional European public spaces in relation to religious and political ideologies?

    Hello all,

    I am looking for books or articles that focus on the development of traditional European public spaces in relation to religious and political ideologies.

    It seems evident that most of the traditional public spaces in European cities were created with political and/or religious buildings as the primary focal points.  In many cities, these two functions overlapped.

    In the United States, our public spaces are continuously criticized in relation to these traditional European public spaces, though there is also a strong resistance to keep religious ideology separate from the public realm.

    Kathryn Cullen-Edwards · Deakin University

    Hi Tyler, you may well have already read this but if not then "The City in History" by Lewis Mumford might be useful as a starting point.  

  • Wangang Zhang added an answer in Proteolysis:
    How can I check wild wine-yeasts proteolysis?

    I want to test my isolated wild yeasts strains for proteolytic activities. Can you recomment a methodoly, which is easy and quick, for screening purposes in the lab?

    Thank you!

    Wangang Zhang · Nanjing Agricultural University

    I think Francesc provided very good method for you among many many methods.

  • What might be the possible reason for not getting an increase in a reducing power assay with increase in concentration?

    It is usually found that the reducing power assay is concentration dependent and increases with increase in concentration. However in my experiment taking different parts of the same plants (in triplicate) at a conc. of 20, 40, 60, 80 and 100, I found that in all the cases the highest reducing power activity was found at a conc. of 40 and then decreased at 60 followed by gradual increase at 80 and 100.

    Please provide your valuable suggestions.

    Thank you

    Bhakta Prasad Gaire · Gachon University

    Though you are not mentioning which sorts of reducing tests did you performed, I guess it is oxidation reduction experiment. Many compounds such as flavonoids and polyphenols have anti-oxidant efficacy at lower concentration and pro-oxidant efficacy in higher concentration. Forexample The mechanism of cell protection by T. chebula extract, against H2O2 induced cell death is largely due to the antioxidant efficacy of polyphenols present in T. chebula, such as quercetin, gallic acid and ellagic acids. These polyphenols are reported to show pro-oxidant activity at higher concentrations. However compounds having high low and again high effect in concentration dependent manner can not be scientifically explained. Might have some experimental error also. Following links may help you.

  • Wangang Zhang added an answer in Fatty Acids:
    Can anyone recommend an article about fatty acid biosynthesis in grasses?

    My interest is about tropical grasses, but there are few articles with this subject 

    Wangang Zhang · Nanjing Agricultural University

    Look at this paper: Fatty acid biosynthesis in mitochondria of grasses: malonyl-coenzyme A is generated by a mitochondriallocalized acetyl-coenzyme A carboxylase

  • Gerard Tromp added an answer in Agarose Gel:
    What are the advantages of Denaturing Gradient Gel Electrophoresis(DGGE) over the conventional Agarose Gel Electrophorosis in the Genomic studies?

     I need to Know the Efficiency of DGGE on the Genomic studies of Fungal mixed culture.

    Gerard Tromp · Geisinger Health System

    Denaturing gradient gel electrophoresis is a method that established the "melting point" of the DNA (usually PCR fragments). When DNA denatures, especially when provided with a high melting temperature "clamp" in one of the primers, the stokes radius, increases (dramatically if clamped) and the migration slows such that the band of DNA stays in place. Thus DNA fragments can be characterized by how far they migrate. It is often used for sequences that are conserved such that PCR primers will amplify the DNA from many closely related organisms, e.g., the gene for 16S RNA. DGGE can then provide some information about the what organism contributed tot he band. It remains an approximate method.

  • Can you see any relation between social media and bureaucracy of Weber?

    How can social media change the relation about the dominations explained by Weber (Bureaucratic, charismatic and tradition).

    Ademir Macedo Nascimento · Universidade de Pernambuco

    Thank your for the discussion.

    Can your recommend any text of Schulz?

  • Christopher J. Brush added an answer in Emotion:
    Can anyone share with me the differences between “emotions”, “affect”, “feelings”, “mood” and “dispositions”?

    These terms have been often used interchangeably in the literature. Is it any operational definition? 

    Christopher J. Brush · Rutgers, The State University of New Jersey

    There are definitely distinct differences between those concepts, which have often been overlooked within the literature. 

    Panteleimon Ekkekakis, Ph.D. of Iowa State University has written several book chapters that focuses on differentiating between affect, mood, and emotion. In the book chapter that I am attaching, Ekkekakis addresses the challenge that researchers have in measuring and defining affect, mood, and emotion.

  • Denise M. Barbulescu added an answer in Moringa:
    How to get moringa leaf extract?

    Hi,i am conducting an experament on moringa leaf extract as growth promotors for some crops but i am not sure of a reliable and proper method to get a concetrate extract of the leaves, any ideas?

    Thanks

    Refaat

    Denise M. Barbulescu · Department of Environment and Primary Industries

    You may want to make both aqueous and ethanolic extracts from young leaves /shoots. For ethanolic extracts you may grind dry leaves to powder and macerate in 70% ethanol at room temperature for 24hrs. After 24hrs filter the extract and dilute the filtrate at different concentrations in water for your experiments. For the aqueous extractions homogenize fresh leaves and water in a blender  and then filtrate using filter paper or cheese cloth. Again further dilute for your experiments. It is said that moringa leaves contain zeatin which has the growth promoting effect.

  • Regina Wikinski added an answer in Lecithins:
    What is the ratio of lecithin to apolipoprotein a in the absence of cholesterol?

    I've been told that there is a maximum amount of lecithin that may be incorporated into Apo A-1 but am unable to find any support for this notion in the literature.  The ratio I was given is 18 lec : 1 apo.  Does anyone know if this is true and have a reference for it? My own work appears to dispute this number!

    Regina Wikinski · University of Buenos Aires

    Which molecule,in a given animal model or human  pathology?This  is the first question  . I am sure that  nobody can help you without such simple data  

  • Rotor gene troubleshooting?

    A RT PCR rotor gene was used for blue tongue diagnosis and the curve was absent either the internal control was absent, any suggestion?

  • Shiromani Balmukund Rahi asked a question in Tunneling:
    What is happening behind effective bandgap and effective mass of SiGe after Some critical value?

    We knew that bandgap in SiGe is mole fraction dependent. Means bandgap of SiGe decreases with increasing germanium mole fraction. resulting better tunneling current But some critical value in tunneling current shows not same trends. Actually tunneling current is dependent on effective bandgap and effective mass.
    Please explain clearly with suitable formula.
    Why tunneling current is not following same trends?
    or
    What is happening behind effective bandgap and effective mass of SiGe after Some critical value(above 35 %Ge)?

  • Jimmy Tsang added an answer in Bacteria:
    How do I distinguish and determine species from potentially two different bacteria if their basic morphological features look the same?

    For example, two different species of coccus in mixed culture. How would I be able to determine their respective names?

    Jimmy Tsang · The University of Hong Kong

    Streak or plate them out for single colonies. Pick , e.g. ten individual colonies and prepare total DNA from each of them. Amplify their ribosomal DNA using universal primers designed for 16srDNA [16srRNA-F: AGAGTTTGATCCTGGCTGAG; 16srRNA-B: AAGGAGGTGATCCAGCCGCA]. Clone the PCR products to say, pGEM-Teasy and determine the DNA sequences of the inserts. The sequences would be able to provide information related to the genus or species of the bacteria.

  • Can we use the connectivity Map (cMap) for different diseases or it is just for cancer?

    The Connectivity Map (also known as cmap) is a collection of genome-wide transcriptional expression data from cultured human cells treated with bioactive small molecules and simple pattern-matching algorithms that together enable the discovery of functional connections between drugs, genes and diseases through the transitory feature of common gene-expression changes.
    Is it only for cancer?(In this project there are six cancer tissue cell line )
    How can we use it for another diseases?

    Michael Poidinger · Agency for Science, Technology and Research

    That just happens to be the dataset they used, it's not hardwired into the software.  You can load any array data you like.

  • Regina Wikinski added an answer in Metabolics:
    How can I get a list of all genes/enzymes involved in metabolism is human cells?

    I am interested in checking whether genes involved in metabolism are regulated upon treating human cells with a certain drug. However, I cannot find a comprehensive list of these genes that encode metabolic enzymes. Any idea how I can get such a list?

    Regina Wikinski · University of Buenos Aires

    There is a huge number of genes,related with proteins and enzymes in lipoprotein metabolism. You must study only the regulation of  your group of molecules involved in your  objective-problem  It Is a long way but a very long list is useless. Your work will be useful when you are sure that each step is the first one and you can go to the second step.   

  • Neil Gordon added an answer in Weather Forecast:
    What is the most appropriate method of categorical forecast validation?

    Thanks in advance for your replies.

    Neil Gordon · Massachusetts Institute of Technology

    Another reference which includes mention of multicategory forecasts: http://www.wmo.int/pages/prog/hwrp/documents/FFI/expert/Guidelines_on_Performance_Assessment_of_Public_Weather_Services.pdf    and   http://journals.ametsoc.org/doi/abs/10.1175/1520-0493%281982%29110%3C0657%3AETSOCF%3E2.0.CO%3B2 

  • Yannapol Sriphutkiat added an answer in Comsol:
    Clogging of nozzle from the deposition of solid particle, could it be that Comsol considers the particle as a point (dimensionless)?

    I would like to simulate the clogging of nozzle from the deposition of solid particle, but it seems to be that Comsol consider particle as a point (dimesionless)

    Therefore, when the particle deposit, it will not accumulate in order to make the mesh change (because the particle is dimensionless).

    i attach the image to describe my desired model 

    So, What should I do ?

    Thank you in advance

    Best Regards,
    Yannapol S. 

    Yannapol Sriphutkiat · Nanyang Technological University

    Thank you so much 

  • What is the effect of gasoline engine load on engine emission?

    What is the effect of dynamo meter load (not throttle load) on gasoline engine emissions?

    Tongchit Suthisripok · Rangsit University

    Adding to Prof. Maddali, NOx is temperature dependent component particularly over 2000 deg. C and oxygen present.  In SI engines, exhaust gas composition is substantially different on the lean  AF ratio (low CO2 and CO  due to excess oxygen concentration) and the rich AF ratio (;high CO2 in the insufficient oxygen concentration environment).  Fuel composition has only a modest effect on the magnitude of the emission concentration.  Unburned hydrocarbon emission concentrations vary substantially with engine design and operating conditions. (Ref. J.B. Heywood, Internal Combustion Engine Fundamental)

  • Michael Gebhardt added an answer in Bacteria:
    Any tips for good mRNA extraction from bacteria?

    I would like to know which are the most important points I should consider when performing mRNA extraction from bacteria.

    Michael Gebhardt · University of Chicago

    I think the gold standard for RNA extraction from bacteria involves using the hot phenol method.  For a metabolism stop solution, add ice old 10% Phenol in Ethanol.  

  • Mark Noar added an answer in Stents:
    Is a malignant distal biliary stricture worth SEMTs?

    In our hospital, we use plastic stents for malignant biliary obstruction, usually it needs to be replaced due to its obstruction.

    Due to the nature of the disease, the short life span of the patient, the possible obstruction and the need for replacement and the much more expensive metallic stent... I ask if malignant biliary stricture is worth this very expensive self expanding metallic stent?

    Mark Noar · Endoscopic Microsurgery Associates

    I would tend to agree with Georgios, from a strict viewpoint of stent obstruction only. It is certainly possible that the placement of multiple simultaneous plastic stents can be sufficient if this is a short life expectancy and for palliation only. Having said that, if there is any possibility of any salvage therapy that could prolong the life of the patient, then the SEMS are always a better choice. One important consideration is that we should not only look at the cost of the stents alone. One additional ER visit for cholangitis or hospitalization or return for replacement due to obstructed plastic stents, even within the 3 months, will cost far more than having placed the SEM in the first place.  That is why we are tending to just opt for the SEM immediately.

  • Jennifer Carter asked a question in eLearning:
    Does anyone know of any research into educating existing teachers to incorporate eLearning into the lecture theatre?

    I am interested in incorporating the use of clicker (audience response systems) into our established large group lecture based curriculum in tertiary eduction.  Many of the younger lecturers have been keen to have a go but most of the older, more established teachers are reluctant or out-right refuse to try.  There is plenty of literature to support the benefits of this technology in this setting but uptake has still been difficult.

  • S Kunaratnam Sita Raman added an answer in ESL:
    Can anyone enlighten me on types of assessments that can be used in an ESL classroom to enhance HOTS?

    I am in the process of compiling various types of assessments covering all the four language skills for my ESL classes in line with Bloom's taxonomy. Wonder if you have or know where I can get material of this nature.

    S Kunaratnam Sita Raman · Universiti Teknologi MARA

    Thank you so much Laura for the website address and comment. And Reza, what you say is true. However, in the Malaysian education system traditional used formative and summative assessment are still the main assessment tools used in schools. Alternative assessments such as portfolios and project work , even if used the weightage is very low. Thank you again. You sure have given me what I needed to break out of the box!

  • Denise M. Barbulescu added an answer in Senescence:
    What is the best method for screening wheat leaf senescence in field under stress conditions ?

    In field, how can we estimate leaf senescence with non-destructive method ?

    thanks

    Denise M. Barbulescu · Department of Environment and Primary Industries

    NDVI measurements coupled with chlorophyll reflectance measured by a SPAD meter could be used determine senescence  onset and progression.

  • Shahrukh Khan added an answer in Implant:
    Is ridge mapping with panorama alone enough before implant replacement in posterior edentolous region without using CBCT?

    as ridge mapping can give idea about Bucco-linual width not giving by panorama

    Shahrukh Khan · University of Malaya

    Yes. It is a good estimate of your future implant insertion. But having a CBCT could benefit and confirm the true positioning and future success

  • Why does the resistance of amorphous semiconductors decreases by many orders of magnitude on crystallization?

    It is observed that resistivity decreases drastically on crystallization. Is it due to change in band gap or mobility or both?

    Suresh Sharma · Harcourt Butler Technological Institute

    Dear Mr. Anjani low  mobility is due to absence of long range order... as I have already mentioned above......

  • Daniel Kovach added an answer in Community:
    MCL Community detection algorithm in R?

    Does anyone know any package of R for MCL Community detection algorithm ?

    Daniel Kovach · Gayatri Vidya Parishad College of Engineering

    I have not seen any packages that provide functionality for this 'out of the box', but I did attach a link to a code snippet that may help.