PCR Primer Design

PCR Primer Design

  • N. James asked a question:
    Does anyone know whether is it reliable to trust an assembled contigs sequence?

    I have a sequence (assembled contig) in which bottom 3rd frame shows homology to a known protein. Is it reliable? How should I go about designing primers?

  • Judith Weerts added an answer:
    Are there any difference between real time PCR primers and normal PCR primers?

    gene expression analysis

    Judith Weerts · Academisch Medisch Centrum Universiteit van Amsterdam

    I have very good experience with the free online program by MIT. I design for 100-200 bp products.

    http://bioinfo.ut.ee/primer3-0.4.0/

    The primerblast program from NCBI uses the same interface but also blasts the sequences at the same time. On Biorad real time PCR machines I usually have great efficiency at the first go. For cDNA I always design intron spanning primers.

  • Rinaldo Batista Viana added an answer:
    If we have primers and primary antibodies for bovine species, can we use these primers and primary antibodies also for the buffalo?
    In our lab, we purchased the primers and primary antibodies for the bovine fibroblasts, but now want to conduct the experiment in buffalo fibroblasts. Can we use the same primes and antibodies?
    Rinaldo Batista Viana · Universidade Federal Rural da Amazônia (UFRA)

    I believe we must consider that agents / antibodies in diagnosing using these primers. Some agents that affect cattle do not behave the same way in buffaloes. And certain diseases with similar symptoms can separate agents, which produce antibodies will be specific for each species.

    Rinaldo Viana

    buffaloes health

  • Adam Farkas added an answer:
    Does anyone have knowledge on genotyping for APCmin mice?

    Hi All,

    Does anyone have a good protocol for genotyping APCmin mice? I have the primers from the paper below, but was wondering if anyone has recommendations for the PCR setup (i.e. annealing temp, cycle number and so on). Thanks much. 

    http://cancerres.aacrjournals.org/content/65/22/10623.long#sec-2

    Adam Farkas · Columbia University

    Thanks, Elyse. The genotyping protocol from JAX is a qPCR-based assay so I was looking for a std. PCR assay. I think I've found one though. Thanks for your help.

  • qi Xu added an answer:
    How can I add a palindrome behind my target DNA fragment by PCR? How the primer be designed to avoid the formation of dimers and hairpins during PCR?

    I have a plasmid carried mCherry. Now I want to amplify the mCherry gene sequence from this plasmid, and at the same time add a GAL4 gene sequence just behind mCherry. But, GAL4 gene sequence(17bp) is a palindrome, thus, we cannot just by adding the gene sequence of GAL4 in the reverse primer to achieve our goal. So, how can we achieve our goal by PCR or is there any other new method can help me?

    qi Xu · South University of Science and Technology of China

    Do you mean that we add the first half of the palindrome for the first time. And then, on the second PCR, we add the second half of the palindrome just behind. But, for the  second time, the primer we used becomes a palindrome again, since it must include the first half of the palindrome, and also the second half as templete for this PCR. Or you just mean other ways?

  • Nelson Carvalho Filho added an answer:
    Can anyone help with annealing troubleshooting?

    If you increase annealing temperature, let say from 60 to 63 degrees, will Ct values from the same cDNA concentrations be changed?

    It is just a matter of setting up your machine. The one we have is a CFX96 from bio-rad. http://www.bio-rad.com/pt-br/category/real-time-pcr-detection-systems. 

  • Sena Adi Subrata asked a question:
    Does anybody has experience using SP Designer (Villard & Malausa, 2013) for designing species specific primers?

    I am considering to design species specific primers to identify species from fecal samples. Would you like to suggest me which software is the best ?

  • A. Ripon added an answer:
    How to solve the problem of miRNA stem-loop RT PCR- Endogenous control (U6 snRNA) not working properly?
    I'm having a problem in stem-loop RT PCR for detection of mature microRNA in cultured cell. I can detect both of my target microRNA and endogenous control (RNU6B). I confirmed the correct product size by agarose gel electrophoresis.

    But the problem is when I try to validate the primer using serial diluted template, I can't get any amplification of target U6snRNA. I'm using SYBRgreen detection system.

    I performed gradient PCR and choose the best annealing temperature (57 degree C) and I also tried touch down PCR with annealing temperature (64-55, decrease 0.5 degree C per cycle).

    My initial program was: 95 degree C for 5 min, 35/40 cycle of 95 degree for 5 sec, 57 or 55 degree C for 10 sec, and final extension 72 degree C for 1 sec.

    With all these conditions, my target miRNA primers show perfect linearity in amplification but I can't get any amplification by the endogenous control primer in serially diluted template (3 fold dilution).

    I have isolated the total RNA using mirVana kit (A260/A280 is 1.7) and used 400-100 ng total RNA for cDNA synthesis.

    I have used following primers for U6 snRNA:
    U6 RT- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATATGGAAC
    U6 Forward- CGCAAGGATGACACGCAAATTC
    Universal Reverse- CCAGTGCAGGGTCCGAGGT
    Can anyone suggest any ideas?
    A. Ripon · Tohoku University

    Hi Prashanti,

    I used the following protocols for designing of stem loop RT primer.

    http://nar.oxfordjournals.org/content/33/20/e179.full

    http://www.plantmethods.com/content/3/1/12

    Total RNA works fine for me.

    Thanks.

  • Dung My Hoang added an answer:
    What is the cause of an undetectable PCR product?

    %GC of my primers (59%) is higher than %GC of my template (32%). Do you think that is the cause of undetectable PCR product?

    Dung My Hoang · Chonnam National University

    Thank you for all advices...
    I have a perfect band with extension temperature at 60 C.

  • Nigel E Gapper added an answer:
    Can anyone give me their advice on changing PCR settings for annealing and/concentration in Real Time Sybr green PCR?

    I run real time sybr green pcr (rat hippocampus) and I came accros a primer dimer situation. I use 42.5 nM primers in final concentration. I am getting PDs in whole range of concentrations, from 10 ng to 0.001 ng. I can attach my primer sequences if needed.

    5 HT1a (F) – gtcctgcctttctgtgaaagca

    5 HT1a (R)- tatggcacccaacaacgca

     

    p11 (F) – tgctcatggaaagggagttc

    p11 (R)- ccccgccactagtgatagaa

     

    β-arrestin  (F) –  aagacaccaacctggcttcc

    β-arrestin  (R) – taggacgaaaggtagctccac

    Nigel E Gapper · Cornell University

    I have been using the primer design tool in NCBI without any issues. One thing you could try is different concentrations of your for and rev primers, eg you for primer 3-10 times more concentrated that your rev and vise versa. When our lab started qPCR, this is something we routinely used to find the optimal conditions, but I don't think anyone does this anymore.

  • Petar Dianov Petrov added an answer:
    Why do we need to design a primer for PCR?

    If we want to amplify a target gene, we just find the sequences besides it, and then use the complimentary sequences of them as primers. Why do we need "design" a primer?

    Petar Dianov Petrov · University of the Balearic Islands

    I will quote Stephen Bustin, who said "For qPCR the primers are what the tires  are for a car". You could have Mercedes, but if you run it with bad tires...

  • Fitria Eka Aprilia added an answer:
    How can I avoid Primer - Dimer formation and get our gene amplified?
    I have to amplify a COI gene from Stolus sp. and I have designed the primers. But after amplification with PCR and running on gel I see the band way down the ladder, that is, the band is below the lowest band on the ladder of 150 bps.
    Fitria Eka Aprilia · Brawijaya University

    my friend also conducted research on barcoding Stolus from raja ampat. she use COI F and COI R primer describe by Arn, 1995.  For annealling she use 50  degree celcius. and she succes.

  • Milos Mitic added an answer:
    Primer design for real time PCR
    I am designing my real time PCR pair of primers. I put them into oligoanalyzer to determine hairpin loops, homo and heterodimer formation. What are the limts for a good design regarding these 3 items? The program gives the Gibbs free energy for these three posibilities,There are a number beyond which it is not convenient to synthesize? I understand that any program to design primers get a list of the best primers, but taking into account only the specificity, is that right? So I have to decide also to base on how they act about this kind of other possible reactions, right?
    Milos Mitic · Vinča Institute of Nuclear Sciences

    What are the limts for a good design regarding these 3 items? The program gives the Gibbs free energy for these three posibilities,There are a number beyond which it is not convenient to synthesize?

     

    No one answered to these questions?

  • Vijaykumar S added an answer:
    How to monitor the expression of genes of some protein which name HSP or Heat shock protein in aphids?

    How to monitor expression genes of some protein which name HSP or Heat shock protein in aphids. which I will do this working with PCR, I have to design primers for this HSPs for PCR. I don't know how I can to do this?

    Vijaykumar S · Thiagarajar School of Management, Madurai

    Yes sequence of my aphids is not available in gene bank so i need to design primer for HSP on them. but my problem is we have not genome of Hsp in aphid for designing their primer.

  • Stephen Andrew Bustin added an answer:
    How to design a good primer for qPCR?
    Criteria, software, parameter, expected size, base pair length.
    Stephen Andrew Bustin · Anglia Ruskin University

    Primer Design tool:

    https://www.ncbi.nlm.nih.gov/tools/primer-blast/

    as well as premierbiosoft

     

  • Heather E Doherty added an answer:
    Can anyone help me with some problems I am having with primer Tm?
    I have a set of primers designed by IDT and the Tm for most of them is 62 but I am using Quant fast SYBR green which has an annealing temperature of 60 C and says that the primers should have the Tm below 60. In my qPCR condition, I am using 60 C for 45 seconds and for some of the primers this seems to work, however for a couple of them this does not work. My question is whether the annealing temperature should be the one recommended in the kit or if we can change it to optimize our condition?
    Also, should I order primers with Tm below 60 C?
    Because my samples are not enough to test for various conditions, I am afraid to lose them.
    Heather E Doherty · Plymouth State University
    I ran into this problem recently and found out that the truth is in the fine print. Almost all kits and primer design programs will say in the fine print something similar to "all calculations of primer annealing temps are estimations and ideal annealing temperatures should be determined for each individual assay". They are basically saying that their calculations are estimations or make a lot of assumptions. Don't waste a bunch of SYBR, troubleshooting in qPCR. It's too expensive. Do a regular PCR with cDNA and use a temperature gradient to find the proper annealing temp for your primers. If your PCR machine doesn't have a gradient, run several PCRs at 55, 57, 59, etc... You have the ideal temp when you get one strong band. Then, transition to doing qPCR and further troubleshoot the temperature there (you probably won't have to). Important to mention, if the kit says the maximum is 60C, don't go above that. Redesign your primers (which are cheap) if you need a temp above the maximum for the assay. Good luck!
  • Gabriel Figueroa-Parra added an answer:
    How to check if the primer can attach to another organism from the same family?
    I am working with two types of viruses from the same family. I was provided with specifically designed primers to test if either of the viruses are present in the material. However, I ran a PCR and it shows all my samples contain both viruses according to the primers I used. All those samples must have only one virus! The fragment size is exactly the same as it needed to be if there would be another virus.
    There are two possibilities: either my starting material was infected with both types of the viruses (or I contaminated them during the process) OR the primer is not specific for only one type of the virus since both of them are quite similar (the same family).
    I did PRIMER-BLAST: no, all my primers 100% fits only my desired type of virus and nothing else.
    I did BLAST-TWO-SEQUENCES - Highly similar sequences (mega-blast) - comparing both of the types of viruses: yes, it finds 3 places where it is similar but it looks like none of the places fits my primer sequence.
    How can I analyse those results? Maybe there is some better way to check my primer?
    How does it work?
    I have forward and reverse primer, they have a specific sequence for exact regions of some organism. Can they attach to somewhat similar sequence and do their job? If yes then what are the minimum requirements for the attachment?
    Gabriel Figueroa-Parra · Autonomous University of Nuevo León
    Probably you have both virus in your samples.

    Good luck.
  • Vikas kumar Patel added an answer:
    How do check that the primers published in the paper were rightly designed?
    I amplified a cDNA sequence of a conserved gene with the published primers. I isolated RNA and converted to cDNA with the help of RT enzyme. How do check that the primers published in the paper were rightly designed?
    Vikas kumar Patel · University of Allahabad
    do the primer BLAST using the full length sequence of your's amplified product as template and forward and revers primers from literature, if you are getting the online amplification then primers are correct.
  • Bhupendra singh Punwar added an answer:
    Is it OK to check primer specificity using a nucleotide redundant database?
    I want to design RT PCR primer using primer-blast (ncbi). In the organism I have added Cajanus cajan and in database Refseq mRNA and RNA. It replies that the database for this organism is not available. I have tried it with nucleotide redundant but it gives me primers so my doubt is whether it is fine to check primer specificity using a nucleotide redundant database?
    Bhupendra singh Punwar · Indian Agricultural Research Institute
    since nucleotide redudant database contain Cajanus Cajan genome sequence, you can use it
  • Karim Abdel-Hady added an answer:
    Can micro RNA (miRNA) found in human serum act (itself) as a primer for RT-PCR to give non specific bands on the gel?
    I was amplifying a viral fragment from human serum using RT-PCR. When I amplified a negative sample (not containing the virus), I got a non-specific band in the gel. I got the same non-specific band in a positive sample. Could this band be from the amplification of human RNA, with an interference for miRNA?
    Karim Abdel-Hady · D-Kimia Diagnostic Solutions, LLC.
    Thank you all for your help. The problem is that the non-specific bands don't always appear, it is rather a rare event. I did have the non specific bands sequenced once and indeed they returned BLAST matches that are human. It is strange though because I keep the annealing temperature as high as possible to avoid non-specific binding.
  • Amy Klocko added an answer:
    Does anyone have primers for a sweetgum housekeeping gene?
    There is no publicly available genome or transcriptome for sweetgum (Liquidambar styraciflua) and I've had no success designing primers for the (very few) sequences in GenBank. The one publication I found for RT-PCR of genes in this tree published gene expression without a reference gene (!). Any help would be very appreciated.
    Amy Klocko · Oregon State University
    Thank you very much David, I did not know about those websites and they look like just the sort of information I was hoping to find.

    Amy
  • siva Mallika Donepudi added an answer:
    Can anybody help me calculate primer dilutions?
    I have a 20 picomole concentration of working stock of primers but I need 1 micro mole for the final concentration in my PCR vail. Please guide me to what the calculation is, and how much volume of 20 pm primer should be added to get 1 micro mole concentration?
    siva Mallika Donepudi · Acharya Nagarjuna University
    Thank you all actually I have working primer conc of 20 pm/ ul.
  • Bailey Massa added an answer:
    What is the reason for getting a fragment of DNA rather than a vector after mutagenesis PCR reaction?
    I have done a lot of mutagenesis and I have a protocol that usually works 90% of the time in pET21d and pGEX6P-1 vectors. I have started mutating sequences in mammalian vectors such as pcDNA3 and 5 and for one of the mutagenesis reactions I always get a band at about 2 or 300 bps. I have increased the annealing temperature, increased the elongation time, but I always get this fragment produced. When I transform the reaction into DH5alphas I don't get any transformants. I have also redesigned the primers making them slightly longer to 45 nucleotides with a Tm of 78. I am not sure what else to try.
    Bailey Massa · Newcastle University
    Thanks for all of the suggestions.

    It was a site-directed mutagenesis done with the Agilent quick change kit as well as using phusion enzyme. The vector is about 6 kb and I have given sufficient extension times. I didn't do a PCR purification I just dpnI digested and then ran that on a gel.

    I will try your suggestions and let you know how it goes.
  • Andrew D Beggs added an answer:
    Can anyone suggest a better primer designer than Exon Primer?
    I am trying to design a set of primers to cover the coding region of a gene. I have looked at Exon Primer, but it doesn't really do what I want:

    1) To design to strict size limits, i.e. the amplicon should be < 200bp
    2) To stick to a very rigid Tm, i.e. 60 C
    3) To split the exon designs into multiple parts if the design template is too long

    Exon Primer doesn't seem flexible enough to do this - any other suggestions (other than doing it manually).
    Andrew D Beggs · University of Birmingham
    Thank you so much! If I could rate up your post more I would - a very useful tool. I am, as you have guessed, designing a panel of amplicons for targeted resquencing using a Fluidigm Access Array. I therefore need quite rigid conditions for it to work.
  • Jack M Gallup added an answer:
    Any idea as to why I might have some highly variant 18S Ct values while other targets amplify normally?
    Troubleshooting issues:
    In RT-PCR, we have had trouble with our usual amplifications of 18S using SYBR green primers. We have tried multiple, already tested and confirmed sets of primers, and multiple sets of samples. We thought this may have been an issues with cDNA synthesis, however when testing other targets with SYBR green primers, the amplification was as expected.

    In 18S runs, with ~40 samples, we have a range from 20-45 cycles for Ct values while the other targets are within a narrow (expected) range of 3-5 cycles. The problem has appeared in a number of other experimental models in mouse tissue though the variability does not occur in C2C12s -- only harvested, mouse skeletal muscle. The Tm Peaks look normal. We have only just switched to SYBR for our endogenous control. Previously, TAQMAN probes for 18S were used and they worked fine.

    Any suggestions/ideas? Why would this gene that is hardly ever altered, even slightly, show dramatic variances in expression?
    Jack M Gallup · Iowa State University
    Daniel brings up an important point since 18S has no poly A tail on which to use the oligo (dT). Plus, you should dilute samples 1000X more when assessing them for 18S since it is among the most abundant targets out there -- it can inhibit qPCR when too much is present (template inhibition of 'Taq') - giving falsely high Ct values. The log linear dynamic range for 18S is obtained much farther out on the sample dilution scale than most other targets. E.g., be sure to do a dilution series from most concentrated out to 1:5,000,000 to see this for your self. 18S is very abundant.
  • Richard Christen added an answer:
    Does anyone know how to calculate (theoretically) the optimum annealing temperature of a primer set?
    I have a couple of primer sets and am interested in calculating their theoretical annealing temperature before the actual optimization. I understand we can use +-5C of Tm gradient and find the exact Ta. But I wonder whether anybody has ever used an equation which can possibly tells us anything about Ta of a given primers. I found this equation on the web
    Ta Opt = 0.3 x(Tm of primer) + 0.7 x(Tm of product) - 25
    But I don't necessarily know how to find the Tm of product or it gives a temperature above 1000Cs.

    Please advise me. Thanks
    Richard Christen · University of Nice-Sophia Antipolis
    There are several methods to compute a theoretical Tm
    try
    http://www.ebi.ac.uk/compneur-srv/melting/ probably the best

    http://www.mybiosoftware.com/pcr-primer-design/6607
    or
    http://melolab.org/dnaMATE/tm-pred.html very simple


    If you have both target and non target (that you don want to amplify) take a look at
    http://bioinfo.unice.fr/softwares/ohm/

    finally, a list of tools
    http://omictools.com/primer-quality/
  • Henk-jan Schoonbeek added an answer:
    What is the best online PCR primer design?
    I'm using NCBI's Primer-Blast to design primers for qPCR. When I get the results, is the first primer pair listed generally my best bet? I ask because I recently noticed that the first primer pair result for rat PPIA has several more potential off-target amplicons, but has a lower 3'-complementarity score (2, versus 3 for the second pair).
    Henk-jan Schoonbeek · John Innes Centre
    I quite like Primer3 but usually set the temperatures a bit higher than default
  • Pietro Pilo Boyl added an answer:
    Is there already for purification and then sequencing?
    From left to right:
    1. Marker for the length of DNA base pairs (Ladder DNA from 0.1 until 1.0 kb)
    2. & 3. = empty
    4. PCR using sample E
    5. PCR using sample F
    6. PCR using sample G
    Pietro Pilo Boyl · University of Bonn
    Good quality sequencing with the Thermosequenase and fluorescent dideoxy nucleotides requires about 100 ng per 1000 bp of purified PCR fragment. From what I see in your gel, the marker seems the 100 bp, so your fragments should be around 7-800 bp, which means you could sequence them with only 100 ng of PCR product. Now, it depends what you loaded on the gel: if it is 1/10th of your PCR reaction, probably after gel extraction you'll have enough to sequence (even though you've got quite a lot of Ethidium bromide there, so there is not much DNA on gel...), but if on gel you have the entire PCR reaction I would doubt it, mostly for well 5 and 6. In this case you should pool a few reactions or re-amplify your first reaction (which might have a higher chance to introduce mutations and increase the unspecific bands).
  • Can anyone help me figure out if there are any primer-dimer formations in this visualization?
    I was using High Pure PCR Template Preparation Kit version 20 from Roche to isolate DNA from Holothurians. But something unpredictable was happened.

    (from left to right, in the photograph):
    1. Marker for the length of DNA base pairs
    2. DNA solution using sample A
    3. DNA solution using sample B
    4. PCR using sample A
    5. PCR using sample B
    6. PCR using sample C
    7. PCR using sample D

    Nb: Sample A was a similar species to sample B, but not for the individual. Sample A and B are of a different genus with either sample C or D. Sample C was a similar species with sample D, but not for the individual.
    Alexander Kurniawan Sariyanto Putera · Airlangga University
    Thank you all of your comment and suggest.
  • Manvi Singh added an answer:
    Can someone suggest universal primers for fungal 18S rDNA gene PCR amplification?
    As we are already tried the ITS1F and ITS4R primer set, but its not working..
    Manvi Singh · National Botanical Research Institute - India
    I did characterization for about 50 fungal strains isolated from soil, using two different sets of primers. PN3 f and PN10 r & ITS1 f and ITS4 r , showed good amplification with all strains. And also change (if you are using) Taq Pol with some high fidelity and Proof Reading enzyme like PR Polymerase, HoT Start.

Topic Followers (96) See all