PCR Primer Design

PCR Primer Design

  • Kajan Muneeswaran added an answer:
    Any advice on ARMS PCR Primer design?

    Hi all,

    I'm trying to perform ARMS PCR to see if certain cell lines that I'm interested in show heterozygosity for SNP rs2736098 (in exon 2 of TERT gene)

    This is my first time doing ARMS PCR and practically don't have any idea how to design a primer for this.. I understand the theory but I'm worried that Primer design may be different from standard PCR.

    Input from experts in this aspect would be greatly appreciated !

    Kajan Muneeswaran

    I would like to share some more useful links on ARMS-PCR
    Designing tool : http://primer1.soton.ac.uk/primer1.html

    • Source
      [Show abstract] [Hide abstract]
      ABSTRACT: Objectives: Genotyping of single-nucleotide polymorphisms (SNPs) has been applied in various genetic contexts. Tetra-primer amplification refractory mutation system (ARMS) polymerase chain reaction (PCR) is reported as a prominent assay for SNP genotyping. However, there were published data that may question the reliability of this method on some occasions, in addition to a laborious and time-consuming procedure of the optimization step. In the current study, a new SNP genotyping method named modified tetra-primer ARMS (MTPA) PCR was developed based on tetra-primer ARMS PCR. Design and methods: The modified method has two improvements in its instruction, including equalization of outer primer and inner primer strength by additional mismatch in outer primers, and consideration of equal annealing temperature of specific fragments more than melting temperature of primers. Advantageously, a new computer software was provided for designing primers based on novel concepts. Results: The usual tetra-primer ARMS PCR has a laborious process for optimization. In nonoptimal PCR programs, identification of the accurate genotype was found to be very difficult. However, in MTPA PCR, equalization of the amplicons and primer strength leads to increasing specificity and convenience of genotyping, which was validated by sequencing. Conclusions: In the MTPA PCR technique, a new mismatch at -2 positions of outer primers and equal annealing temperature improve the genotyping procedure. Together, the introduced method could be suggested as a powerful tool for genotyping single-nucleotide mutations and polymorphisms.
      Genetic Testing and Molecular Biomarkers 02/2015; 19(3). DOI:10.1089/gtmb.2014.0289
  • Václav Bačovský added an answer:
    Hi, has anyone experience with AllPrepp DNA/RNA Mini Kit from Qiagen? How big yield you can get and it is working on plants tissues too?

    I would like to isolate DNA/RNA from small seedlings-20-40 mg only.

    Václav Bačovský

    Many thanks, I will try it

  • Roshan Kumar added an answer:
    Troubleshooting amplifying coding region of the beet paralogs BvFT1 and BvFT2 from genomic DNA?

    I have some trouble amplifying the paralogs BvFT1 and BvFT2 from sugar beet within a panel of different genotypes. I know that both share a lot of sequence identity so I blasted both and designed primers within non-similar regions as well as I designed mismatch-primers ending at SNP positions between both genes. I have designed and tested primers within exons, within introns and within the UTRs.. I tried a lot of different primer combinations, gradient PCR for optimizing, I did nested PCR and double-nested PCR and vector-transformation and plasmid cloning as well as I tried different master-mixes, different DNA templates, different Taq Polymerases..but nothing worked quiet well for sequencing. I have nice products with the correct fragment size but still sequencing shows a lot of background noise and is just working sometimes for some single genotypes. I am running out of options here is there anyone with an idea? Or is there anyone who might have some working primers? I need to cover the whole coding regions. Maybe one of you has an idea.

    Roshan Kumar

    HI Nadine

    Do both the paralogs are of same size?

    What you can try design the primers from upstream and downstream of the gene, and try to amplify them using phusion polymerase

  • Artur Burzynski added an answer:
    My designed primer mRNA sequence has similarity with another DNA sequence gene. How do I solve this problem?

    My target gene mRNA sequence has similarity 99% with GRCh38.p2 DNA sequence, I have problem for Real Time PCR primer design, because all designed primers identifies this DNA sequence. How do I solve this problem?
    Is DNase treatment to delete gDNA the only way?

  • David f Barker added an answer:
    Does qRT-PCR amplify ONLY from fully spliced mRNA? Or could it amplify some pre-mRNA that still contains introns?

    Does qRT-PCR amplify ONLY from fully spliced mRNA? Or could it amplify some pre-mRNA that still contains introns? I’m not a qRT-PCR expert, and before I reproduce a method from a paper, I want to be sure it is properly designed.

     The scenario: A gene that is expressed in two forms – a full-length form, and a shortened form by activation of an alternate transcriptional start site. The alternate start site is in the first intron of the gene. Therefore the shortened protein is lacking the first exon, but otherwise identical to the full-length isoform.

     The method quantifies the expression of each type using qRT-PCR (reverse transcription, then real-time PCR). There are 3 primers:

    1. Forward, for full-length, within the first exon.

    2. Forward, for shortened, within the first intron.

    3. Reverse, for both isoforms, within the second exon.

     -Full-length should be amplified by primers 1 & 3, because the first intron containing primer 2 has been spliced out of the mRNA.

    -The shortened version will be amplified by primers 2 & 3, because the mRNA only starts at the 5’-untranslated region in the first intron which contains primer 2.

     But, if some unspliced RNA is produced by the RT reaction, then primer 2 could bind to the unspliced intron 1 in transcripts of the full-length gene, falsely inflating the reported amount of the shortened variant. Is this a valid concern?

    Random vs. oligo(dT) primers for reverse transcription: oligo(dT) primers should (I think) prevent or limit the amount of unspliced pre-mRNA, but will they reliably amplify the approximately 1 kb of transcript, from 3’-end to the 5’ first and second exons for which the qRT-PCR primers are targeted? Alternatively, can I trust random primers to reliably amplify only fully-spliced mRNA?

     Contaminating genomic DNA: Can I be confident that DNAse will completely eliminate any genomic DNA? Because primers 2 and 3 will happily amplify directly from the genomic template.

    I've looked for information on this subject, but I'm still not confident in my understanding. So any help would definitely be appreciated. 

    David f Barker

    Melting analysis (assuming you are using Sybr green) should be a sensitive way to determine if there is any problem with amplification of the primary RNA from the longer transcript when you use the short-specific primer pair.  Your description is a bit ambiguous with respect to whether there is an intron segment between the short product first exon and the second exon.  If there is, you can also design a primer which bridges the junction between the end of the first exon of the short mRNA and the second exon.  This primer would have only a 3' match of 4 to 6  bases with the 5' sequence of the second exon and the 5' part of the primer would be from the 3' end of the short promoter first exon.  This would avoid amplification of both genomic DNA and the primary transcript from the longer product promoter.  In fact, you could design such a primer for the longer promoter product as well--and still use the same reverse primer for both amplifications.

  • Xupeng Hong added an answer:
    Any advice on Taqman probe specificity problem?

    I have two viruses that are fairly similar. The design of the primer relied basically in minimum differences since these viruses are too similar. I could make the assay work under SYGR assay but after 30 cycles some amplification is detected. When I run the gel, no bands are visible. We decided to move to Taqman probes to eliminate the detection that SYGR has. However since the viruses are too similar, the probes are not specific. However the set of primers are like 300bp apart. Do you think I might have a problem if I try to multiplex the sample?

    Xupeng Hong

    Hi, although the idea length of amplicon is 50-150bp, but I think 300 bp is also could work. Based on the specificity, I want to say whether you could design the primer beyond the same sequence. Do you have the genomic sequence of these 2 viruses? Before you run RT-PCR, you may run normal PCR first to check the specificity. I strongly advise you to change the primers and run RT-PCR with SYBR. Good Luck. 

  • Noha Said added an answer:
    Is the primer used for real time pcr different from that used in conventional pcr?

    i want to know about real time pcr primer way of designing. i want the programe used for designing real time pcr primers. i want to know hoe to interpret the results. i want to know how to avoid primer dimer. 

    Noha Said

    thanks Alejandro Olmedo so much. i could understand what you siad. thanks again so much

  • Yuan-Yeu Yau added an answer:
    How can I perform PCR in one reaction tube?

    Hello everyone,

    Regularly I do PCR for target and housekeeping genes in two reaction tubes. But now I have very small amount of rare cDNA. I need to save it. So I decided to perform PCR for two genes in one reaction tube to use less cDNA. I checked primers - they are work well in different tubes but when I use the same protocol in one reaction tube I get a housekeeping gene band only. Please could you help me to figure out what is wrong? Thank you.

    Yuan-Yeu Yau

    Hi Alex,

    Can these two bands (135 bp, 176 bp) separate well on a gel? You said that you were successful in PCR amplifying them if separately. Have you tried to run the mixture of those successful PCR products on a gel to see whether they can be separated.

    Can you post your gel pictures, including 'single' and 'multiplex' PCR results?

  • Paola Campomenosi added an answer:
    Any recipe for home-made gel solubilization solution for DGGE gels?


    I´d like to know it is possible to prepare in the lab an efficient gel solubilization solution for the bands being cut in DGGE gels, to reamplify the DNA with primers with GC clamps, and if you could share any recipe it would be great. 

    According to a technical bulletin of Gen Elute Gel Extraction kif from Sigma, the gel solubilization solution is a final part of the process of elution of the bands of acrylamide, and is actually different from an elution solution, with which the DNA is released from the acrylamide band cut. 

    Thanks very much for the comments! 

    Martha S. 

    Paola Campomenosi

    In my experience on DGGE, that dates a few years back ;-), it was sufficient to CUT the band of interest out, mince, add a small volume (eg 50 microliters) of nuclease free water and leave at 4 degrees C, ON. The following day you had enough template for PCR.. Good luck!

  • Michael Marcus Hoffmann added an answer:
    Is it possible to fuse two mCherry sequences (identical DNA sequences) by overlap extension PCR using unique linker regions?

    I am trying to generate a 2x mCherry sequence using overlap PCR. The first reaction generates good fragments with overhanging sequences (linkers) but the following 'fusion reaction' does not work. Any ideas why the second reaction does not work? It is important to say that the two fragments I want to fuse (mCherry sequence) have identical sequences apart from the designed overhanging linkers.

    Here is what I do:

    Primer 1: 5'-(25bp nesting region 1)ATGGTGAGCAAGGGCGAG-3'



    Primer 4: 5'-CTTGTACAGCTCGTCCATGC(25bp nesting region 2)-3'

    Primer 5 and 6: 25bp nesting regions in primer 1 and 2, respectively.

    I generate two fragments using primer pairs 1+2 and 3+4. I purify these fragments and use it in a second reaction where I use nested primers (5+6) to amplify the larger fragment. This second reaction does not work. 

    Michael Marcus Hoffmann

    Yes, with this homology you have to change your strategy. Good luck with cloning!

  • Kamal Sadeghi asked a question:
    Dose any one worked on metallothionein in fungi?

    I need primers of metallothionein  genes in fungi to detect these area in Trichoderma spp. and Fusarium spp.

  • Mohamed A. A. Mahdy added an answer:
    Are there published qPCR primer sequences for detection of mouse NLRP3 and mouse IL-18?

    I'm looking for published qPCR primer sequences for detection of mouse NLRP3 and mouse IL-18, to be used with either SYBR Green or TaqMan chemistry. Any suggestions? It seems that commercial primer assays are commonly used for these targets.

    Mohamed A. A. Mahdy

    You are welcome Kristina, wishing the best for you

  • Modestas Ruzauskas added an answer:
    What are the best primers for 16S rRNR sequencing for identification of soil bacteria isolates?

    I would like to identify (by 16SrRNR sequencing and blasting) bacteria (pure cultures) prevalent in a soil. Which primer pair or sets of primer pairs would be the most useful for that reason? 

    Modestas Ruzauskas


  • Alejandro Olmedo added an answer:
    Does anyone know about bioinformatic software to analyze primers with deoxyinosine?

    I'm trying to design primers which contain deoxyinosines, but I was wondering if there is any specific software or a well known software which help me calculate the °Tm and other thermodynamic parameters for a primer with deoxyinosines??

    Alejandro Olmedo

    Thanks for your suggestion Rachayata, but how do you use it to analyze a degenerate primer? I was trying, but I couldn't do it. And Rayne, yes Primer3 gives you the parameters; however, it doesn't accept other letters in the sequence than A,C,G,T; so, for this purpose (analyzing a degenerate primer) Primer3 doesn´t work.

  • Nazmiara Sabnam added an answer:
    How can I create a translational GFP fusion of (PTrpC promoter + Gene of interest + eGFP + TTrpC Terminator) without frameshifts by overlapping PCR?

    Actually I need to make a construct for protein localization and I don't have any idea how to stitch so many fragments together. Can anyone suggest me how to do that starting from primer designing and doing PCR. The promoter and eGFP+TTrpc terminator are available from two different plasmid vectors whereas I can simply get the CDS in conventional way. Is there any necessity to join all the fragments in such a way that between any of the fragments there shouldn't be any restriction sites added additionally so that if this strategy fails I can go for one by one cloning too. Please reply as soon as possible. Thank You!!!

    Nazmiara Sabnam

    Thank you so much!!! I have designed primers and let's see hopefully it will work.

  • Steve Baeyen added an answer:
    How will I know if the PCR product is oriented (Fwd. or reverse) in the sequence data?

    I have performed cloning for the gene of interest using pcrII TOPO vector. After the slection steps and innoculation steps I isolated the plasmids using QIAGEN kit and then measured using nanodrop. Then I performed PCR from a fraction of the isolated plasmid to check if the gene of interest has been incorporated within the plasmid and the PCR worked. I sent the samples for sequencing and we have used M13 reverse primer. But what we dont know if our products are fwd oriented or reverse oriented. I have been asked to do sequence alignment using ebi.ac.uk but I dont understand how to proceed and what I infer. I would appreciate if anyone can tell me how to go about or proceed.

  • Arbind Kumar added an answer:
    Can I use reverse transcription pcr primer for real-time pcr?

    I have a primer for reverse transcription pcr but I want to perform real-time pcr. Is it possible using the same primer for both reverse trascription pcr and real-time pcr? Thanks~!

    Arbind Kumar

    Hi Jung, You can use

    But  amplicon size should be around 80-200 bp in length.

    Longer amplicon size  compromises the efficiency of qPCR

  • Lalita Sharma added an answer:
    Can we use Real time primers for doing simple semiquantitative RT- PCR if the product size is within detection limit?

    I want to do simple RT- PCR for some genes. so, can I use the primer seq. which are used for real time PCR for these genes. The product size of real time PCR is generaly v. small. so if the product size is within detection limit (on gel) . so can Iu se the same seq. for simple RT- PCR?

    Lalita Sharma

    Thanks all of  ypou for all the valuable suggestion.

  • Péter Gyarmati added an answer:
    No turbidity in LAMP product tubes. Smears and multiple bands on agarose gel for negative control as well. What could be wrong with the protocol?

    I recently started working with LAMP (Loop-mediated Isothermal Amplification) using target DNA. I designed 4 primers using PrimerExplorer V3. I use LAMP Kit by Lucigen, Inc. For some reason I do not see any turbidity in the tubes after 1 hour of reaction at 70 degree C in the thermal cycler. On the agarose gel, I can see multiple bands for my LAMP reaction products but I also see huge smears throughout the lanes along with thick band near the gel. My negative control (reaction mixture without template) gives me the same result. Can you suggest what is wrong with my protocol? Thank you for your help.

    Péter Gyarmati


    Just like Panduranga said, it is most likely an amplification artifact in your no template controls. Try decreasing incubation time, but if you dont see specific products at all, it might be something with the oligo design/template cc. Here is a general guideline:


  • Alejandro Olmedo added an answer:
    How can I solve primer dimer & faint PCR product problem ?

    My PCR product appear very faint with primer dimer in each samples , I tried to increase annealing temperature , the extension time and the initial denaturation temperature as recommended in  PCR troubleshooting  guidelines but I didnot get the clear bands , take in considerations I previously optimized the condition and get very clear and sharp bands but after 2 months of stop working I lose my bands , how I can cover these problem ?? 

    Alejandro Olmedo

    Did you analyze if your primers (F and R) are complementary between themselves?

    If not, you can use this software: oligoanalyzer https://www.idtdna.com/calc/analyzer

    Where you put the sequence of each primer and then analyze if they form primers dimers with itself and with the another primer, and even all those secondary structures such as hairpins with their delta G, all this taking into account the conditions of your PCR (concentrations of cations: Na, Mg, and the temperature of annealing)

  • Alejandro Olmedo added an answer:
    Is there are any difference between designing gene specific primers For RT -PCR and qpcr ?

    How can i design primer to complete my experiment ? 

    Alejandro Olmedo

    It depends on the chemistry of your qPCR. If you're going to use Taqman qPCR you will need a probe which aligns in the middle of the product that detect the primers set (Probe attached a kind of fluorescent molecular or something similar and °Tm of the probe has to be 10°C greater than the °Tm of the primers set). If you use SyBR Green you design normally the primers. But, in both cases, it's preferable that your products don't have more than 150 bp (or no more 300 bp). And in the case of RT-PCR, there are some random primers depending on the kind of tissue or sample which you're handling in the RT, and in the PCR, designing the primers is developed normally, but you can have products from 80 to 1000-2000 bp.

    Hope that this information is useful.

  • Mohammed Sulaiman added an answer:
    Can anyone help me with the best primer(s) for RT-PCR amplification of RFT1 gene from Indica Rice?

    Can anyone help me with the best primer(s) for RT-PCR amplification of RFT1 gene from Indica Rice ?

    Mohammed Sulaiman

    Thanks for the respond. I already design now !

  • Craig A Gelfand added an answer:
    Is there a tool to help design primers for single base extension?

    I'm trying to design primers for analyzing SNPs via single base extension. I know I need to use a F or R primer that lines up to the SNP, but I'm trying to figure out how many base pairs to use, melting temperature and possible secondary structure. I've tried using BatchPrimer3, but it offers no primers, even when I broaden the search criteria. Does anyone have tips on how to do this, or know of a program that I can use to help design these primers? If there are tips on how to broaden the search criteria (GC content, self complementarity etc.) also, I would appreciate that.

    Craig A Gelfand

    Further suggestion to above (especially the idea of designing 2-3 primers):

    I spent a few years developing high-throughput SNP technologies.  When you are doing initial evaluation of a new SNP (or at least new to your lab), it can be beneficial to order and test both F and R primers for the single-base extension step.  Oligos are so cheap that it's not much of an expense.  The benefit is that you get confirmatory information -- the SNP data read from either direction must match (and if not, something else is going wrong).  Among the issues this can help identify is whether there are nearby (possibly undiscovered) SNPs that interfere with your primers.  Remember that this should always be a concern with PCR primers also, but with only 1 primer the single-base SNP assays are a bit more sensitive to this. 

  • Henry Okuchukwu Ebili added an answer:
    Between PimerStation and MPprimer, which one performs better at designing primers for multiplex PCR?

    I am attempting to design a multiplex PCR assay. I want to find out which software,between PrimerStation and MPprimer, has better performance at designing primers for multiplex PCRs.

    Henry Okuchukwu Ebili

     Thanks for the suggestions.  I am going to attempt  my primer design using your advice.

  • Michel Kostantin added an answer:
    What are specific primers for qPCR measurement for HCC other than AFP?

    We've already tried EpCAM, ASGPR, CK-18 and Albumin. They were all positive in healthy blood making them useless. AFP showed great results but we need a second one to increase specifity.

    Michel Kostantin

    Dear Jae-Hwi thank you for taking the time to answer my question. We´re working with CTCs detection in HCC patients using different methods, one of them being qPCR. The only primer giving good results so far is AFP and we were hoping to find another one with similar results to use alongside AFP to increase the specifity of this approach. Would lymphotoxins remain negative in samples from hepatitis patients and healthy volunteers?

  • Pratima Chawla added an answer:
    Anyone familiar with SMARTER RACE 5' and 3' Kit?

    Dear all,

    I would like to ask for general recommendations to anyone with experience of using the aforementioned kit for their RACE PCR.

    I am currently having difficulties on using the kit for both 5' and 3' RACE of which I am running out of options on where to troubleshoot, and hence any alternative point of view which I may have missed would be most welcomed.

    At the moment, I have a total RNA sample that I know contains my mRNA of interest, as using the same sample, I managed to synthesize first strand cDNAs. To my understanding, since I used oligo dT primers to do so, the synthesized sequence should be originating from only mRNAs present within. With use of designed degenerate primers on the cDNAs, I managed to obtain a partial fragment of my gene of interest some 700bp long of which I used to design gene specific primers for RACE.

    Unfortunately, after following the protocols outlined from first strand synthesis to nested RACE PCR, I have so far been unable to obtain any bands of any kind. All this is in view of using the same RNA aliquot obtained earlier, with integrity and concentration prior to use verified via denaturing gel electrophoresis via nanodrop. The primers I designed (sense for 3' RACE and antisense for 5' RACE) have been deemed to be good and later confirmed via amplification of the correct size of band.

    From this result, and assuming the other components have been administered as sufficient, my main hunch as to where it could go wrong is on the first strand synthesis for both strands, of which the 5' CDS and 3' CDS primers (at 0.5µM per reaction,functions as oligo dT primer shall function) may have difficulty in binding to the polyA tails due to the initial total RNA concentration being low, but again I iterate that this is all a hunch and nothing is certain.

    Should anyone else out there be familiar with RACE PCR of a different kind, attached with this email is the User Manual for the aforementioned kit, which may prove useful for comparison. Any help is much appreciated and I extend my thanks in advance for all the kind souls out there willing to do so :)

    Pratima Chawla

    I use the same kit for 5' RACE and I got the result. what I do is follow the exact protocol and changes et al and I use every thing from the kit even the deionized water.

    Main thing is the integrity of mRNA used, for that you can check your mRNa either by formaldehyde denaturing gel for RNA detection or you can incubate a little portion of your mRNa at 37C for 2 hours and remaining in -80 and then compare both mRNA (37 and -80) by using 1.5% EtBr gel. If the expression is different after 37C incubation that means your RNA contains RNase which is a huge problem. then you should be more careful during RNA extraction

    Good luck

  • Camilla Dalby Hansen added an answer:
    Why does my PCR samples not show?

    I'm doing PCR and the samples do not show. 

    We have tried EVERYTHING: Change of primers, change of buffer, change of percentage, new tails, new everything. And we've tried to add more and less DNA pr. sample.

    The most confusing part is that the controls show every time, which means that the protocol should be okay? 

    The first picture is how it looks 9 out of 10 times.

    The second picture is the closest we got to something, where we used: 
    0.8% gel
    10uL MasterMix
      8uL H2O
      1uL Primer
      1uL DNA

    + 1 more attachment

    Camilla Dalby Hansen

    We reduced the annealing temp. and changed the DNA-extraction protocol - AND IT FINALLY WORKED !!! :) Thank you for your help! 

  • Bruno Gabriel Berardino added an answer:
    How many stem loop primers could I use in a single RT reaction for specific retrotranscription of various miRNAs?

    I have done some RTs for miRNA retrotranscription, but since we work with limited RNA mass from our samples, I would like to retrotranscribe several miRNAs in a single RT reaction. I have tried adding up to 4 stem loop primers and worked well. Has anyone have experience in scaling this up to 10 or 20 stem loop miRNA-specific primers? In this case, did you work with constant concentration or constant mass for the primers?

    Bruno Gabriel Berardino

    Thank you very much for your answers Thomas, Johannes and Raihana!

    Thomas and Johannes: are those products suitable for SYBR qPCR detection or they are only usable with TaqMan technology?

    Raihana: when performing the RT reaction for 5 genes vs 6 genes, do you usually add the same amount of mass for all the stem loop primers (i.e. fixed total nmoles) or you conserve the concentration of each (i.e. for 5 genes you would have less total nmoles of primers than for 6 genes)?

  • Guillaume Dubois added an answer:
    How can I optimized long primer PCR ?


    I need to insert the V5 tag next to a protein into a pBAC, and we want to use the red-mediated recombination to do so. I first need to amplify the kanamycin resistance sequence from pEPkan-S with addition of homologue sequences to our pBAC by PCR. We designed these two primers:

    For: gctgttgactttattacctggcgcagacaggagttaaatgggtaagcctatccctaaccctctcctcggtctcgattctacgggtggttctggtggttcttagggataacagggtaatcgattt  124nt Tm: 71.5°C %GC: 48.4% from IDT DNA

    Rev: cataccacacagtgtctgcaagataagcatcagccataaaagaaccaccagaaccacccgtagaatcgagaccgaggagagggttagggataggcttaccgccagtgttacaaccaattaacc 123nt Tm: 71.5°C %GC: 48.8% from IDT DNA

    The expected size of our amplicon is 1188nt.

    We tried the PCR following this protocol:

    Template (pEP-kanS): 1 µl (~10 ng)
    5X Buffer: 10 µl
    dNTP (HF grade): 5 µl of 2mM
    Primer Forward: 2.5 µl of 10 pmol/µl
    Primer Reverse: 2.5 µl of 10 pmol/µl
    NEB Q5 Polymerase: 0.5 µl
    H2O (HF grade): 28.5 µl
    Total: 50 µl

    98°C, 30 s ; (98°C, 30 s; 50°C, 30 s; 72°C, 1.5 min) x 8 cycles ; (94°C, 30 s; 60°C, 30 s; 72°C, 1.5 min) x 22 cycles ; 72°C, 2 min

    Up to now, after migration on a 1% agarose gel, I only see the primer dimers on the gel. We are trying to optimize the chosen temperature for the annealing step, but without success. We will also try to do the PCR with 3-9% DMSO to help the annealing of our primers.

    I am aware that the primers can easily form dimers, especially because both of them contain the V5 tag, but we have no other option for them. So I was wondering if you could give me advices on which parameters I could optimize for this step. We will try adding some DMSO as I said, and to reduce the quantity of primers used, hoping it will help the annealing to pBAC.

    Best regards.

    Guillaume Dubois

    Hi, Sorry for my late answer.

    Thank to all of you for your advices. It appears that just by decreasing the primers concentration to 0.2µM final with 9% DMSO it works very well. The primers seemed to be too concentrated, facilitating the formation of dimers instead of the annealing to the template.

Topic followers (124) See all