Molecular Cloning

Molecular Cloning

  • Fazel Gorjipour added an answer:
    I have a big problem, after 4 months I couldn't amplify the Bmp2 gene by cDNA synthesis and PCR. Can anybody help me?
    Liver tissue was used for extraction of Bmp2 RNA.
    Fazel Gorjipour · Iran University of Medical Science
    If you did all this and the result is yet the same, please come to my office at your first convenience. I have some points. We could check everything together. ;)
  • Henk-jan Schoonbeek added an answer:
    What should be done if my pcr products are giving laddering effect even after altering the annealing temp. & using fresh aliquotes of every component?
    1F- GCTCCTACAAATGCCATCA
    1R- GATAGTGGGATTGTGCGTCA

    2F- GCATGACGTTATTTATGAGATGGG
    2R- GACACCGCGCGCGATAATTTATCC

    are the primers came with dst purification from sigma and taq dna polymerase from sigma with optimized 10X buff, using the same company's dNTPs mix for standard PCR

    cycling conditions were
    1 cycle of 95 degree for 5min
    35 cycles of 94 degree for 30secs, 62degrees for 40secs, 72 degrees for 40secs
    final extension was at 72degrees for 5mins
    and hold at 4degrees

    results was only the nonspecific bands like laddering effect starting at below 500bp
    Henk-jan Schoonbeek · John Innes Centre
    Do you know how your template is organised?
    Aren't there suppossed to be 2 fragments?
    Because, if you just BLAST your primers there areseveral constructs in which they bind twice:

    Gossypium hirsutum transgenic line MON15985 promoter region
    Sequence ID: gb|KJ608138.1|Length: 610Number of Matches: 3
    Related Information
    Range 1: 537 to 556GenBankGraphics Next Match Previous Match
    Alignment statistics for match #1 Score Expect Identities Gaps Strand
    40.1 bits(20) 0.93 20/20(100%) 0/20(0%) Plus/Minus

    Query 20 GATAGTGGGATTGTGCGTCA 39
    ||||||||||||||||||||
    Sbjct 556 GATAGTGGGATTGTGCGTCA 537


    Range 2: 101 to 119GenBankGraphics Next Match Previous Match First Match
    Alignment statistics for match #2 Score Expect Identities Gaps Strand
    38.2 bits(19) 3.7 19/19(100%) 0/19(0%) Plus/Plus

    Query 1 GCTCCTACAAATGCCATCA 19
    |||||||||||||||||||
    Sbjct 101 GCTCCTACAAATGCCATCA 119


    Range 3: 362 to 380GenBankGraphics Next Match Previous Match First Match
    Alignment statistics for match #3 Score Expect Identities Gaps Strand
    38.2 bits(19) 3.7 19/19(100%) 0/19(0%) Plus/Plus

    Query 1 GCTCCTACAAATGCCATCA 19
    |||||||||||||||||||
    Sbjct 362 GCTCCTACAAATGCCATCA 380


    Possibly you have a double 35S in your template. I don't know which size marker you used, are the fragments about 456 and 200 bp? (MAybe not they seem to be a bit to close together)
  • Matthieu D. Lavigne added an answer:
    How to prove functional activity of the TF-binding site within an intron identified via ChIP-Seq?
    We´ve got data strongly indicating that TF regulates the gene of interest via direct binding within an intron and not in the promoter region. How can I prove the functional activity of such a region? Do the luciferase reporter constructs, containing only intron region upstream of luciferase, make sense? Thank you in advance for the feedback!
    Matthieu D. Lavigne · Biomedical Sciences Research Center Alexander Fleming
    Hi, I haven't read all answers but I'll give you my opinion before trying wet stuffs: you may want to try to find Gene Expression profiling data for your TF KD in this or a similar cell line or tissue (ENCODE or GEO datasets) and check if your target gene's expression is affected. That would be a good indication that if your TF binding is limited by lack of proteins the functional output is deregulated. Good luck!
  • Ian Teo added an answer:
    How can I purify PCR fragments less than 70 bp?
    How can I purify a PCR product that is smaller than 70 bp? I typically use a Qiagen gel purification prep to purify PCR; however, the manual states that fragments of that size are removed rather than purified. So, how do I get my fragment out?
    Ian Teo · Imperial College London
    try exosap if the PCR product is free of non-target products
    http://www.nucleics.com/DNA_sequencing_support/exonucleaseI-SAP-PCR-protocol.html
    Ian
  • Rakesh Sinha added an answer:
    Clone is not expressing in E.coli cells
    My pET28 clone containing 3 flag-Avitag and TNF alpha fusion protein is not expressing in E.coli Bl21 (DE3) cells. Sequencing results of the clone showed that all the sequences are in frame.
    Rakesh Sinha · Agriculture and Agri-Food Canada
    I am using the strain which have tRNA plasmid, in pet 53 but still I am not getting protein......
    can you suggest.......
  • Jeannette Marrero added an answer:
    What is the best percentage of glycerol stock preparation for transformed culture recommended for the long term storage?
    What is the best percentage of glycerol stock preparation for transformed culture is recommended for the long term storage? How long will cultures be efficiency maintained?
    Jeannette Marrero · University of Havana
    I agree with all of them using glycerol concentration around 10% with 0.1 M CaCl2 is suitable for preservation of most of bacterial cultures. In this way, the culture could even last for at least 5 years at -80C.
  • Dmitry S Karpov added an answer:
    What do you do if you have troubles with cloning into a plasmid vector?
    My colleagues and I have an experience of successful cloning into various plasmid vectors. We noticed that it is hard to clone some inserts into one vectors, while the same inserts can be readily cloned into other vectors. In our hands, one of these hard-to-clone vectors is pEGFP-N1. With various cloning strategies my colleagues and I obtain a very few colonies, which often do not contain the vector with the insert. The same inserts can be easily cloned in other vectors. What can be wrong with pEGFP-N1? Did you have the same problems with some vectors? Did you solve similar problems?
    Dmitry S Karpov · Институт молекулярной биологии им. В.А. Энгельгардта Российской академии наук
    So, our problem was that we do not outgrow transformed cells. About 30-45 minutes of growth on SOC medium is enough to obtain large quantity of colonies.
  • Vishal Srivastava added an answer:
    Why do I see no amplification in PCR?
    I have done a gradient PCR (55-70 degree) using Forward primer GAATTCCATATGCAATCTACTAAAAAGGCA and reverse primer TATCTCGAGTTACACGATAAAGTCCGTGGC using .4um of primer concentration and 17 ng of template DNA for amplification of my 1.5 kb gene product. It successfully amplified but due to some mistakes I had to change my primers and when I used new primer sets forward (ACAAACTACCATATGCAATCTACTAAAAAGGCA) and reverse (TATAAGCTCGAGTTACACGATAAAGTCCGTGGC) with the same genomic DNA I am not getting any amplification at various temperature.
    The image of previous primers are as below showing amplification at 57.9 and 55 degree. However I am not able to upload image for agarose gel electrophoresis for new one.
    Vishal Srivastava · Indian Institute of Technology Delhi
    @artur Sir, Its a protein from Prokaryotic organism and the polyA track is in the open reading frame of gene to code specific amino acids. I dont want to remove the restriction sites and off course these primers are really crapy but i dont have any other option. The modification possible is only to change restriction sites or 5 prime overhang sequence. However i solved this problem, primers were ok the problem was the Genomic DNA concentration, which by mistake i added too more than required. Thanks for everyone paying attention and giving ideas, i learned a lot which surely help me in my future projects.
  • Raymond Fernalld added an answer:
    Does anybody have a problem cloning with Invitrogen's "GeneArt® Seamless Cloning and Assembly Enzyme Mix"?
    I am posting this question just to see if there are other people who are not satisfied with this kit. With Geneart we are constantly getting negative results. With Clontech's In-Fusion Advantage or In-fusion HD kits we never had a problem.
    Raymond Fernalld · SoyMeds
    We tried using the High Order Assembly Kit from Invitrogen/Life Technologies, to no avail. We wound up having Life Tech make the construct we wanted. Seamless Cloning is really just a Gibson reaction; there are others who make Gibson enzyme mixes that may work better, or you can make your own mix, as there are formulations for it online.
  • Michele Cloete added an answer:
    Why is cloning required before sequencing?
    I am working on barcoding of zoanthids. And I want to do sequencing of COI and ITS-rDNA. I have amplified both the genes. Now what should be the next step to get sequence of both the genes?
    Michele Cloete · Agricultural Research Council, South Africa
    Cloning also ensure that you have a cloned copy of the gene available to use in PCR. We actually sequence our PCR products directly if it targeted gene sequences i.e. ITS, RPB2. But I will still clone one of the amplicons for future use in PCR tests.
  • Joanne Kamens added an answer:
    Can you answer my questions on my plasmid (pCEP4) cloning process?
    I have a plasmid DNA with pCEP4 as backbone. The plasmid is 17kb in size. I transformed JM109 and achieved a very high c.f.u., and could successfully pick and inoculate single colonies for 16 hours for miniprep. I then used miniprep to extract 4.0mL of bacterial suspension. Gel electrophoresis showed that most of the plasmid DNA extracts are correct in size. All reagents and competent bacteria are freshly prepared. However I have some problems: 1. Despite of correct plasmid size, the yield was extremely low (<1ug) per miniprep. I have done everything to maximize yield already (e.g. damp filter with binding buffer beforehand; warm elution buffer). Any potential problems beside a bad kit? 2. Is DH5a a better alternative than JM109 in this case (pCEP4 plasmid)? Are there any precaution when using DH5a different than using JM109? 3. The 260/280 ratio of my yield varied between 1.6~2.2. Is it acceptable to have 1.8~2.0 ratio? Given using the same miniprep and procedures, would DH5a generally give higher purity? 4. I have read a profile of a similar pCEP4-backbone plasmid construct: http://www.addgene.org/20926/ It said the plasmid has '"Extremely" low copy number'. I wonder if pCEP4 plasmid itself has very low copy number, or was it because of the transgene that reduced its copy number in bacteria? 5. Can the solutions (if any) above also be applicable to pEP4-backbone plasmid constructs (~15kb)? Thank you very much.
    Joanne Kamens · Addgene
    Try the backbone selector database to see if you can get the features you need http://www.addgene.org/empty_backbones/
  • Rothangmawi Victoria Hmar added an answer:
    Which one is better for genome integration, single crossover or double crossover?
    Two integration methods are widely used: single and double crossover. Before I chose which one to use, I want to make sure the advantages and disadvantages of them.
    Rothangmawi Victoria Hmar · Indian Institute of Technology Madras
    A double crossover is better than single. In case of single crossover there is a chance of the multiple copies of the integrated genes, it might revert back to wild type. Double cross over are more stable, also the vector back bone can be removed and you can get only the desired gene integrated without the rest of the vector body.
    Vectors are available to ensure that single and double integration occur in cells. There are markers on the plasmid which enable the selection
    you can check out this paper , the vector is used for Lactococcous integration.

    http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2519346/

    I hope it will help
  • Petre Ianakiev added an answer:
    Does Qiagen's buffer AE inhibit qPCR reactions?
    I quantitatively analyze various bacterial 16s rDNAs from DNA samples prepped with a Qiagen kit. I have been using Qiagen's buffer AE, which contains 0.5 mM EDTA.

    Has anyone tested for the inhibitory affects of using DNA eluted with buffer AE on qPCRs (assuming the polymerase needs some metal(s) to work properly)?

    I typically use 4 uL of DNA eluted with buffer AE in a 20 uL qPCR reaction (SYBR). So, is 0.1mM EDTA inhibitory?
    Petre Ianakiev · Beckman Coulter Inc.
    No, 0.01mM EDTA is not enough to cause significant inhibition. You have 2.5 mM Mg ions ( or more) in the QPCR mix. If you have inhibition you will notice that in the serial dilutions of your standard. (slope)
  • Mustafa A Adhab added an answer:
    What is the best way to clone an 8000 bp insert into a 4000 bp vector?
    I have experienced some difficulty in cloning one of my inserts. I could get this insert into 2000 bp vector, but I've tried several times to get it into 4000 bp vector, for different experiment reasons, and it did not work. Does anybody have an explanation for that or have experienced the same problem?
    By the way, I am using T4 DNA Ligase for ligation.
    Mustafa A Adhab · University of Missouri
    Thanks Louise Elizabeth Bird
  • Karuppaiya Vimala added an answer:
    How to accurately identify cancer tissue origin with MicroRNAs?
    In this article fig. 1. The Author has made a decision tree with 24 nodes. Each node is specified for a specific cancer tissue of origin and the couple of MicroRNA which can identify these cancer tissues of origin. My question is, if I isolate miRNAs at the node14(hsa-miR-21, let-7e), node21(hsa-miR-205, 152), node24 (hsa-miR182, 34a, 148), node10(hsa-miR-194, 382, 210), will it be enough to identify cancerous tissue originated from the lung.
    Why am I asking this question, because, I want to identify cancerous tissue, which has migrated to different region but originated in the lung. So if I take miRNAs from those specified nodes, will it be enough to identify lung cancer tissue, which has migrated to different region but originated in the lung.
    Karuppaiya Vimala · Bharathiar University
    Hi
    i think the specific receptor or noncoding (Specificity) of tumour site using RT-PCR
  • Kaushal Kumar Bhati added an answer:
    How can I know whether I have already cloned the full-length cDNA including both 5' UTR and 3' UTR?
    I have recently been doing RACE PCR of a gene using Clontech Smarter RACE kit. After 5'race and 3'race PCR, I have got a single band for each PCR to get sequenced. In all, I got the full CDS region and part of the 5' UTR and 3' UTR. As the genome of the species is unknown, how I can judge whether the 5' UTR and 3' UTR are fully cloned?
    Is there any feature for the two regions?
    Kaushal Kumar Bhati · National Agri-Food Biotechnology Institute
    Hey Hii.....
    I used same kit for no. of genes from wheat, every time in case of 3' race i got poly A sequence (a feature of 3' end) and multiple ATG with gap of few stretches at 5' end like ATGGGAATG. further you can translate these seq. from both ends or try ORF finder at NCBI. use these translated seq. as query in BLASTp you will surely get clue by similarity scores from closely related hits.

    Bests
  • Sandeepa Dey added an answer:
    How can cloning a PCR product help me avoid getting multiple bands when using gel electrophoresis?
    I am persistently left with at least two bands when running my PCR product on an agarose gel. I was going to excise, elute and sequence these bands separately, but have since been told to clone them as this does not require much DNA and gives good sequencing data.
    What is it I would clone and how could this help my problem?
    Sandeepa Dey · The Scripps Research Institute
    You could consider purifying both the bands separately from the gel. Use a tiny bit for cloning (for instance using TOPO cloning kit) and use some of the rest for sequencing. That way, even if the sequencing fails, you will still have the cloned products as back up. If the sequence of the target is known consider using a nested primer for sequencing.
  • Manoj Balakrishna Menon added an answer:
    Could anyone recommend some methods (e.g. staining) for testing if cultured MEF cells are indeed MEF cells?
    I have been culturing MEF cells and tried to use different transfection methods to transfect them and they show very low efficiency and we would like to make sure that they are indeed MEFs so that I can rule out this doubt and focus only on the transfection issue.....Thank you!!!
    Manoj Balakrishna Menon · Hannover Medical School
    Every MEF line differ in the transfectability (even from the same mouse line). Our mefs are very hard to transfect and now we have shifted to retroviral vectors. So I dont think based on this problem, u can doubt ur cell line. If they have fibroblast morphology, with high F-actin and vimentin, they should be fibroblasts.

    In my opinion, if you prepare primary mefs (or even immortalize them), its very rare that anythiing else will grow better and overpopulate your culture.
    Good Luck with transfection standardization as Aalam suggested above
  • Christopher O'Kane added an answer:
    Does EDTA get precipitated with DNA during ethanol precipitation?
    My sample contains 20mM EDTA. Further assay steps involves restriction analysis of DNA for which I need to remove EDTA. I tried ethanol ppt, however restriction analysis is still not working. I doubt, EDTA is getting precipitated with DNA. If so, how do you remove EDTA without using kits and columns?
    Christopher O'Kane · University of Ulster
    You might concider increasing the mg2+ concentration. Many enzymes require magnesium to function. The EDTA then chelates the magnesium to stop enzymatic activity which is why is works as a stop reagent. By adding an excess of magnesium, (At least half the concentration of residual EDTA more than required for restriction enzyme activity), there should be sufficient mg ions for the enzyme to work.
  • Eslam Samir Ragab added an answer:
    Can anyone help troubleshoot why I got unexpected results from my clone?
    I was trying to make a full-length clone of a circular double-stranded DNA virus genome. The genome is 7,753bp in length. A Rolling Circle Amplification (RCA) was applied with a commercial RCA kit (with a virus-specific primer). After RCA, I chose several restriction enzymes to digest the DNA product, however, none of the enzymes gave an expected band. For example, EcoRI is supposed to have no digestion site therefore should have a smear in the lane after digestion, but there were two bands (~1,800bp and ~2,000bp) showing. A geI is supposed to cut only once therefore it should generate a full-length band with 7,753bp in length, however, the fact was that the only band showing was about 2,000bp. All bands we saw were unexplainable​.

    I'm wondering if anybody has faced the same problem and/or if you have a solution for that.

    Appreciate your collaboration in advance.
    Eslam Samir Ragab · Cairo University
    If possible, you can sequence one of the 2 bands then you can use bioinformatics & run (blastn) using NCBI database
    N.B : try search only in Viruses DNA then try excluding Viruses

    identify your origin of your band cutted unexpectedly by EcoRI
  • Uday Mohanta added an answer:
    Purification of small DNA fragment from agarose gel?
    I am trying to isolate a 120 bp DNA fragment from a 1% agarose gel. Every attempt to do this by using a DNA purification KIT failed, because the DNA fragment is too small to bind to the column. Now I would like to try to precipitate the DNA by sodium acide. However, I am still struggling how to isolate the DNA from the agarose gel before precipitation. Any ideas?
    Uday Mohanta · Sher-e-Bangla Agricultural University
    You may try with Nucleospin gel & PCR clean up kit. Hope it will work.
  • Aleksandar Kojic added an answer:
    Cloning a large insert (>4kb) into lentivirus vector pLVX?
    I have been trying to clone a gene of slightly more than 4kb into pLVX vector using single blunt and sticky end ligation (PmaI/XbaI site on gene, SmaI/XbaI site on the vector).
    I did ligation using T4 DNA ligase at 16C overnight, at various ratios (1:3, 1:4, 1:5, 1:6, 1:10) with 50ng vector in 20ul reaction.
    Then I transform 100ul of competent Stbl3 cells using 10ul of the ligation mix as follow:
    ->put on ice 30mins after mix
    -> heat shock 60 secs
    -> put on ice 2min
    -> added 300ul LB (w/o Amp) and recover at 37C for 1-2 hours
    -> spin down cells at 4000rpm for 5 min
    -> resuspend cells and spread on plate
    My positive control plate with uncut vector (100ng, about 9kb) usually yield just around a hundred colonies and most of the time I get 0 colonies on the experimental plates.
    I have been stuck at this for months. Not sure if it's problem with transformation or cell competency. I've tried making fresh competent cells and did get over few hundred colonies, but no colonies mostly for other plates. Except for once I get a single colony but that doesn't seems to contain my gene. Not sure whether the vector+ insert is too large (nearly 13kb) to be cloned? Any suggestions or advice?
    Aleksandar Kojic · Centro Nacional de Investigaciones Oncológicas
    Guys, I think I have a similar problem or maybe a bit ´bigger´ since the insert I am trying to clone is 8.4kb and the vector is pLVX-PURO which is 8.1kb. My protocol is similar to Chai´s except that my heatshock is between 30-40 sec. My insert came with another vector and it was excised with Xma1 and purified from gel. That goes for my destination vector too. Digested with Xma1, treated with CIP and purified. I laso tried different insert/vector ratios and different bacteria (TOP10, DH5alfa and STBL3) but with no success. I was obtaining some colonies (4-11) but they were all negative, with some weird band sizes. Any ideas?
  • Closed account added an answer:
    What is the best protocol for microRNA enrichment in RNA extraction using Trizol?
    Thanks in advance.
    Deleted · Slovak Academy of Sciences
    So you should use the classic Trizol protocol, or miRNeasy mini kit..
    http://tools.lifetechnologies.com/content/sfs/manuals/trizol_reagent.pdf
    http://jgi.doe.gov/wp-content/uploads/2014/02/Qiagen_miRNeasy_Mini_Handbook.pdf
    If you have any question regarding the protocol, feel free to ask..
  • Heinz-Georg Jahnke asked a question:
    Can anyone help me in my search for an Adenoviral Vector?
    We have the pAd vector system from Life Technologies. Unfortunately, we only have the pAd backbone with integrated CMV-promoter. I'm searching now for the pAd-promoterless backbone. Life Technologies can't provide the vector at the moment. So does anyone else have the vector and could provide it for research purposes?
  • Nageena Zahid added an answer:
    Does anyone knows about expressing two proteins in bacterial periplasm under one promoter and one signal peptide in one vector?
    I have a plasmid with a strong promoter and a gene with a signal peptide. It works perfectly so far for expression. Now I want to clone one more gene in the same plasmid under the same promoter control and I also need expression of a new gene in periplasm. Should I also include the signal peptide with the new gene? Will it work under the same promoter in the presence of another gene? Should I include a new RBS site also?
    Thank you for your suggestions
  • David Farringdon Spencer added an answer:
    How are we able to see DNA (extracted from whole blood) in agarose gel electrophoresis when human genomic DNA size is in billions of bps?
    When we extract DNA from whole blood, is it the whole DNA that is precipitated or is it a fragment of DNA? If it's a fragment of DNA then how can I be sure that it contains the gene that I want to study? Or if it's complete DNA then how does it run in agarose gel when agarose has the capacity to run only the molecules of a few thousand?
  • Siddharth Anand added an answer:
    Can anyone explain the procedure for single primer SDM from a plasmid template?
    Does anyone out there have experience with SDM using a single large primer to carry out multiple substitutions in a single run? If so can you please provide some insights into the procedure?
    Siddharth Anand · Advanced Centre for Treatment, Research and Education in Cancer
    Thanks guys

About Molecular Cloning

A platform to ask questions and discuss the procedures involved in Molecular Cloning.

Topic Followers (29971) See all