Genetic and Genomic analysis, DNA sequence determination, whole genome projects and decoding.

• Johnny Loke

  I am looking to isolate gDNA and protein from tissues, any pointers?

  QIagen or old school trizol?

  Recent replies ⋅ Show All (2)

  • 
    Johnny Loke replied

    HI Mara, I actually have small amount of sample, hence it has to be concurrent isolation. Thanks for your comment though.

    Apr 27, 2012

• Post protected

  Join ResearchGate now to read this post.

  Recent replies ⋅ Show All (3)

  • 

    Comment protected

    Join ResearchGate now to read this comment.
• Vishal A Mevada

  What is Scaffold N50 in Genome sequencing techniques?

  Could anybody explain the importance and application of scaffold N50 and other related terminologies in Next Generation Sequencing?

  Recent replies ⋅ Show All (4)

  • 
    Neha Sanghi replied

    Vishal, There are many software/tools for doing reference based genome assembly. Probably it depends on the platform you are using for sequencing. If you are using SOLiD , then you can use bioscopeVishal, There are many software/tools for doing reference based genome assembly. Probably it depends on the platform you are using for sequencing. If you are using SOLiD , then you can use bioscope or lifescope which comes with the SOLiD software itself. there are many others too like tophat, bowtie cufflink and may more. you have to choose depending on the platform. Hope it helps Neha

    Apr 20, 2012
• Marianna Limas

  Intellectual Property and Emerging Technologies: The New Biology This unique and comprehensive collection investigates the challenges posed to intellectual property by recent paradigm shifts inIntellectual Property and Emerging Technologies: The New Biology This unique and comprehensive collection investigates the challenges posed to intellectual property by recent paradigm shifts in biology. It explores the legal ramifications of emerging technologies, such as genomics, synthetic biology, stem cell research, nanotechnology, and biodiscovery. Extensive contributions examine recent controversial court decisions in patent law such as Bilski v. Kappos, and the litigation over Myriad's patents in respect of BRCA1 and BRCA2 while other papers explore sui generis fields, such as access to genetic resources, plant breeders' rights, and traditional knowledge. The collection considers the potential and the risks of the new biology for global challenges such as access to health-care, the protection of the environment and biodiversity, climate change, and food security. It also considers Big Science projects such as biobanks, the 1000 Genomes Project, and the Doomsday Vault. The inter-disciplinary research brings together the work of scholars from Australia, Canada, Europe, the UK and the US and involves not only legal analysis of case law and policy developments, but also historical, comparative, sociological, and ethical methodologies. Intellectual Property and Emerging Technologies will appeal to policy-makers, legal practitioners, business managers, inventors, scientists and researchers.

  http://books.google.ca/books?id=L4rB3EXoJxIC&printsec=frontcover&dq=Intellectual+Property+and+Emerging+Technologies:+The+New+Biology&hl=pt-BR&sa=X&ei=ae5KT9zpMIyN0QH_o4T7DQ&ved=0CDIQ6AEwAA#v=onepage&q=Intellectual%20Property%20and%20Emerging%20Technologies%3A%20The%20New%20Biology&f=false
• Leandro A sanchez

  GyrB ICB database.

  Hi !.. I´m looking for someone with experience on sequencing GyrB gene for bacterial identification. My question is regarding the gyrB database ICB. I don´t know why, I never could acces to thisHi !.. I´m looking for someone with experience on sequencing GyrB gene for bacterial identification. My question is regarding the gyrB database ICB. I don´t know why, I never could acces to this database and I dont know if doesnt longer exists. Somebody knows?. Thanxs !! Database webpage: http:/www.mbio.co.jp/icb
• Valentin Penchev

  Hello! Does anybody work about some research/screening program for FLG (Filaggrin) mutations??

  Soon I will start work for detecting and characterization of FLG mutations, responsible for ichtyosis vulgaris, atopic dermatitis and etc. For me is interesting to know how other colleagues prepareSoon I will start work for detecting and characterization of FLG mutations, responsible for ichtyosis vulgaris, atopic dermatitis and etc. For me is interesting to know how other colleagues prepare their probes, what clinical material they use and etc. I want to perform HRM or TaqMan for this study. I will be really grateull for any ideas and commentaries! Best regards and have a nice work!
• Muhammad Riaz Khan

  Rare Genetic disorders

  Hi, everybody, I am recently enrolled myself in PhD program. The research project will be on rare genetic disorders. I have not yet defined, the disorders on which my project will be based. I amHi, everybody, I am recently enrolled myself in PhD program. The research project will be on rare genetic disorders. I have not yet defined, the disorders on which my project will be based. I am reviewing the literature. Could you people help me which rare disorders are more explore-able. And disorder should be autosomal recessive. Or any useful suggestion regarding this topic?
• Amit Karole

  Do you think to understand human genome evolution will reveal the secret associated with cancer ?

  Cancer is a heterogeneous disorder that evolved from genomic instability and gene mutaion that can be revealed more by understanding evolution.
• mohammad hadi Taghipour

  the secret of human genome

  hi...give me some idea about that....... just 1% of our genome transcripted and some of them express and make protein......there are many diffrent question that has net answer yet.........come on tohi...give me some idea about that....... just 1% of our genome transcripted and some of them express and make protein......there are many diffrent question that has net answer yet.........come on to began the new window to find the answers that can help us to resolve diffrent problem and question

  Recent replies ⋅ Show All (2)

  • 
    Amit Karole replied

    yes, near about 98% of our genome is known as junk DNA these contains LINE and SINE sequenses which has either + or - role in maintaining genome. e.g in BRCA1 there are 42% of alu repeats whichyes, near about 98% of our genome is known as junk DNA these contains LINE and SINE sequenses which has either + or - role in maintaining genome. e.g in BRCA1 there are 42% of alu repeats which belongs to SINE , which make it vulnerable for recombination. if we look at total number of alu seuqeses added from primates to human ,number gose on incresing that means addition of alu sequenses played an important role in human evolution and can be used as importent marker.

    Dec 12, 2011
• Alireza Kargardolatababi

  Why person that have lecsh-nyhann syndrome, have mental retardation?

  Why person that have lecsh-nyhann syndrome, have mental retardation? What effect on the brain by extra ureac acid or other metabolit?
• Rolando Milian

  new guide on Genomics

  Dear colleagues, I have created this new guide on Genomics and would greatly appreciate it your feedback, comments, etc. Am I missing some important tool, resource, databse, that you consider needsDear colleagues, I have created this new guide on Genomics and would greatly appreciate it your feedback, comments, etc. Am I missing some important tool, resource, databse, that you consider needs to be included? http://guides.uflib.ufl.edu/Genomics Many Thanks!!!
• Karthika Gopakumar

  paragenomics

  can anyone help me to know about paragenomics?

  Recent replies ⋅ Show All (8)

  • 
    Graeme Smith replied

    Another side to this research, is that if the theory is correct, you should be able to recreate from the phylogenic memory, all the development stages of a cell. thus developing a replacement cellAnother side to this research, is that if the theory is correct, you should be able to recreate from the phylogenic memory, all the development stages of a cell. thus developing a replacement cell for even the most transigent cells, like neurons. The problem being reintegration of the replacement cell once it is fully developed. Alternately, you might be able to redesign the cell, so that it can navigate an adult body despite the fact that morphogenesis in the childs body was simpler because the brain was smaller then.

    Sep 21, 2011
• Rolando Milian

  Database of genetic information by ethnic groups?

  Dear colleagues, I am looking for genetic studies on Pashtun tribes. While I can look in the published literature, I am wondering if there is a database of genetic information by ethnic groups thatDear colleagues, I am looking for genetic studies on Pashtun tribes. While I can look in the published literature, I am wondering if there is a database of genetic information by ethnic groups that includes Pashtun. Thanks, Rolando

  Recent replies ⋅ Show All (1)

  • 
    Santosh H. S. Kumar replied

    as for as I know... there are no such database to give genomic data by ethnicity.. how ever.. there are such excersice going on at avasthagen ltd.. bangalore.. you can ask them.. may be they can beas for as I know... there are no such database to give genomic data by ethnicity.. how ever.. there are such excersice going on at avasthagen ltd.. bangalore.. you can ask them.. may be they can be of some help

    Sep 21, 2011
• Dhanasekaran Rathinam

  Comparitive genomics

  Hi everyone...generally by comparitive genomics, we can determine the evolutionary relationship between the organisms or we can hypothesis one organism may be from this or that...for exampleHi everyone...generally by comparitive genomics, we can determine the evolutionary relationship between the organisms or we can hypothesis one organism may be from this or that...for example chimpenzees genome have 98% similarity to human, so it is hypothesised that humans are from chimpenzees due to environmental changes, but why chimpenzee still being as chimpenzee, why not it become a human? Is really humans are from chimpenzee or something else?...

  Recent replies ⋅ Show All (1)

  • 
    Santosh H. S. Kumar replied

    The humans need to live in a constrained envt.. They have to maintain girl friend/wife/parents/kids/property... So much head ache naa... So they decided not become human again... They passed aThe humans need to live in a constrained envt.. They have to maintain girl friend/wife/parents/kids/property... So much head ache naa... So they decided not become human again... They passed a resolution not to repeat the mistake they did million years ago

    Sep 21, 2011
• Hassan Hachim

  Best PCR thermocycler conditions

  Hi every body, i have to tried to design a groups of primers to my work about detection of some genes in bacterium (brucella spp.) i used primer3 oline software to design of my... Show moreHi everyHi every body, i have to tried to design a groups of primers to my work about detection of some genes in bacterium (brucella spp.) i used primer3 oline software to design of my... Show moreHi every body, i have to tried to design a groups of primers to my work about detection of some genes in bacterium (brucella spp.) i used primer3 oline software to design of my primers, list of my primers with their products: Primer Sequence (5’- 3’) Product size CBG F GAATTCGCCAATGAGGAAAA 575bp R ACGATATCGGATGCGAAAAG mviN F GCAGATCAACCTGCTCATCA 344bp R GGCCATAGATCGCCAGAATA manA F TCGATCCAGAAACCCAGTTC 271bp R CATACACCACGATCCACTGC manB F GGCTGGTTCGAGAATATCCA 228bp R CAATCGCATACCCTGGTCTT wbkA F GAGCGCTTAGGAATGCTGAT 309bp R CTCCTAGGTTCCAGCCCTTT omp25 F CGTACCTCACGGCTGGTATT 188bp R CGTACCGGCCAGATCATAGT omp31 F GCTGCTCCTGTTGACACCTT 257bp R GCTGAAATCGAACCCGTAAC znuA F CTGGGTCCGAGCATGTTTAT 465bp R AGGCATCGAGTTTTTCTCCA my question: 1- can i use all these primers in as multiples in one pcr reaction but i have only standrd 2X pcr master mix (promega).....12.5ul per one reaction? 2- are you know what is the best pcr thermocycler condition per all primers or per each primer? 3- can i use multiplex pcr by use two primers only? 4- what is the type of pcr thermocycler can be used in this reaction....normal or gradient pcr???

  Recent replies ⋅ Show All (2)

  • 
    Santosh H. S. Kumar replied

    Boss no matter which softy u use, the primers supplied to you need to be optimised for concentration, Mg2+ concentration and annealing temp. If you are going for cloning you better select the primerBoss no matter which softy u use, the primers supplied to you need to be optimised for concentration, Mg2+ concentration and annealing temp. If you are going for cloning you better select the primer that give you amplicon of more length.. If it is for diagnostic purpose you better go for primers of 200bp amplicon. Yes you can do multiplex using the combination... but then you need to optimise the primer.. anf you better go for touchdown assymetric PCR

    Sep 21, 2011