Sang-Gu Kang

Yeungnam University, Onyang, South Chungcheong, South Korea

Are you Sang-Gu Kang?

Claim your profile

Publications (10)14.58 Total impact

  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: An apple polygalacturonase-inhibiting protein (PGIP), that specifically inhibited endopolygalacturonase (PG, EC 3.2.1.15) from Botryosphaeria dothidea, was purified from B. dothidea infected apple (Malus domestica cv. Fuji) fruits. The apple PGIP was a mixed-type inhibitor of PG from B. dothidea. Optimal temperature for the maximum enzyme activity was , and optimum pH of the purified PGIP was pH 5.0. PGIP was stable up to temperature of and was completely suppressed after heating at for 10 min, PGIP was stable at pH between 4 and 8. Inhibition of PG by PGIP was reduced by , , , and metal ion, sodium dodecyl sulfate (SDS) and 1,2-diaminocyclohexane tetra acetate (CDTA).
    Journal of Life Science. 01/2006; 16(4).
  • Sang-Gu Kang, Hye Kyeong Jeong, Hak Soo Suh
    [Show abstract] [Hide abstract]
    ABSTRACT: A cDNA encoding an Oryza sativa glutathione peroxidase, OsGPX1, was isolated and characterized. OsGPX1 encodes a protein of 168 amino acids with a predicted molecular mass of approximately 18.5 kDa. The protein has 92% identity to a GPX of Zea mays, but only 65% identity to rice PHGPX. The deduced amino acid sequence of OsGPX1 contains two GPX active site domains and one WNF(S/T)KF domain. There is no plastid transit peptide sequence, suggesting that OSGPX1 may function in the cytoplasm. OsGPX1 is located slightly over 85.5 cM from the end of the short-arm of chromosome 4. The OsGPX1 transcripts were abundant only in the leaves of mature plants, and were barely detectable in the leaves of seedlings. However, the transcription of OsGPX1 gene was induced in the seedlings within an hour of exposure to salt stress and was also gradually increased by cold and drought stress. These results indicate that OsGPX1 is a stress-inducible gene of the rice glutathione peroxidase family that protects cells against both metabolic and environmental oxidative stresses.
    Molecules and Cells 03/2004; 17(1):23-8. · 2.21 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Viral infections of twenty six accessions of Korean native bottle gourd (Lagenaria siceraria) plants were investigated. Cucumber mosaic cucumovirus (CMV), zucchini yellow mosaic virus (ZYMV), and cucumber green mottle mosaic virus (CGMMV) were identified in the native bottle gourd plants. All examined plants were grouped into four different types of viral symptoms on the leaves. ‘Buan’ showed no visible symptom. Eighteen gourdes including ‘Andong’ showed typical yellow mosaic spots on the leaves. ‘Ulreung 1’ showed progressive wilting and severe leaf distortion. Twelve gourdes including ‘Habcheon’ showed yellow mosaic and bleaching on the leaves. Four native plant genotypes, ‘Buan’, ‘Andong’, ‘Ulreung 1’, and ‘Habcheon’, were selected to identify and to associate viruses with the typical symptoms. Antiserum against to CMV reacted positively to proteins isolated from all the selected plants. Antiserum against to CGMMV reacted positively to proteins isolated from ‘Andong’, and ‘Ulreung 1’. Antiserum against to ZYMV reacted positively to proteins isolated leaves from ‘Ulreung 1’, and ‘Habcheon’. Leaf cells of ‘Ulreung 1’ and ‘Habcheon’ showed typical potyvirus inclusions of pinwheels, scrolls and cylindrical inclusions, indicating that ZYMV was common in gourds. Mixed infection of CMV, CGMMV, and ZYMV caused extremely severe symptoms such as wilting and leaf distortion of ‘Ulreung 1’. Although ‘Buan’ showed no symptom, antiserum against CMV reacted positively on the immunblot analysis. This result suggested that ‘Buan’ might be a tolerant genotype against to plant viruses.
    Wonye kwahak kisulchi = Korean journal of horticultural science and technology / 01/2004; 22(1). · 0.33 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: The POTM1-1 gene is abundantly expressed in both vegetative and reproductive organs of potato. We performed in situ hybridization and RNA blotting analysis to investigate the patterns of POTM1-1 gene expression in the flower development and the early tuber development. In the early flowers, POTM1-1 transcripts were accumulated abundantly in the developing reproductive organs, including the placentae of carpels and the pollen sacs of stamens. In contrast, the pattern of POTM1-1 distribution during late flower development was different from that of the early flower development. The POTM1-1 transcripts were abundant in the sepals and petals of late flowers, but were minimally expressed in the stamens and carpel. In the shoot apical meristem of the vegetative organs, transcripts were distributed throughout meristem domes, young leaves, and developing vascular cambium. In the early tuberization, the transcripts were widely distributed in the swollen tips of the stolons. Taken together, the results suggest that POTM1-1 gene expression is temporally and spatially regulated in active growing tissues of both vegetative and floral organs with specific distribution patterns dependent upon the developmental stages of the tissue.
    Molecules and Cells 03/2003; 15(1):48-54. · 2.21 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: A beta-galactosidase (EC 3.2.1.23) from peach (Prunus persica cv Mibackdo) was purified and characterized. The purified peach beta-galactosidase was 42 kDa in molecular mass and showed high enzyme activity against a the beta-galactosidase substrate, rho-nitrophenyl-beta-D-galactopyranoside. The Km and Vmax values of the enzyme activity of the peach beta-galactosidase were 5.16 and 0.19 mM for rho-nitrophenyl-beta-D-galactopyranoside mM/h, respectively. The optimum pH of the enzyme activity was pH 3.0, but it was relatively stable from pH 3.0-10.0. The temperature optimum was 50 degrees C. The enzyme activities were not improved in the buffers that contained Ca2+, Cu2+, Zn2+, and Mg2+, which indicates that the purified peach beta-galactosidase did not require these cations as co-factors. However, the enzyme was completely inhibited by Hg2+. The purified protein was cross-reacted with an antibody against the persimmon fruit beta-galactosidase. A further comparison of the N-terminal amino acid sequence of the purified protein showed high homologies to those of beta-galactosidase in apple (87%), persimmon (80%), and tomato (87%). Therefore, enzymatic, immunological, and molecular evidences in this study indicate that the purified 42-kDa protein is a peach beta-galactosidase.
    Molecules and Cells 03/2003; 15(1):68-74. · 2.21 Impact Factor
  • Sang-Gu Kang, Eric Henderson
    [Show abstract] [Hide abstract]
    ABSTRACT: G4-DNA binding proteins of E. coli, Saccharomyces cerevisiae, Arabidopsis, and human have been identified by a synthetic non-telomeric G4-DNA oligo 5'-d(ACTGTCGTACTTGATATGGGGGT)-3' using gel mobility shift assays. G4-DNA binding proteins are specific to G4-DNA, a four-stranded guanine-DNA structure. Bound complexes of G4-DNA and proteins were identified in nuclear extracts of all examined organisms in this study. In humans, three different G4-DNA and protein complexes were identified. However, human telomeric G-quadruplex oligo did not compete with G4-DNA oligo in the competition assays, suggesting that the identified G4-DNA binding proteins may be different from the known human telomeric G4-DNA binding proteins. We discovered two complexes of G4-DNA and protein in Arabidopsis identified in mobility shift assays. Interestingly, two complexes of G4-DNA and proteins were identified from E. coli, which have a circular genomic DNA structure. Results of this investigation suggest that non-telomeric G4-DNA structure and its binding proteins may be involved in important functional roles in both prokaryotes and eukaryotes.
    Molecules and Cells 01/2003; 14(3):404-10. · 2.21 Impact Factor
  • Sang-Gu Kang, Jun-Hwa Choi, Sang-Gon Suh
    [Show abstract] [Hide abstract]
    ABSTRACT: The 22 kDa Kunitz-type potato proteinase inhibitor (22 kDa KPPI) was induced in tubers. However, the 27 kDa protein, which is immunologically related to the 22 kDa KPPI, was induced in leaves by wounding, hormones, and environmental stresses. The leaf-specific 27 kDa protein was induced in leaves that were treated with exogenous abscisic acid (ABA), ethephon, methyl jasmonate (MeJA), and water deficit. These results indicate that the 27 kDa protein in leaves could function as a defense protein against mechanical damages by herbivorous animals and abiotic environmental stresses that could induce plant hormones.
    Molecules and Cells 03/2002; 13(1):144-7. · 2.21 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Two cDNAs, STGA2 and STGB2, that encode heterotrimeric G protein alpha and beta subunit proteins, respectively, were cloned from an early tuber cDNA library of potato (Solanum tuberosum cv. Superior). The cDNA of STGA2 encoded 384 amino acids, which showed 75-98% identities to plant Ga-subunits; STGB2 encoded 377 amino acids, which showed 83-92% identities to plant Gbeta-subunits. The transcript levels of the two genes were abundant in leaves, shoots, axially buds, unopened flowers, and active growing sprouts. However, the transcripts were barely detectable in roots. The expressions of STGA2 and STGB2 were up-regulated by light. Interestingly, the STGA2 and STGB2 gene expression showed synchronous patterns in the examined organs. During the early tuber development, the transcripts of STGA2 and STGB2 were abundant in unswollen stolons, swollen stolons, and new tubers, but were undetected in matured tubers. This indicates that potato Galpha- and beta-subunit genes are developmentally regulated. Based on these observations, we propose that heterotrimeric G proteins may be involved in the signaling pathway during potato tuber development.
    Molecules and Cells 03/2002; 13(1):99-106. · 2.21 Impact Factor
  • Source
    Sang-Gu Kang, Hyeon Ji Lee, Sang-Gon Suh
    [Show abstract] [Hide abstract]
    ABSTRACT: The maize(Zea mays) crinkty4 (cr4) gene encodes a receptor-like kinase (RLK). Its mutants show irregularities in the epidermal cells of crinkled and severely adherent leaves, resulting in dwarf characteristics and delayed growth. We successfully grewcr4 mutants up to the reproductive stage, where we noted both pistillate and staminate spikelets in the tassels. This suggests that thecr4 gene may be involved in the sex-determination process during bisexual floral-organ development We found no remarkable abnormalities in the roots. Northern-blot analysis showed thatcr4 gene transcripts were abundant in the leaves, weak in the stems, tassels, and ears, and hardly measurable in the roots. Likewise, transcripts were not detected in the leaves of dark-grown seedlings, but were greatly induced after 24 h of light exposure, indicating that expression of thecr4 gene is regulated by light However, transcripts were not inducible in the roots of seedlings either when grown in the dark or following exposure to light treatment, which suggests that this gene is expressed only in aerial-specific organs.
    Journal of Plant Biology 01/2002; 45(4):219-224. · 0.99 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: An apple polygalacturonase-inhibiting protein (PGIP), which specifically inhibits endopolygalacturonase (PG, EC 3.2.1.15) from Botryosphaeria dothidea, was purified from Botryosphaeria dothidea-infected apple (Malus domestica cv. Fuji) fruits. The purified apple PGIP had a molecular mass of 40 kDa. The N-terminal amino acid sequence of the purified protein showed high homologies to those of PGIP from pear (100%), tomato (70%), and bean (65%). We also purified polygalacturonase (PG) from B. dothidea. The PG hydrolyzes pectic components of plant cell walls. When the extracted apple pectic cell wall material was treated with purified apple PGIP and B. dothidea PG, the amount of uronic acid released was lower than that treated with B. dothidea PG alone. This result demonstrates that PGIP functions specifically by inhibiting cell wall maceration of B. dothidea PG Furthermore, we characterized the de novo function of the PGIP against PG on the solubilization and depolymerization of polyuronides from cell wall of apple fruits inoculated with B. dothidea. This result demonstrated that the PGIP of plants exhibits one of the direct defense mechanisms against pathogen attack by inhibiting PGs that are released from pathogens for hydrolysis of cell wall components of plants.