T Huynh-Dinh

Institut Pasteur, Lutetia Parisorum, Île-de-France, France

Are you T Huynh-Dinh?

Claim your profile

Publications (119)438.17 Total impact

  • [Show abstract] [Hide abstract]
    ABSTRACT: A general method for the assignment of DNA fragment proton resonances, especially for the sugar protons, has been presented and used to interpret the 400 MHz proton spectra of dApTpGpT and dApCpApTpGpT in neutral aqueous solution. Only fine splittings of about 3 Hz are observed in the H-2″ resonances, and the total splitting is larger for the H-2′ (≈29 Hz) than for the H-2″ (22–23 Hz) multiplets. The purine and pyrimidine resonances can be distinguished on the basis of the H-2″ and H-2″ chemical shifts. The resonances of the H-2′ and H-2″ protons (above and below the sugar plane, respectively) of dA and dG exhibit chemical shifts of 2.65—2.80 ppm, while those of dC and dT residues are located at higher fields between 1.95 and 2.40 ppm. At high temperature (≥60°C), δH-2′>YδH-2″ for the purine family, while δH-2′ « δH-2″ in the case of the pyrimidine family. Except for the terminal residue, the H-3′ resonances of dA and dG are located at lower fields compared with those of the dC and dT residues. The same is true for the H-4′ resonances. In general δA1′>δG1′ and in the case of self complementary duplexes the H-1′ and H-2′ chemical shift variations versus temperature are found to be larger for the dC than for the dT residues.
    Magnetic Resonance in Chemistry 04/2005; 18(3):148 - 152. · 1.53 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Optical spectroscopic techniques such as CD, Raman scattering, and fluorescence imaging allowed us to analyze the complex formation and vectorization of a single-stranded 20-mer phosphorothioate oligodeoxynucleotide with a 15-mer amphipathic peptide at molecular and cellular levels. Different solvent mixtures (methanol and water) and molecular ratios of peptide/oligodeoxynucleotide complexes were tested in order to overcome the problems related to solubility. Optimal conditions for both spectroscopic and cellular experiments were obtained with the molecular ratio peptide/oligodeoxynucleotide equal to 21:4, corresponding to a 7:5 ratio for their respective +/- charge ratio. At the molecular level, CD and Raman spectra were consistent with a alpha-helix conformation of the peptide in water or in a methanol-water mixture. The presence of methanol increased considerably the solubility of the peptide without altering its alpha-helix conformation, as evidenced by CD and Raman spectroscopies. UV absorption melting profile of the oligodeoxynucleotide gave rise to a flat melting profile, corresponding to its random structure in solution. Raman spectra of oligodeoxynucleotide/peptide complexes could only be studied in methanol/water mixture solutions. Drastic changes observed in Raman spectra have undoubtedly shown: (a) the perturbation occurred in the peptide secondary structure, and (b) possible interaction between the lysine residues of the peptide and the oligodeoxynucleotide. At the cellular level, the complex was prepared in a mixture of 10% methanol and 90% cell medium. Cellular uptake in optimal conditions for the oligodeoxynucleotide delivery with low cytotoxicity was controlled by fluorescence imaging allowing to specifically locate the compacted oligonucleotide labeled with fluorescein at its 5'-terminus with the peptide into human glioma cells after 1 h of incubation at 37 degrees C.
    Biopolymers 05/2004; 73(6):727-34. · 2.88 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Short RNA and DNA hairpins have been analysed in aqueous phase by means of UV absorption and vibrational spectroscopy in the following oligodeoxynucleotide and oligoribonucleotide sequences: 5′-d(GC-GAA-GC)-3′, 5′-r(CGC-GNRA-GCG)-3′ (where N=U, A, C, G and R=A, G) and 5′-r(GCG-UGAA-CGC)-3′. These hairpins contain GAA triloop, GNRA and UGAA tetraloops stabilised by two or three GC base pairs in their stems. The analysis of UV absorption melting profiles allowed us to confirm the high (to very high) thermodynamic stability of these hairpins through the estimation of their melting temperature (Tm). FT-IR spectra revealed the presence of N-type and/or S-type sugar puckers in the hairpins. Raman spectra at the temperatures below Tm provided information on the conformations of certain nucleosides involved in the hairpins, as well as on the global conformation (A or B forms) of their stems. Raman spectra recorded as a function of temperature, are consistent with the hairpin-to-random coil conformational transitions through the breakdown of interbase H-bonds, and the loss of stacking between the bases. A discussion has been carried out on the agreement between vibrational data and those available from NMR on a few number of these hairpins.
    Journal of Molecular Structure 06/2003; s 651–653:67–74. · 1.40 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: We describe in this paper the preparation and characterization of semicarbazide glass slides and their use for the fabrication of microarrays using site-specific alpha-oxo semicarbazone ligation. The functional density and homogeneity of the semicarbazide glass slides were optimized by analyzing the reactivity of the layer toward a synthetic glyoxylyl fluorescent probe. Oligonucleotide microarrays were prepared by site-specific immobilization of glyoxylyl oligodeoxynucleotides. The slides were directly used in the hybridization assays using fluorescence detection and displayed a significant gain in sensibility as compared to the aldehyde glass slide/amino oligodeoxynucleotide chemistry. Semicarbazide slides were also used for the immobilization of a biotinylated peptide alpha-oxo aldehyde. The peptide microarrays allowed model interaction studies with streptavidin or an anti-biotin antibody.
    Bioconjugate Chemistry 01/2003; 14(2):430-9. · 4.58 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: The genome of all retroviruses consists of two identical copies of an RNA sequence associated in a non-covalent dimer. A region upstream from the splice donor (SL1) comprising a self-complementary sequence is responsible for the initiation of the dimerization. This region is able to dimerize in two conformations: a loop-loop complex or an extended duplex. Here, we solve by 2D NMR techniques the solution structure of a 23-nucleotide sequence corresponding to HIV-1 SL1(Lai) in which the mutation G12-->A12 is included to prevent dimerization. It is shown that this monomer adopts a stem-loop conformation with a seven base pairs stem and a nine nucleotide loop containing the G10 C11 A12 C13 G14 C15 sequence. The stem is well structured in an A-form duplex, while the loop is more flexible even though elements of structure are evident. We show that the structure adopted by the stem can be appreciably different from its relaxed structure when the adenines A8, A9 and A16 in the loop are mechanically constrained. This point could be important for the efficiency of the dimerization. This experimental study is complemented with a 10 ns molecular dynamics simulation in the presence of counterions and explicit water molecules. This simulation brings about information on the flexibility of the loop, such as a hinge motion between the stem and the loop and a labile lattice of hydrogen bonds in the loop. The bases of the nucleotides G10 to C15 were found outside of the loop during a part of the trajectory, which is certainly necessary to initiate the dimerization process of the genuine SL1(Lai) sequence.
    European Biophysics Journal 01/2003; 31(7):521-31. · 2.27 Impact Factor
  • Biochemistry 04/2002; 23(7). · 3.38 Impact Factor
  • Journal of the American Chemical Society 04/2002; 106(10). · 10.68 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: We report here an alternative double-helical structure of the DNA molecule. It has been found in the d(ATA(Br)UAT) and d(ATATAT) sequences by single-crystal x-ray crystallography. This sequence is found not only in TATA boxes, but also in other regulatory regions of DNA. Bases of the two antiparallel strands form Hoogsteen pairs, with adenines in the syn conformation. The structure is related neither to those found in triple helices nor to parallel DNA duplexes. Its conformational parameters are very similar to those of duplex DNA in the B form. Both forms may coexist under physiological conditions, although the Hoogsteen pairing greatly influences the recognition sites on DNA. Our results demonstrate that an alternative to the classical B-DNA double helix is possible.
    Proceedings of the National Academy of Sciences 04/2002; 99(5):2806-11. · 9.81 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: The deoxyoligoribonucleotide d(CTTGCTGAAGCGCGCACGGCAAG) (dSL1) corresponding to the reverse transcripted sequence of the dimerization initiation site SL1 of HIV- 1(Lai) RNA was synthesized using phosphoramidite chemistry. Like its oligoribonucleotide counterpart, dSL1 dimerized spontaneously in solution. Here we report the first NMR solution structure of a kissing complex formed with two DNA strands. The melting point of the DNA dimer (35 degrees C) was found slightly higher than the one of the corresponding RNA dimer (32 degrees C). Despite this only slight difference in melting point, several structural differences were observed between the ribo- and the deoxyribo- dimers. The solution structure of the deoxy- dimer was a symmetric homodimer with a loop-loop interaction stabilized by four central G-C base-pairs, a head to tail A-A base-pair arrangement between the A8 residues of the two strands and a stacking of A9 with C15. As a consequence, G10 was not paired and occupied a position outside the stem and the loop. Each stem was formed by seven base-pairs whose axis made an angle of about 100 degree with the plane of the loops. The distortion of the helix at the junction of the stem and of the loop induced a fold up of the A8pA9 step with a phosphate-phosphate distance lowered to 4.5 A. The plane of the non-canonical A-A base-pair was oriented perpendicularly to the axis of the stems. The four central base-pairs formed an open fan-shaped motif with an angle of 20 degrees between the bases and each of them was oriented perpendicularly to the A8-A8 plane. The deviation of the computed chemical shifts and the experimental ones for the aromatic proton was always less than 0.25ppm for each of the 16 converged solution structures and their average less than 0.1ppm.
    Journal of biomolecular Structure & Dynamics 03/2002; 19(4):649-58. · 2.98 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: An oligonucleotide was functionalized on the solid-phase by a tartaramide moiety, which could be converted efficiently in solution into a glyoxylyl group following a mild periodic oxidation. The glyoxylyl-oligonucleotide was found to be very stable upon storage and was successfully engaged in hydrazone ligation with an α-hydrazino acetyl peptide.
    Tetrahedron Letters 02/2002; 43(6):997-999. · 2.40 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: The aim of this study was to clarify whether Ni2+ ions could bind to guanine bases in a standard B-DNA duplex and eventually induce a B-->Z transition. We have determined by X-ray crystallography at 3.1 A resolution the structure of the alternating deoxynucleotide d(CGTGTACACG), which contains both internal and terminal guanines. The duplex is in the B form. It is shown that nickel ions bind selectively to the N7 atom of guanine 10, which is in an extra-helical position, and guanine 2, which is in the terminal position of the duplex. It does not bind to guanine 4, which lies within a standard B-DNA tract. This simple but unambiguous result proves that nickel ions select between different guanines via steric accessibility. Guanine-Ni2+-guanine bridges among symmetry-related duplexes have also been found. These bridges may explain why Ni2+ ions may act either as a precipitant or a renaturing agent for DNA under certain conditions. The biochemical interaction of nickel with DNA can thus be related to its capacity to specifically bind to B-DNA regions with exposed guanines. Also, from the structural point of view, we have found a terminal cytosine, which forms a C.G:C reverse-Hoogsteen triple structure with a base pair of a neighbor duplex. This type of triplet is seldom found and is here described for the first time for a DNA structure.
    JBIC Journal of Biological Inorganic Chemistry 01/2002; 7(1-2):195-9. · 3.35 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Triple helices with G*G.C and A*A.T base triplets with third GA strands either parallel or antiparallel with respect to the homologous duplex strand have been formed in presence of Na (+) or Mg(2+) counterions. Antiparallel triplexes are more stable and can be obtained even in presence of only monovalent Na(+) counterions. A biphasic melting has been observed, reflecting third strand separation around 20 degrees C followed by the duplex -> coil transition around 63 degrees C. Parallel triplexes are far less stable than the antiparallel ones. Their formation requires divalent ions and is observed at low temperature and in high concentration conditions. Different FTIR signatures of G*G.C triplets in parallel and antiparallel triple helices with GA rich third strands have been obtained allowing the identification of such base triplets in triplexes formed by nucleic acids with heterogeneous compositions. Only S-type sugars are found in the antiparallel triplex while some N-type sugar conformation is detected in the parallel triplex.
    Journal of biomolecular Structure & Dynamics 12/2001; 19(3):527-34. · 2.98 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Surface-enhanced Raman spectroscopy (SERS) with an (Ag)n+ substrate detects picomoles of adenyl residues (Ayl) in a mildly salted aqueous medium (10−2M NaCl). Chloride binding to Ayl enhances the Ayl affinity for silver. The SER spectral profile provides information on Ayl orientation. If silver plasmons are closely related, Ayl SERS intensities depend on the extent of the adsorption. This allows us to compare Ayl availability in poly(dA), d(CCA AAA ACC) and d(GCC GAC CCG), in the corresponding double strands or in the self-complementary d(CGA TCG) oligomer. Single-strand self-association constrains Ayl reactivity but less than duplex arrangements. Ayl reactivity is notably amplified in A tracts. In highly diluted poly(dA)–poly(dT) mixtures Ayl adsorption is available along flexible bulges. In the d(GCC GAC CCG).d(CGG GC GGC) duplex, where a thymidine is missing, Ayl is not more accessible than in the canonical duplex. Mg2+–nucleic acid complexation has a dual activity on the nucleic bases. At specific Mg2+ to nucleotide ratios, C6N/N7 Ayl sides are hidden in Mg2+ cross-bridged structures involving homologous or complementary strands. Alternatively, below these ratios a 1 : 1 Mg2+–phosphate interaction enhances Ayl but also thymyl and cytosyl interactions with the electron-depleted sites. Exploring salt effects and concentration dependences on nucleic base reactivity is crucial to predict elementary conditions for topological recognition in ‘living’ DNA, especially when temporarily unpaired or coiled in hairpins. Copyright © 2001 John Wiley & Sons, Ltd.
    Journal of Raman Spectroscopy 11/2001; 32(12):1037 - 1045. · 2.68 Impact Factor
  • Source
    V Baumruk, C Gouyette, T Huynh-Dinh, J S Sun, M Ghomi
    [Show abstract] [Hide abstract]
    ABSTRACT: CUUG loop is one of the most frequently occurring tetraloops in bacterial 16S rRNA. This tetraloop has a high thermodynamic stability as proved by previous UV absorption and NMR experiments. Here, we present our results concerning the thermodynamic and structural features of the 10mer 5'-r(GCG-CUUG-CGC)-3', forming a highly stable CUUG tetraloop hairpin in aqueous solution, by means of several optical techniques (UV and FT-IR absorption, Raman scattering). UV melting profile of this decamer provides a high melting temperature (60.7 degrees C). A set of Raman spectra recorded at different temperatures allowed us to analyze the order-to-disorder (hairpin-to-random coil) transition. Assignment of vibrational markers led us to confirm the particular nucleoside conformation, and to get information on the base stacking and base pairing in the hairpin structure. Moreover, comparison of the data obtained from two highly stable CUUG and UUCG tetraloops containing the same nucleotides but in a different order permitted an overall discussion of their structural features on the basis of Raman marker evidences.
    Nucleic Acids Research 11/2001; 29(19):4089-96. · 8.81 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: PMP1 is a 38-residue single-spanning membrane protein whose C-terminal cytoplasmic domain, Y25-F38, is highly positively charged. The conformational coupling between the transmembrane span and the cytoplasmic domain of PMP1 was investigated from 1H-nuclear magnetic resonance data of two synthetic fragments: F9-F38, i.e. 80% of the whole sequence, and Y25-F38, the isolated cytoplasmic domain. Highly disordered in aqueous solution, the Y25-F38 peptide adopts a well-defined conformation in the presence of dodecylphosphocholine micelles. Compared with the long PMP1 fragment, this structure exhibits both native and non-native elements. Our results make it possible to assess the influence of a hydrophobic anchor on the intrinsic conformational propensity of a cytoplasmic domain.
    FEBS Letters 10/2001; 505(3):431-5. · 3.58 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Finding the combinations of key amino acids involved in the interaction network underlying the interfacial features of membrane proteins would contribute to a better understanding of their sequence−structure−function relationships and the role of anionic phospholipids. To further address these questions, we performed mutational analysis associated with NMR experiments on synthetic fragments of the single-spanning membrane protein PMP1 that exhibit binding specificity for phosphatidylserine (PS). The aromatic and glutamine residues of the helix part of the PMP1 cytoplasmic domain were mutated. 1H NMR experiments were carried out using perdeuterated DPC micelles as a membrane-like environment, in the absence and presence of small amounts of either POPC or POPS lipids. From intermolecular NOEs and chemical shift data, specific and nonspecific aspects of peptide−phospholipid interactions were distinguished. The major finding of our study is to reveal the concerted influence of a tryptophan and a glutamine residue on the interfacial conformation and lipid binding specificity of the PMP1 cytoplasmic domain.
    Biochemistry 07/2001; 40(33). · 3.38 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: PMP1 is a 38-residue single-spanning membrane protein whose C-terminal cytoplasmic domain, Y25–F38, is highly positively charged. The conformational coupling between the transmembrane span and the cytoplasmic domain of PMP1 was investigated from 1H-nuclear magnetic resonance data of two synthetic fragments: F9–F38, i.e. 80% of the whole sequence, and Y25–F38, the isolated cytoplasmic domain. Highly disordered in aqueous solution, the Y25–F38 peptide adopts a well-defined conformation in the presence of dodecylphosphocholine micelles. Compared with the long PMP1 fragment, this structure exhibits both native and non-native elements. Our results make it possible to assess the influence of a hydrophobic anchor on the intrinsic conformational propensity of a cytoplasmic domain.
    Febs Letters - FEBS LETT. 01/2001; 505(3):431-435.
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: PMP1 is a 38-residue plasma membrane protein of the yeast Saccharomyces cerevisiae that regulates the activity of the H(+)-ATPase. The cytoplasmic domain conformation results in a specific interfacial distribution of five basic side chains, thought to strongly interact with anionic phospholipids. We have used the PMP1 18-38 fragment to carry out a deuterium nuclear magnetic resonance ((2)H-NMR) study for investigating the interactions between the PMP1 cytoplasmic domain and phosphatidylserines. For this purpose, mixed bilayers of 1-palmitoyl, 2-oleoyl-sn-glycero-3-phosphocholine (POPC) and 1-palmitoyl, 2-oleoyl-sn-glycero-3-phosphoserine (POPS) were used as model membranes (POPC/POPS 5:1, m/m). Spectra of headgroup- and chain-deuterated POPC and POPS phospholipids, POPC-d4, POPC-d31, POPS-d3, and POPS-d31, were recorded at different temperatures and for various concentrations of the PMP1 fragment. Data obtained from POPS deuterons revealed the formation of specific peptide-POPS complexes giving rise to a slow exchange between free and bound PS lipids, scarcely observed in solid-state NMR studies of lipid-peptide/protein interactions. The stoichiometry of the complex (8 POPS per peptide) was determined and its significance is discussed. The data obtained with headgroup-deuterated POPC were rationalized with a model that integrates the electrostatic perturbation induced by the cationic peptide on the negatively charged membrane interface, and a "spacer" effect due to the intercalation of POPS/PMP1f complexes between choline headgroups.
    Biophysical Journal 12/2000; 79(5):2624-31. · 3.67 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: We present evidence of formation of an intramolecular parallel triple helix with T*A.T and G*G.C base triplets (where * represents the hydrogen bonding interaction between the third strand and the duplex while. represents the Watson-Crick interactions which stabilize the duplex). The third GT strand, containing seven GpT/TpG steps, targets the polypurine sequence 5'-AGG-AGG-GAG-GAG-3'. The triple helix is obtained by the folding back twice of a 36mer, formed by three dodecamers tethered by hydroxyalkyl linkers (-L-). Due to the design of the oligonucleotide, the third strand orientation is parallel with respect to the polypurine strand. Triple helical formation has been studied in concentration conditions in which native gel electrophoresis experiments showed the absence of intermolecular structures. Circular dichroism (CD) and UV spectroscopy have been used to evidence the triplex structure. A CD spectrum characteristic of triple helical formation as well as biphasic UV and CD melting curves have been obtained in high ionic strength NaCl solutions in the presence of Zn(2+) ions. Specific interactions with Zn(2+) ions in low water activity conditions are necessary to stabilize the parallel triplex.
    Nucleic Acids Research 10/2000; 28(18):3511-6. · 8.81 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Retroviruses contain dimeric RNA consisting of two identical copies of the genomic RNA. The interaction between these two RNA molecules occurs near their 5' ends. A region upstream from the splice donor comprising an auto-complementary sequence has been identified as being responsible for the initiation of the formation of dimeric HIV-1(Lai) RNA. This region (SL1), part of the PSI encapsidation domain, can adopt a stem-loop structure. It has already been shown that this stem-loop structure can initiate the formation of two distinct dimers differing in their thermostability: a loop-loop dimer or 'kissing complex' and an extended dimer. We report here a study using UV and 1D NMR spectroscopy of the dimerization of a short oligoribonucleotide (23 nucleotides) spanning nucleotides 248-270 of the HIV-1(Lai) SL1 sequence, in order to derive the thermodynamic parameters associated with the transition from the loop-loop complex to the extended dimer. The temperature dependence of the UV absorbency shows an hypochromicity for this transition with a small enthalpy change equal to - 29.4 +/- 5 kcal x mol-1, together with a concentration independent transition which implies a monomolecular reaction. On the other hand, our NMR results don't indicate a dissociation of the GCGCGC sequence engaged in the loop-loop interaction during the rearrangement of the loop-loop complex into the extended dimer. Our data suggest that the loop-loop interaction is maintained during the temperature dependent conformational change while the intramolecular base-pairing of the stems is disrupted and then reconstituted to form an intermolecular base-pairing leading to an extended dimer.
    European Journal of Biochemistry 06/2000; 267(9):2711-9. · 3.58 Impact Factor

Publication Stats

913 Citations
438.17 Total Impact Points

Institutions

  • 1989–2002
    • Institut Pasteur
      Lutetia Parisorum, Île-de-France, France
  • 2001
    • Charles University in Prague
      • Ústav částicové a jaderné fyziky
      Praha, Hlavni mesto Praha, Czech Republic
  • 1988–2001
    • Université Paris 13 Nord
      Île-de-France, France
  • 2000
    • Russian Academy of Sciences
      • Engelhardt Institute of Molecular Biology
      Moscow, Moscow, Russia
  • 1995–2000
    • Atomic Energy and Alternative Energies Commission
      • Centre d'Etudes de Saclay
      Gif-sur-Yvette, Ile-de-France, France
    • Natural Product Chemistry Institute
      Lutetia Parisorum, Île-de-France, France
  • 1998–1999
    • Pierre and Marie Curie University - Paris 6
      Lutetia Parisorum, Île-de-France, France
  • 1991–1999
    • Polytechnic University of Catalonia
      • Department of Chemical Engineering (EQ)
      Barcelona, Catalonia, Spain
  • 1992–1998
    • Institut de Génétique et de Biologie Moléculaire et Cellulaire
      Strasburg, Alsace, France
    • Pasteur Institute of India
      Raj Nilgiri, Orissa, India
  • 1986–1990
    • French National Centre for Scientific Research
      • Institut de Chimie des Substances Naturelles
      Paris, Ile-de-France, France