Shunichi Matsumoto

Gunma University, Maebashi-shi, Gunma-ken, Japan

Are you Shunichi Matsumoto?

Claim your profile

Publications (8)32.6 Total impact

  • [Show abstract] [Hide abstract]
    ABSTRACT: Thyroid hormones (TH) are critical for development, growth, and metabolism. Circulating TH levels are tightly regulated by thyroid stimulating hormone (TSH) secretion within the hypothalamic-pituitary-thyroid (HPT) axis. While circadian TSH secretion has been well documented, the mechanism of this observation remains unclear. Recently, the nuclear corepressor, NCOR1, has been postulated to regulate TSH expression, presumably by interacting with thyroid hormone receptors (THRs) bound to TSH subunit genes. We report herein the first in vitro study of NCOR1 regulation of TSH in a physiologically relevant cell system, the TαT1.1 mouse thyrotroph cell line. Knock-down of NCOR1 by shRNA adenovirus increased baseline Tshb mRNA levels compared to scrambled control, but surprisingly had no affect on the T3-mediated repression of this gene. Using ChIP, we show that NCOR1 enriches on the Tshb promoter at sites different from THR previously identified by our group. Furthermore, NCOR1 enrichment on Tshb is unaffected by T3 treatment. Given that NCOR1 does not target THR on Tshb, we hypothesized that NCOR1 targeted Rev-erbα (NR1D1), an orphan nuclear receptor that is a potent repressor of gene transcription and regulator of metabolism and circadian rhythms. Using a serum shock technique, we synchronized TαT1.1 cells to study circadian gene expression. Post-synchronization, Tshb and Nr1d1 mRNA levels displayed oscillations that inversely correlated with each other. Further, NR1D1 was enriched at the same locus as NCOR1 on Tshb. Therefore, we propose a model for Tshb regulation whereby NR1D1 and NCOR1 interact to regulate circadian expression of Tshb independent of TH negative regulation.
    Journal of Biological Chemistry 05/2014; · 4.65 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Thyroid hormones have a profound influence on human development and disease. The hypothalamic-pituitary-thyroid axis involves finely tuned feedback mechanisms to maintain thyroid hormone (TH) levels. Despite the important role of TH-negative feedback in regulating this axis, the mechanism by which this occurs is not clearly defined. Previous in vivo studies suggest separate roles for the two thyroid hormone receptor isoforms, THRA and THRB, in this axis. We performed studies using a unique pituitary thyrotroph cell line (TαT1.1) to determine the relative roles of THRA and THRB in the regulation of Tshb. Using chromatin immunoprecipitation assays, we found that THRB, not THRA, bound to the Tshb promoter. By selectively depleting THRB, THRA, or both THRA and THRB in TαT1.1 cells, we found that simultaneous knockdown of both THRB and THRA abolished T(3)-mediated down-regulation of Tshb at concentrations as high as 100 nm T(3). In contrast, THRA knockdown alone had no effect on T(3)-negative regulation, whereas THRB knockdown alone abolished T(3)-mediated down-regulation of Tshb mRNA levels at 10 nm but not 100 nm T(3) concentrations. Interestingly, chromatin immunoprecipitation assays showed that THRA becomes enriched on the Tshb promoter after knockdown of THRB. Thus, a likely mechanism for the differential effects of THR isoforms on Tshb may be based on their differential DNA-binding affinity to the promoter.
    Molecular Endocrinology 05/2012; 26(6):926-39. · 4.75 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: The liver X receptors (LXR-α and -β) are nuclear oxysterol receptors that play pivotal roles in regulating the expression of genes involved in cholesterol transport and metabolism. Recently, several groups have reported that the LXRs also regulate adrenal steroidogenesis. In the previous report, we demonstrated that LXR-α is dominantly expressed in the pituitary and that LXR-α positively regulates the proopiomelanocortin (POMC) gene promoter at the transcriptional level. In this report, we evaluated the expression levels of LXR-α and -β gene in the human pituitary tumor. Even though LXR-α mRNA levels are not significantly increased in ACTH-secreting adenomas, LXR-α/β expression ratio is significantly higher than other pituitary tumors including normal pituitaries. Furthermore, in At-T20 cells, which express POMC gene, overexpression of LXR-β decreased POMC gene promoter activities. Thus, we concluded that LXR-α/β gene expression ratio is a critical factor to activate POMC gene expression in ACTH-secreting pituitary adenomas.
    Neuroscience Letters 02/2011; 494(1):34-7. · 2.03 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: We report the isolation and functional characterization of a novel transcriptional co-activator, termed LXRBSV. LXRBSV is an alternative splicing variant of liver X receptor (LXR)-beta LXRBSV has an intronic sequence between exons 2 and 3 in the mouse LXR-beta gene. The LXRBSV gene is expressed in various tissues including the liver and brain. We sub-cloned LXRBSV into pSG5, a mammalian expression vector, and LXRBSV in pSG5 augmented human Sterol Response Element Binding Protein (SREBP)-1c promoter activity in HepG2 cells in a ligand (TO901317) dependent manner. The transactivation mediated by LXRBSV is selective for LXR-beta. The LXRBSV protein was deduced to be 64 amino acids in length; however, a GAL4-LXRBSV fusion protein was not able to induce transactivation. Serial deletion constructs of LXRBSV demonstrated that the intronic sequence inserted in LXRBSV is required for its transactivation activity. An ATG mutant of LXRBSV was able to induce transactivation as wild type. Furthermore, LXRBSV functions in the presence of cycloheximide. Taken together, we have concluded that LXRBSV acts as an RNA transcript not as a protein. In the current study, we have demonstrated for the first time that an alternative splicing variant of a nuclear receptor acts as an RNA co-activator.
    Biochemical and Biophysical Research Communications 10/2009; 390(4):1260-5. · 2.28 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: The molecular mechanism of thyroid hormone (TH) effects to fatty acid metabolism in liver is yet to be clear. The carbohydrate response element-binding protein (ChREBP) as well as sterol response element-binding protein (SREBP)-1c plays a pivotal role in hepatic lipogenesis. Both SREBP-1c and ChREBP are target genes of liver X receptors (LXRs). Because LXRs and TH receptors (TRs) cross talk mutually in many aspects of transcription, we examined whether TRs regulate the mouse ChREBP gene expression. In the current study, we demonstrated that TH up-regulated mouse ChREBP mRNA and protein expression in liver. Run-on and luciferase assays showed that TH and TR-beta1 positively regulated the ChREBP gene transcription. The mouse ChREBP gene promoter contains two direct repeat-4 sites (LXRE1 and LXRE2) and EMSAs demonstrated that LXR-alpha and TR-beta1 prefer to bind LXRE1 and LXRE2, respectively. The direct repeat-4 deletion and LXRE2 mutants of the promoter deteriorate the positive regulation by TR-beta1, indicating that LXRE2 is functionally important for the regulation. We also showed that human ChREBP gene expression and promoter activities were up-regulated by TH. These data suggest that ChREBP mRNA expression is positively regulated by TR-beta1 and TH at the transcriptional level in mammals. This novel observation indicates that TH fine-tunes hepatic lipogenesis via regulating SREBP-1c and ChREBP gene expression reciprocally.
    Endocrinology 04/2009; 150(7):3417-24. · 4.72 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: The liver X receptors (LXR-alpha and -beta) are nuclear oxysterol receptors that play pivotal roles in regulating the expression of genes involved in cholesterol transport and metabolism. Recently, several groups have reported that the LXRs also regulate adrenal steroidogenesis. However, the roles of LXRs in the hypothalami-pituitary-adrenal axis, especially whether they regulate proopiomelanocortin (POMC) gene expression in the pituitary, remain to be elucidated. In this report, we demonstrate that LXR mRNA is expressed in the pituitary and that at the protein level, LXR-alpha is dominantly expressed. Next, we show that the LXR agonist TO901317 (TO) increased POMC mRNA levels and the number of cells immunostained with anti-ACTH antibody in the mouse pituitary. We also confirmed that TO elevated plasma ACTH and serum corticosterone levels in vivo and increased the total tissue content of immunoreactive ACTH in the pituitary. TO activated the rat POMC gene promoter (-706/+64 bp) in GH3 and AtT-20 cells. Silencing of LXR-alpha mRNA expression in GH3 cells with small interfering RNA specific to LXR-alpha caused a loss of promoter activity induced by the LXR ligand, suggesting that LXR-alpha directly regulates the POMC gene promoter. EMSAs also demonstrated that the retinoid X receptor-alpha/LXR-alpha heterodimer bound to the region between -73 and -52 bp in the rat POMC gene promoter, and this site was responsible for the induction by TO, as confirmed by chromatin immunoprecipitation assays using AtT-20 cells. Our findings provide the first evidence that LXR-alpha positively regulates the POMC gene promoter at the transcriptional level and suggest LXR-alpha to be a coordinator for cross talk between lipid metabolism and neuroendocrinology.
    Molecular Endocrinology 12/2008; 23(1):47-60. · 4.75 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: The nuclear oxysterol receptors, liver X receptors (LXRs), and thyroid hormone receptors (TRs) cross talk mutually in many aspects of transcription, sharing the same DNA binding site (direct repeat-4) with identical geometry and polarity. In the current study, we demonstrated that thyroid hormone (T(3)) up-regulated mouse LXR-alpha, but not LXR-beta, mRNA expression in the liver and that cholesterol administration did not affect the LXR-alpha mRNA levels. Recently, several groups have reported that human LXR-alpha autoregulates its own gene promoter through binding to the LXR response element. Therefore, we examined whether TRs regulate the mouse LXR-alpha gene promoter activity. Luciferase assays showed that TR-beta1 positively regulated the mouse LXR-alpha gene transcription. Analysis of serial deletion mutants of the promoter demonstrated that the positive regulation by TR-beta1 was not observed in the -1240/+30-bp construct. EMSA(s) demonstrated that TR-beta1 or retinoid X receptor-alpha did not bind to the region from -1300 to -1240 bp (site A), whereas chromatin-immunoprecipitation assays revealed that TR-beta1 and retinoid X receptor-alpha were recruited to the site A, indicating the presence of intermediating protein between the nuclear receptors and DNA site. We also showed that human LXR-alpha gene expression and promoter activities were up-regulated by thyroid hormone. These data suggest that LXR-alpha mRNA expression is positively regulated by TR-beta1 and thyroid hormone at the transcriptional level in mammals. This novel insight that thyroid hormone regulates LXR-alpha mRNA levels and promoter activity should shed light on a cross talk between LXR-alpha and TR-beta1 as a new therapeutic target against dyslipidemia and atherosclerosis.
    Endocrinology 11/2007; 148(10):4667-75. · 4.72 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1-6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (-574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-alpha/thyroid hormone receptor-beta heterodimer bound to Site2, but retinoid X receptor-alpha/liver X receptor- heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-beta recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3 in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.
    Endocrinology 10/2006; 147(9):4292-302. · 4.72 Impact Factor