-
[show abstract]
[hide abstract]
ABSTRACT: It was recently found that the ten-eleven-translocation (TET) family of Fe(II) and 2-oxoglutarate-dependent enzymes (Tet1/2/3) can oxidize 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC), and thus promotes active demethylation of genomes. Tet1 is highly expressed in mouse embryonic stem cells (mESC) and has been demonstrated to involve in mESC maintenance. Here we used small interference RNA (siRNA) to transiently knockdown expression of Tet1 in porcine induced pluripotent stem cells (iPSC) in order to identify its functions. The fetal fibroblasts were isolated from a 30-day-old porcine fetus and induced into iPSC with defined transcription factors, namely Oct-4, Sox-2, Klf-4, and C-myc. The colonies appeared on Day 12 and were picked up on Day 14. These colonies had normal ES-like morphology and alkaline phosphatase activity. Specifically, they were positively stained for pluripotency-specific markers, including Oct4, Sox2, Nanog, Rex1, and SSEA1. When cultured in vitro, the cells formed embryoid bodies (EB), and all 3 germ layer markers (endoderm: AFP, alphaAT; mesoderm: BMP4, Enolase; ectoderm: GFAP, Neurod) were detected positively in EB. For siRNA transfections, iPSC from the colonies were transfected with 40pmol of siRNA and 2µL of Lipofectamine 2000 in 1 well of a 24-well plate. After transfection, iPSC were subjected to fluorescence-activated cell sorting to determine the fraction of FAM-positive cells in order to confirm transfection efficiency; the percentage of positive cells reached 48±4.96. We observed obvious knockdown of Tet1 after short-term transfection of siRNA, and the knockdown efficiency was confirmed using qRT-PCR and immunofluorescence staining. Notably, knockdown of Tet1 resulted in morphological abnormality and loss of undifferentiated state of porcine iPSC. However, no obvious morphological changes were observed in the negative control (transfected with nonsense-siRNA), positive control (transfected with GAPDH-siRNA), or mock control (transfected with DEPC-treated water). To gain insight into the molecular mechanism underlying the self-renewal defect, we analysed the effects of Tet1 knockdown on the expression of key stem cell factors and differentiation markers of different embryonic layers using qRT-PCR. We found that knockdown of Tet1 resulted in downregulated expression of pluripotency-related genes, such as Lefty-2, Klf-2, and Sox-2 (the expression ratios of post-transfection to pre-transfection were 0.31±0.21, 0.48±0.072, and 0.65±0.046, respectively), and upregulated expression of differentiation-related genes, including Pitx-2, Hand-1, Gata-6, and Lef-1 (the expression ratios of post-transfection to pre-transfection were 4.35±1.36, 2.56±0.68, 2.91±1.47, and 2.33±1.11, respectively). However, Oct-4, C-myc, Klf-4, and Nanog were not downregulated (the expression ratios of post-transfection to pre-transfection were 0.91±0.15, 1.12±0.26, 1.15±0.21, and 1.08±0.08, respectively). Taken together, Tet1 plays important roles in porcine iPSC self-renewal and characterization maintenance.
Reproduction Fertility and Development 12/2012; 25(1):301. · 2.11 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: The elastic modulus of an oral cancer cell line UM1 is investigated by nanoindentation in an atomic force microscope with a flat-ended tip. The commonly used Hertzian method gives apparent elastic modulus which increases with the loading rate, indicating strong effects of viscoelasticity. On the contrary, a rate-jump method developed for viscoelastic materials gives elastic modulus values which are independent of the rate-jump magnitude. The results show that the rate-jump method can be used as a standard protocol for measuring elastic stiffness of living cells, since the measured values are intrinsic properties of the cells.
Journal of the mechanical behavior of biomedical materials. 04/2012; 8:134-42.
-
[show abstract]
[hide abstract]
ABSTRACT: The protein-protein interactions between hepatitis B surface antigen (HBsAg) and its antibodies (anti-HBs) were studied by measuring the binding force between microspheres coated with such proteins using optical tweezers. The interaction force between the protein-coated microspheres was found to be strongly influenced by the acidity of the surrounding liquid medium, as well as the experimental temperature, and it reaches a maximum value at around pH 7.5 and temperature around 37°C. By measuring the protein distribution on the surfaces of the microspheres and their contact areas using scanning electron microscopy, the specific binding force between an HBsAg and anti-HBs protein pair is estimated to be around 4.8 pN at the optimum pH value and temperature at an applied loading rate of around 1 pN/s.
IET Nanobiotechnology 03/2012; 6(1):9-15. · 1.83 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: The reliability test of an electron cyclotron resonance ion source developed for accelerator driven sub-critical system is carried out in China Institute of Atomic Energy. A unique technique to improve the reliability is adopted. The source is operated for more than 200 h at 75 keV, 100 mA extracted hydrogen current, while 2 beam trips are recorded in the period, and uninterrupted operation time is about 150 h. The experimental result is described.
The Review of scientific instruments 02/2012; 83(2):02A321. · 1.52 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Histone deacetylase 1 (HDAC1) is one of the most conserved enzymes present in the nuclei of cells. It was thought to be the most important enzyme in the regulation of histone deacetylation process. However, the function of HDAC1 in bovine fibroblast cells and nuclear transfer embryos is not clear. In the present study, sh299 (5'GCAAGCAGATGCAGAGATTTCAAGA GAATCTCTGCATCTGCTTGCTT3') targeting of HDAC1 mRNA sequence was designed in the PGP/U6/GFP vector (short hairpin RNA, shRNA, expression vector). The sh299 vector was transfected into bovine fibroblast cells by transfection reagent FuGENE HD and the positive cells were identified by the expression of green fluorescent protein (GFP). Histone deacetylase 1 down-regulation in bovine fibroblast cells was measured by quantitative real-time PCR (qRT-PCR with the 2(-ΔΔCT) method) at 48h after sh299 vector transfection at mRNA level. Immunocytochemistry was performed at 96h after sh299 vector transfection to examine the HDAC1 protein level. Bovine fibroblast cells of the control group, negative control vector transfection group and sh299 vector transfection group were used as donor cells for nuclear transfer. Cleavage rates and expression of HDAC1 mRNA in bovine cloned embryos were examined at 48h after nuclear transfer. Blastocyst rates and total cell numbers of blastocysts were examined on Day 7 post-nuclear transfer. Data were analysed with Statistics Production for Service Solution (version 16.0; SPSS) by 1-way ANOVA. A value of P<0.05 was considered to be significantly different. Our results showed that the expression level of HDAC1 was significantly reduced by transfection of the sh299 expression vector. The GFP-positive cells showed decreased signal for HDAC1 by immunocytochemistry. It was suggested that the transfection of the sh299 expression vector reduced HDAC1 expression in bovine fibroblast cells at both mRNA level and protein level. Following nuclear transfer, expression of HDAC1 was significantly reduced in the sh299 vector transfection group (donor cells were transfected by the sh299 vector) compared to the other 2 groups. No significant difference (P>0.05) was seen in cleavage rates among bovine cloned embryos in the sh299 vector transfection group (52.3±3.4%), control group (51.1±5.4%) and negative control vector transfection group (56.2±3.1%). However, blastocyst rates and total cell numbers of blastocysts were significantly lower (P<0.05) in the sh299 vector transfection group (4.2±1.3% and 75.4±9.2, n=89) compared to the control group (18.2±3.7% and 97.6±7.3, n=78) and negative control vector transfection group (18.9±1.7% and 104.2±10.3, n=83). In conclusion, HDAC1 down-regulation in bovine fibroblast cells and cloned embryos by the sh299 expression vector indicated that HDAC1 was essential for the development of bovine cloned embryos.
Reproduction Fertility and Development 12/2011; 24(1):141-2. · 2.11 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Parthenogenetic activation of the oocyte represents an important step in the somatic cell nuclear transfer. The aim of the present study was to establish optimizing conditions for parthenogenetic activation of Sika deer oocytes necessary for cloning Sika deer. Sika deer ovaries were collected from a slaughter house during oestrus season (October and November), placed into saline (25°C) supplemented with 1% (v/v) penicillin and streptomycin and transported into the laboratory within 4h. The small vesicular follicles (diameter, 2-5mm) on the ovarian surface were incised with a scalpel in a Petri dish containing PBS to release the cumulus-oocyte complexes (COC). Only COC with uniform cytoplasm and at least 3 layers of compact cumulus cells were cultured in vitro for 24h. The media of in vitro maturation (IVM) was TCM-199 supplemented with 10% fetal bovine serum, 10μgmL(-1) FSH, 1μgmL(-1) LH, 0.2mM cysteamine and 50ngmL(-1) epidermal growth factor. After IVM, the cumulus cells were denuded with 0.2% hyaluronidase in TCM-199 at 38.5°C by pipetting. The cumulus-free Sika deer oocytes were stimulated by 1 of the following treatments: 1) ethanol+6-DMAP, treated with 7% ethanol for 7min and 2mM 6-dimethylaminopurine (6-DMAP) in DSOF for 4h; or 2) ionomycin+6-DMAP, treated with 5μM ionomycin for 5min and 2mM 6-DMAP in DSOF for 4h. Then, oocytes were transferred into culture media for 7 days [Day 0 (D0)=activation]. On D3, embryos were transferred into fresh DSOF drops supplemented with 10% (v/v) fetal bovine serum. All cultures were overlaid with mineral oil and kept in a humidified modular incubation chamber gassed with 5% CO(2). Effects of these chemicals on oocyte activation were then examined and compared with the controls, in which oocytes were cultured in TCM-199 for 4h without chemical supplement. Our results showed that rates of cleavage, morula and blastocyst were 72.7, 43.9 and 32.4% (n=139), respectively, by treatment with ionomycin+6-DMAP. And rates of cleavage, morula and blastocyst were 61.1, 29.7 and 17.8% (n=134), respectively, by treatment with ethanol+6-DMAP. However, the rates of cleavage, morula and blastocyst were 5, 0 and 0% (n=101) in the control group. Meanwhile, the rates of oocyte cleavage (72.7% vs 61.1%), morula (43.9% vs 29.7%) and blastocyst (32.4% vs 17.8%) between 2 treatments of ionomycin+6-DMAP and ethanol+6-DMAP were significantly different (P<0.05). In conclusion, parthenogenetic activation of Sika deer oocytes with ionomycin+6-DMAP is more effective than that with ethanol+6-DMAP. These results have begun to elucidate parameters important for animal modeling and cloning with the Sika deer and should facilitate the development of genetically defined animal models in this species.
Reproduction Fertility and Development 12/2011; 24(1):204-5. · 2.11 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: This paper describes interference and background correction problem of direct determination of Pb, Zn and Cd in soil, sediment, plants, halobios and sea water by FAAS. With the improvement of limit of detection(L.O.D) of instrument, Pb, Zn and Cd in same environmental and biological samples can be analyzed directly by FAAS, but it is worth taking attention that there are quantities of elements which lead to background interference in air-ethyne flame, such as Al, Na, K Ca, Mg and Fe. Compare with no background correction, limit of detection using D2 lamp background correction is improved by 1.05-4.5 times, the recoveries and the relative standard deviation(R.S.D) are better, standard samples were also analyzed with satisfactory results.
Guang pu xue yu guang pu fen xi = Guang pu 03/2001; 21(1):77-80. · 0.84 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Spectral interferences in the simultaneous determination of multi-elements in sediments and soil by ICP-AES were investigated and the multicomponent spectral fitting (MSF) method was used for the correction. Several factors affecting the MSF method such as the signal integration time and the spectra shift were studied. The comparison between MSF and off-peak background correction were made by analyzing national standard reference material: sediment GBW07306. The detection limit and the precision could be improved by a factor of 1.3-9.0 and 1.1-4.9 respectively and the results agreed better with those of the certified values when using MSF correction.
Guang pu xue yu guang pu fen xi = Guang pu 09/2000; 20(4):501-6. · 0.84 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: A direct determination of Al, As, Ca, Cd, Co, Cr, Cu, Fe, Mg, Mn, Mo, Ni, Sn, Ti and V in tungsten products with ICP-AES is presented. The influence of tungsten matrix is studied. Based on the selected optimum operating parameters, the feasibility of the proposed method is evaluated by analyzing three WO3 National References. The results are satisfactory.
Guang pu xue yu guang pu fen xi = Guang pu 11/1998; 18(5):576-9. · 0.84 Impact Factor
