-
[show abstract]
[hide abstract]
ABSTRACT: YdiV, a degenerate EAL domain protein, represses motility by interacting with FlhD to abolish FlhDC interaction with DNA. Here, we demonstrate that deletion of ydiV dysregulates coordinate control of motility and adherence, by increasing adherence of E. coli CFT073 to a bladder epithelial cell line by specifically increasing production of P fimbriae. Interestingly, only one of the two P fimbrial operons, pap_2, encoded in the genome of E. coli CFT073 was upregulated. This de-repression of the pap_2 operon is abolished following deletion of either cya or crp, demonstrating cAMP-dependent activation of the P-fimbrial operon. However, the absence of YdiV does not affect the gene expression of cya and crp and loss of SdiA in the ydiV mutant does not affect the de-repression of the pap_2 operon suggesting YdiV control of adherence acts in response to cAMP levels. Deletion of ydiV increases motility by increasing expression of fliA, suggesting that in E. coli CFT073, YdiV regulates motility by the same mechanism described previously for commensal E. coli strains. Furthermore, analysis of site-directed mutations found two conserved Mg(2+)-binding residues of four conserved YdiV residues (E29 and Q219) that were involved in regulation of motility, while two conserved c-di-GMP-binding residues (D156 and D165) did not affect motility. None of the four conserved YdiV residues appeared to affect regulation of adherence. Therefore, we propose a model in which a degenerate EAL, YdiV, utilizes different domains to regulate motility through interaction with FlhD and adherence to epithelial cells through cAMP-dependent effects on the pap_2 promoter.
Journal of bacteriology 05/2013; · 3.94 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: In bacteria, laterally acquired genes are often concentrated within chromosomal regions known as genomic islands. Using a recently developed zebrafish infection model, we set out to identify unique factors encoded within genomic islands that contribute to the fitness and virulence of a reference urosepsis isolate—extraintestinal pathogenic Escherichia coli strain CFT073. By screening a series of deletion mutants, we discovered a previously uncharacterized gene, neaT, that is conditionally required by the pathogen during systemic infections. In vitro assays indicate that neaT can limit bacterial interactions with host phagocytes and alter the aggregative properties of CFT073. The neaT gene is localized within an integrated P2-like bacteriophage in CFT073, but was rarely found within other proteobacterial genomes. Sequence-based analyses revealed that neaT homologues are present, but discordantly conserved, within a phyletically diverse set of bacterial species. In CFT073, neaT appears to be unameliorated, having an exceptionally A+T-rich composition along with a notably altered codon bias. These data suggest that neaT was recently brought into the proteobacterial pan-genome from an extra-phyletic source. Interestingly, even in G+C-poor genomes, as found within the Firmicutes lineage, neaT-like genes are often unameliorated. Sequence-level features of neaT homologues challenge the common supposition that the A+T-rich nature of many recently acquired genes reflects the nucleotide composition of their genomes of origin. In total, these findings highlight the complexity of the evolutionary forces that can affect the acquisition, utilization, and assimilation of rare genes that promote the niche-dependent fitness and virulence of a bacterial pathogen.
PLoS Pathogens 02/2013; 9(2):e1003175. · 9.13 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Extraintestinal Escherichia coli (ExPEC), a heterogeneous group of pathogens, encompasses avian, neonatal meningitis, and uropathogenic E. coli strains. While several virulence factors are associated with ExPEC, there is no core set of virulence factors that can be used to definitively differentiate these pathotypes. Here we describe a multiplex of four virulence factor-encoding genes, yfcV, vat, fyuA, and chuA, highly associated with uropathogenic E. coli, can distinguish three groups of E. coli: diarrheagenic and animal-associated E. coli, human commensal and avian pathogenic E. coli, and uropathogenic and neonatal meningitis E. coli. Furthermore, human intestinal isolates that encode all four predictor genes express them during exponential growth in human urine and colonize the bladder in the mouse model of ascending urinary tract infection in higher numbers than human commensal strains that do not encode the four predictor genes (P = 0.02), suggesting that the presence of the predictors correlates with uropathogenic potential.
Infection and immunity 09/2012; · 4.21 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: In previous work, we designed a modified aptamer-free SELEX-seq protocol (afSELEX-seq) for the discovery of transcription factor binding sites. Here, we present original software, TFAST, designed to analyze afSELEX-seq data, validated against our previously generated afSELEX-seq dataset and a model dataset. TFAST is designed with a simple graphical interface (Java) so that it can be installed and executed without extensive expertise in bioinformatics. TFAST completes analysis within minutes on most personal computers.
Once afSELEX-seq data are aligned to a target genome, TFAST identifies peaks and, uniquely, compares peak characteristics between cycles. TFAST generates a hierarchical report of graded peaks, their associated genomic sequences, binding site length predictions, and dummy sequences.
Including additional cycles of afSELEX-seq improved TFAST's ability to selectively identify peaks, leading to 7,274, 4,255, and 2,628 peaks identified in two-, three-, and four-cycle afSELEX-seq. Inter-round analysis by TFAST identified 457 peaks as the strongest candidates for true binding sites. Separating peaks by TFAST into classes of worst, second-best and best candidate peaks revealed a trend of increasing significance (e-values 4.5×10(12), 2.9×10(-46), and 1.2×10(-73)) and informational content (11.0, 11.9, and 12.5 bits over 15 bp) of discovered motifs within each respective class. TFAST also predicted a binding site length (28 bp) consistent with non-computational experimentally derived results for the transcription factor PapX (22 to 29 bp).
TFAST offers a novel and intuitive approach for determining DNA binding sites of proteins subjected to afSELEX-seq. Here, we demonstrate that TFAST, using afSELEX-seq data, rapidly and accurately predicted sequence length and motif for a putative transcription factor's binding site.
PLoS ONE 01/2012; 7(8):e42761. · 4.09 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: ABSTRACT Proteus mirabilis rapidly migrates across surfaces using a periodic developmental process of differentiation alternating between short swimmer cells and elongated hyperflagellated swarmer cells. To undergo this vigorous flagellum-mediated motility, bacteria must generate a substantial proton gradient across their cytoplasmic membranes by using available energy pathways. We sought to identify the link between energy pathways and swarming differentiation by examining the behavior of defined central metabolism mutants. Mutations in the tricarboxylic acid (TCA) cycle (fumC and sdhB mutants) caused altered patterns of swarming periodicity, suggesting an aerobic pathway. Surprisingly, the wild-type strain swarmed on agar containing sodium azide, which poisons aerobic respiration; the fumC TCA cycle mutant, however, was unable to swarm on azide. To identify other contributing energy pathways, we screened transposon mutants for loss of swarming on sodium azide and found insertions in the following genes that involved fumarate metabolism or respiration: hybB, encoding hydrogenase; fumC, encoding fumarase; argH, encoding argininosuccinate lyase (generates fumarate); and a quinone hydroxylase gene. These findings validated the screen and suggested involvement of anaerobic electron transport chain components. Abnormal swarming periodicity of fumC and sdhB mutants was associated with the excretion of reduced acidic fermentation end products. Bacteria lacking SdhB were rescued to wild-type pH and periodicity by providing fumarate, independent of carbon source but dependent on oxygen, while fumC mutants were rescued by glycerol, independent of fumarate only under anaerobic conditions. These findings link multicellular swarming patterns with fumarate metabolism and membrane electron transport using a previously unappreciated configuration of both aerobic and anaerobic respiratory chain components. IMPORTANCE Bacterial locomotion and the existence of microbes were the first scientific observations that followed the invention of the microscope. A bacterium can swim through a fluid environment or coordinate motion with a group of bacteria and swarm across a surface. The flagellar motor, which propels the bacterium, is fueled by proton motive force. In contrast to the physiology that governs swimming motility, much less is known about the energy sources required for multicellular swarming on surfaces. In this study, we used Proteus mirabilis as a model organism to study vigorous swarming behavior and genetic and biochemical approaches to define energy pathways and central metabolism that contribute to multicellular motility. We found that swarming bacteria use a complete aerobic tricarboxylic acid (TCA) cycle but do not respire oxygen as the terminal electron acceptor, suggesting that multicellular cooperation during swarming reduces the amount of energy required by individual bacteria to achieve rapid motility.
mBio 01/2012; 3(6). · 5.31 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: The urinary tract is one of the most frequent sites of bacterial infection in humans. Uropathogenic Escherichia coli (UPEC) strains are the leading cause of urinary tract infections (UTIs) and are responsible for greater than 80% of uncomplicated cases in adults. Infection of the urinary tract occurs in an ascending manner, with colonization of the bladder leading to possible kidney infection and bacteremia. The goal of this study was to examine the population dynamics of UPEC in vivo using a murine model of ascending UTI. To track individual UPEC lineages within a host, we constructed 10 isogenic clones of UPEC strain CFT073 by inserting unique signature tag sequences between the pstS and glmS genes at the attTn7 chromosomal site. Mice were transurethrally inoculated with a mixture containing equal numbers of unique clones. After 4 and 48 h, the tags present in the bladders, kidneys, and spleens of infected mice were enumerated using tag-specific primers and quantitative real-time PCR. The results indicated that kidney infection and bacteremia associated with UTI are most likely the result of multiple rounds of ascension and dissemination from motile UPEC subpopulations, with a distinct bottleneck existing between the kidney and bloodstream. The abundance of tagged lineages became more variable as infection progressed, especially after bacterial ascension to the upper urinary tract. Analysis of the population kinetics of UPEC during UTI revealed metapopulation dynamics, with lineages that constantly increased and decreased in abundance as they migrated from one organ to another. IMPORTANCE: Urinary tract infections are some of the most common infections affecting humans, and Escherichia coli is the primary cause in most uncomplicated cases. These infections occur in an ascending manner, with bacteria traveling from the bladder to the kidneys and potentially the bloodstream. Little is known about the spatiotemporal population dynamics of uropathogenic E. coli within a host. Here we describe a novel approach for tracking lineages of isogenic tagged E. coli strains within a murine host by the use of quantitative real-time PCR. Understanding the in vivo population dynamics and the factors that shape the bacterial population may prove to be of significant value in the development of novel vaccines and drug therapies.
mBio 01/2012; 3(1). · 5.31 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: ABSTRACT Intracellular concentration of cyclic diguanylate monophosphate (c-di-GMP), a second messenger molecule, is regulated in bacteria by diguanylate cyclases (DGCs) (synthesizing c-di-GMP) and phosphodiesterases (PDEs) (degrading c-di-GMP). c-di-GMP concentration ([c-di-GMP]) affects motility and sessility in a reciprocal fashion; high [c-di-GMP] typically inhibits motility and promotes sessility. A c-di-GMP sensor domain, PilZ, also regulates motility and sessility. Uropathogenic Escherichia coli regulates these processes during infection; motility is necessary for ascending the urinary tract, while sessility is essential for colonization of anatomical sites. Here, we constructed and screened 32 mutants containing deletions of genes encoding each PDE (n = 11), DGC (n = 13), PilZ (n = 2), and both PDE and DGC (n = 6) domains for defects in motility, biofilm formation, and adherence for the prototypical pyelonephritis isolate E. coli CFT073. Three of 32 mutations affected motility, all of which were in genes encoding enzymatically inactive PDEs. Four PDEs, eight DGCs, four PDE/DGCs, and one PilZ regulated biofilm formation in a medium-specific manner. Adherence to bladder epithelial cells was regulated by [c-di-GMP]. Four PDEs, one DGC, and three PDE/DGCs repress adherence and four DGCs and one PDE/DGC stimulate adherence. Thus, specific effectors of [c-di-GMP] and catalytically inactive DGCs and PDEs regulate adherence and motility in uropathogenic E. coli. IMPORTANCE Uropathogenic Escherichia coli (UPEC) contains several genes annotated as encoding enzymes that increase or decrease the abundance of the second messenger molecule, c-di-GMP. While this class of enzymes has been studied in an E. coli K-12 lab strain, these proteins have not been comprehensively examined in UPEC. UPEC utilizes both swimming motility and adherence to colonize and ascend the urinary tract; both of these processes are hypothesized to be regulated by the concentration of c-di-GMP. Here, for the first time, in a uropathogenic strain, E. coli CFT073, we have characterized mutants lacking each protein and demonstrated that the uropathogen has diverged from E. coli K-12 to utilize these enzymes to regulate adherence and motility by distinct mechanisms.
mBio 01/2012; 3(5). · 5.31 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Most uncomplicated urinary tract infections (UTIs) are caused by uropathogenic Escherichia coli (UPEC). Both motility and adherence are integral to UTI pathogenesis, yet they represent opposing forces. Therefore, it is logical to reciprocally regulate these functions. In UPEC strain CFT073, PapX, a non-structural protein encoded by one of the two pap operons encoding P fimbria adherence factor, represses flagella-mediated motility and is a putative member of the winged helix transcription factor family. The mechanism of this repression, however, is not understood. papX is found preferentially in more virulent UPEC isolates, being significantly more prevalent in pyelonephritis strains (53% of isolates) than in asymptomatic bacteriuria (32%) or fecal/commensal (12.5%) strains. To examine PapX structure-function, we generated papX linker insertion and site-directed mutants, which identified two key residues for PapX function (Lys(54) and Arg(127)) within domains predicted by modeling with I-TASSER software to be important for dimerization and DNA binding, respectively. To determine the PapX binding site in the CFT073 genome, systematic evolution of ligands by exponential enrichment (SELEX) in conjunction with high throughput sequencing was utilized for the first time to determine a novel binding site for a bacterial transcription factor. This method identified a 29-bp binding site within the flhDC promoter (TTACGGTGAGTTATTTTAACTGTGCGCAA), centered 410 bp upstream of the flhD translational start site. Gel shift experiments demonstrated that PapX binds directly to this site to repress transcription of flagellar genes.
Journal of Biological Chemistry 12/2011; 286(52):44726-38. · 4.77 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Methicillin-resistant Staphylococcus aureus (MRSA) remains sensitive to vancomycin; when vancomycin-resistant S. aureus (VRSA) emerges, treatment becomes more complex. VRSA emergence is attributed to conjugative transfer of the vancomycin-resistance gene cluster from vancomycin-resistant enterococci (VRE) to MRSA. Because cocolonization with MRSA and VRE precedes VRSA development, this study investigates the epidemiology of cocolonization in skilled nursing facility (SNF) residents at high risk for MRSA or VRE colonization.
A prospective observational study conducted at 15 SNFs in southeast Michigan. Overall, 178 residents (90 with indwelling urinary catheters and/or feeding tubes and 88 device-free) were cultured monthly for MRSA and VRE, and clinical data were recorded.
The incidence of MRSA/VRE cocolonization among residents with indwelling devices was 6.5 per 100 resident-months; 5.2 (95% confidence interval [CI]: 1.49-18.1) times that among those without devices. MRSA/VRE cocolonization in the device group occurred most frequently in wounds (4.1 per 100 resident-months). In a logistic regression analysis limited to residents with devices, functional disability (rate ratio [RR], 1.3; 95% CI: 1.1-1.4) and wound presence (RR, 3.4; 95% CI: 1.4-8.6) were independent risk factors of cocolonization.
In a population of SNF residents, individuals with indwelling devices who also had functional disability or wounds were at greatest risk of MRSA/VRE cocolonization. These individuals should be routinely monitored for the presence of VRSA colonization.
Clinical Infectious Diseases 12/2011; 53(12):1215-22. · 9.15 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Uropathogenic Escherichia coli (UPEC) is responsible for the majority of uncomplicated urinary tract infections (UTI) and represents the most common bacterial infection in adults. UPEC utilizes a wide range of virulence factors to colonize the host, including the novel repeat-in-toxin (RTX) protein TosA, which is specifically expressed in the host urinary tract and contributes significantly to the virulence and survival of UPEC. tosA, found in strains within the B2 phylogenetic subgroup of E. coli, serves as a marker for strains that also contain a large number of well-characterized UPEC virulence factors. The presence of tosA in an E. coli isolate predicts successful colonization of the murine model of ascending UTI, regardless of the source of the isolate. Here, a detailed analysis of the function of tosA revealed that this gene is transcriptionally linked to genes encoding a conserved type 1 secretion system similar to other RTX family members. TosA localized to the cell surface and was found to mediate (i) adherence to host cells derived from the upper urinary tract and (ii) survival in disseminated infections and (iii) to enhance lethality during sepsis (as assessed in two different animal models of infection). An experimental vaccine, using purified TosA, protected vaccinated animals against urosepsis. From this work, it was concluded that TosA belongs to a novel group of RTX proteins that mediate adherence and host damage during UTI and urosepsis and could be a novel target for the development of therapeutics to treat ascending UTIs.
Infection and immunity 11/2011; 80(2):493-505. · 4.21 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Escherichia coli, a cause of ∼90% of urinary tract infections (UTI), utilizes fimbrial adhesins to colonize the uroepithelium. Pyelonephritis isolate E. coli CFT073 carries 12 fimbrial operons, 5 of which have never been studied. Using multiplex PCR, the prevalence of these 12 and 3 additional fimbrial types was determined for a collection of 303 E. coli isolates (57 human commensal, 32 animal commensal, 54 asymptomatic bacteriuria, 45 complicated UTI, 38 uncomplicated cystitis, and 77 pyelonephritis). The number of fimbrial types per E. coli isolate was distributed bimodally: those with low (3.2 ± 1.1) and those with high (8.3 ± 1.3) numbers of fimbrial types (means ± standard errors of the means). The fimbrial genes ygiL, yadN, yfcV, and c2395 were significantly more prevalent among urine isolates than human commensal isolates. The effect of deletion of Ygi and Yad fimbrial operons on growth, motility, biofilm formation, adherence to immortalized human epithelial cells, and pathogenesis in the mouse model of UTI was examined. Yad fimbriae were necessary for wild-type levels of adherence to a bladder epithelial cell line and for biofilm formation. Deletion of these fimbrial genes increased motility. Ygi fimbriae were necessary for wild-type levels of adherence to a human embryonic kidney cell line, biofilm formation, and in vivo fitness in the urine and kidneys. Complementation of each fimbrial mutant restored wild-type levels of motility, biofilm formation, adherence and, for ygi, in vivo fitness. A double deletion strain, Δygi Δyad, was attenuated in the urine, bladder, and kidneys in the mouse model, demonstrating that these fimbriae contribute to uropathogenesis.
Infection and immunity 09/2011; 79(12):4753-63. · 4.21 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: PhoP is considered a virulence regulator despite being conserved in both pathogenic and non-pathogenic Enterobacteriaceae. While Escherichia coli strains represent non-pathogenic commensal isolates and numerous virulent pathotypes, the PhoP virulence regulator has only been studied in commensal E. coli. To better understand how conserved transcription factors contribute to virulence, we characterized PhoP in pathogenic E. coli. Deletion of phoP significantly attenuated E. coli during extraintestinal infection. This was not surprising since we demonstrated that PhoP differentially regulated the transcription of > 600 genes. In addition to survival at acidic pH and resistance to polymyxin, PhoP was required for repression of motility and oxygen-independent changes in the expression of primary dehydrogenase and terminal reductase respiratory chain components. All phenotypes have in common a reliance on an energized membrane. Thus, we hypothesized that PhoP mediates these effects by regulating genes encoding proteins that generate proton motive force. Indeed, bacteria lacking PhoP exhibited a hyperpolarized membrane and dissipation of the transmembrane electrochemical gradient increased susceptibility of the phoP mutant to acidic pH, while inhibiting respiratory generation of the proton gradient restored resistance to antimicrobial peptides independent of lipopolysaccharide modification. These findings demonstrate a connection between PhoP, virulence and the energized state of the membrane.
Molecular Microbiology 08/2011; 82(1):145-63. · 5.01 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: The enteric bacterium Proteus mirabilis is a common cause of complicated urinary tract infections. In this study, microarrays were used to analyze P. mirabilis gene expression in vivo from experimentally infected mice. Urine was collected at 1, 3, and 7 days postinfection, and RNA was isolated from bacteria in the urine for transcriptional analysis. Across nine microarrays, 471 genes were upregulated and 82 were downregulated in vivo compared to in vitro broth culture. Genes upregulated in vivo encoded mannose-resistant Proteus-like (MR/P) fimbriae, urease, iron uptake systems, amino acid and peptide transporters, pyruvate metabolism enzymes, and a portion of the tricarboxylic acid (TCA) cycle enzymes. Flagella were downregulated. Ammonia assimilation gene glnA (glutamine synthetase) was repressed in vivo, while gdhA (glutamate dehydrogenase) was upregulated in vivo. Contrary to our expectations, ammonia availability due to urease activity in P. mirabilis did not drive this gene expression. A gdhA mutant was growth deficient in minimal medium with citrate as the sole carbon source, and loss of gdhA resulted in a significant fitness defect in the mouse model of urinary tract infection. Unlike Escherichia coli, which represses gdhA and upregulates glnA in vivo and cannot utilize citrate, the data suggest that P. mirabilis uses glutamate dehydrogenase to monitor carbon-nitrogen balance, and this ability contributes to the pathogenic potential of P. mirabilis in the urinary tract.
Infection and immunity 07/2011; 79(7):2619-31. · 4.21 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Integrative and conjugative elements (ICEs), which are chromosomal mobile elements, can conjugatively transfer between bacteria. Recently, we identified a genomic island of Proteus mirabilis, a common agent of catheter-associated urinary tract infection (UTI), that possesses all the properties consistent with an ICE. This element, designated ICEPm1, is highly conserved in other causative agents of UTI, suggesting its mobility. We demonstrate that ICEPm1 can actively excise from the chromosome in a clonal population of bacteria and that this excision is integrase dependent. Although in P. mirabilis HI4320, ICEPm1 is annotated as integrated into the phenylalanine tRNA gene pheV, we show that ICEPm1 can integrate into either pheV or pheU. We determined that ICEPm1 transfers at a frequency of 1.35 × 10(-5) transconjugants/donor to ICEPm1-deficient P. mirabilis using plate mating assays with clinical isolates. Insertional inactivation of a putative integrase gene on ICEPm1 decreased transfer frequencies of ICEPm1 to below the limit of detection. Mutation of the relaxase of ICEPm1 also eliminates transfer and demonstrates that this element is indeed self-transmissible and not transferred in trans, as are some mobilizable genomic islands. Together, these findings clearly demonstrate that ICEPm1 can actively excise from the chromosome in an integrase-dependent manner, dynamically integrate into both phenylalanine tRNA genes, and transfer into clinical strains using its own conjugation machinery.
Journal of bacteriology 06/2011; 193(16):4104-12. · 3.94 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Previous studies showed that deletion of genes c3405 to c3410 from PAI-metV, a genomic island from Escherichia coli CFT073, results in a strain that fails to compete with wild-type CFT073 after a transurethral cochallenge in mice and is deficient in the ability to independently colonize the mouse kidney. Our analysis of c3405 to c3410 suggests that these genes constitute an operon with a role in the internalization and utilization of an unknown carbohydrate. This operon is not found in E. coli K-12 but is present in a small number of pathogenic E. coli and Shigella boydii strains. One of the genes, c3406, encodes a protein with significant homology to the sugar isomerase domain of arabinose 5-phosphate isomerases but lacking the tandem cystathionine beta-synthase domains found in the other arabinose 5-phosphate isomerases of E. coli. We prepared recombinant c3406 protein, found it to possess arabinose 5-phosphate isomerase activity, and characterized this activity in detail. We also constructed a c3406 deletion mutant of E. coli CFT073 and demonstrated that this deletion mutant was still able to compete with wild-type CFT073 in a transurethral cochallenge in mice and could colonize the mouse kidney. These results demonstrate that the presence of c3406 is not essential for a pathogenic phenotype.
Journal of bacteriology 06/2011; 193(12):2981-8. · 3.94 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Uropathogenic Escherichia coli (UPEC), the predominant cause of uncomplicated urinary tract infection (UTI), utilizes an array of outer membrane iron receptors to facilitate siderophore and heme import from within the iron-limited urinary tract. While these systems are required for UPEC in vivo fitness and are assumed to be functionally redundant, the relative contributions of specific receptors to pathogenesis are unknown. To delineate the relative roles of distinct UPEC iron acquisition systems in UTI, isogenic mutants in UPEC strain CFT073 or 536 lacking individual receptors were competed against one another in vivo in a series of mixed infections. When combinations of up to four mutants were coinoculated using a CBA/J mouse model of ascending UTI, catecholate receptor mutants (ΔfepA, Δiha, and ΔiroN mutants) were equally fit, suggesting redundant function. However, noncatecholate siderophore receptor mutants, including the ΔiutA aerobactin receptor mutant and the ΔfyuA yersiniabactin receptor mutant, were frequently outcompeted by coinoculated mutants, indicating that these systems contribute more significantly to UPEC iron acquisition in vivo. A tissue-specific preference for heme acquisition was also observed, as a heme uptake-deficient Δhma ΔchuA double mutant was outcompeted by siderophore receptor mutants specifically during kidney colonization. The relative contribution of each receptor to UTI only partially correlated with in vivo levels of receptor gene expression, indicating that other factors likely contributed to the observed fitness differences. Overall, our results suggest that UPEC iron receptors provide both functional redundancy and niche specificity for this pathogen as it colonizes distinct sites within the urinary tract.
Infection and immunity 03/2011; 79(3):1225-35. · 4.21 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Uncomplicated urinary tract infections (UTI) are caused most commonly by uropathogenic Escherichia coli (UPEC). Whole-genome screening approaches, including transcriptomic, proteomic, and signature-tagged mutagenesis, have shown that UPEC highly expresses or requires genes for translational machinery, capsule, lipopolysaccharide, type 1 fimbriae, and iron acquisition systems during UTI. To identify additional genes expressed by UPEC during UTI, an immunoscreening approach termed in vivo-induced antigen technology (IVIAT) was employed to identify antigens produced during experimental infection that are not produced during in vitro culture. An inducible protein expression library, constructed from genomic DNA isolated from UPEC strain CFT073, was screened using exhaustively adsorbed pooled sera from 20 chronically infected female CBA/J mice. Using this approach, we identified 93 antigens induced by UPEC in vivo. A representative subset of these genes was tested by quantitative PCR for expression by CFT073 in vivo and during growth in human urine or LB medium in vitro; proWX, narJI, lolA, lolD, tosA (upxA), c2432, katG, ydhX, kpsS, and yddQ were poorly expressed in vitro but highly expressed in vivo. Of these, tosA, a gene encoding a predicted repeat-in-toxin family member, was expressed exclusively during UTI. Deletion of tosA in UPEC strain CFT073 resulted in significant attenuation in bladder and kidney infections during ascending UTI. By screening for in vivo-induced antigens, we identified a novel UPEC virulence factor and additional proteins that could be useful as potential vaccine targets.
Infection and immunity 03/2011; 79(6):2335-44. · 4.21 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: The replacement of the bladder with a neobladder made from ileal tissue is the prescribed treatment in some cases of bladder cancer or trauma. Studies have demonstrated that individuals with an ileal neobladder have recurrent colonization by Escherichia coli and other species that are commonly associated with urinary tract infections; however, pyelonephritis and complicated symptomatic infections with ileal neobladders are relatively rare. This study examines the genomic content of two E. coli isolates from individuals with neobladders using comparative genomic hybridization (CGH) with a pan-E. coli/Shigella microarray. Comparisons of the neobladder genome hybridization patterns with reference genomes demonstrate that the neobladder isolates are more similar to the commensal, laboratory-adapted E. coli and a subset of enteroaggregative E. coli than they are to uropathogenic E. coli isolates. Genes identified by CGH as exclusively present in the neobladder isolates among the 30 examined isolates were primarily from large enteric isolate plasmids. Isolations identified a large plasmid in each isolate, and sequencing confirmed similarity to previously identified plasmids of enteric species. Screening, via PCR, of more than 100 isolates of E. coli from environmental, diarrhoeagenic and urinary tract sources did not identify neobladder-specific genes that were widely distributed in these populations. These results taken together demonstrate that the neobladder isolates, while distinct, are genomically more similar to gastrointestinal or commensal E. coli, suggesting why they can colonize the transplanted intestinal tissue but rarely progress to acute pyelonephritis or more severe disease.
Microbiology 01/2011; 157(Pt 4):1088-102. · 3.06 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Uropathogenic Escherichia coli (UPEC) strains, which cause the majority of uncomplicated urinary tract infections (UTIs), carry a unique assortment of virulence or fitness genes. However, no single defining set of virulence or fitness genes has been found in all strains of UPEC, making the differentiation between UPEC and fecal commensal strains of E. coli difficult without the use of animal models of infection or phylogenetic grouping. In the present study, we consider three broad categories of virulence factors simultaneously to better define a combination of virulence factors that predicts success in the urinary tract. A total of 314 strains of E. coli, representing isolates from fecal samples, asymptomatic bacteriuria, complicated UTIs, and uncomplicated bladder and kidney infections, were assessed by multiplex PCR for the presence of 15 virulence or fitness genes encoding adhesins, toxins, and iron acquisition systems. The results confirm previous reports of gene prevalence among isolates from different clinical settings and identify several new patterns of gene associations. One gene, tosA, a putative repeat-in-toxin (RTX) homolog, is present in 11% of fecal strains but 25% of urinary isolates. Whereas tosA-positive strains carry an unusually high number (11.2) of the 15 virulence or fitness genes, tosA-negative strains have an average of only 5.4 virulence or fitness genes. The presence of tosA was predictive of successful colonization of a murine model of infection, even among fecal isolates, and can be used as a marker of pathogenic strains of UPEC within a distinct subset of the B2 lineage. IMPORTANCE: Escherichia coli is the primary cause of urinary tract infections, the most common bacterial infection of humans. Virulence of a uropathogenic strain is typically defined by the clinical source of the isolate, the ability to colonize the bladder and kidneys in a murine model, the phylogenetic group of the bacterium, and virulence gene content. Here we describe a novel single gene, the repeat-in-toxin gene tosA, the presence of which predicts virulence of E. coli isolates regardless of source. Rapid identification of uropathogenic strains of E. coli may aid in the development of therapeutic and preventive therapies.
mBio 01/2011; 2(3):e00066-11. · 5.31 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Fimbriae of the human uropathogen Proteus mirabilis are the only characterized surface proteins that contribute to its virulence by mediating adhesion and invasion of the uroepithelia. PMI2122 (AipA) and PMI2575 (TaaP) are annotated in the genome of strain HI4320 as trimeric autotransporters with "adhesin-like" and "agglutinating adhesin-like" properties, respectively. The C-terminal 62 amino acids (aa) in AipA and 76 aa in TaaP are homologous to the translocator domains of YadA from Yersinia enterocolitica and Hia from Haemophilus influenzae. Comparative protein modeling using the Hia three-dimensional structure as a template predicted that each of these domains would contain four antiparallel beta sheets and that they formed homotrimers. Recombinant AipA and TaaP were seen as ∼28 kDa and ∼78 kDa, respectively, in Escherichia coli, and each also formed high-molecular-weight homotrimers, thus supporting this model. E. coli synthesizing AipA or TaaP bound to extracellular matrix proteins with a 10- to 60-fold-higher level of affinity than the control strain. Inactivation of aipA in P. mirabilis strains significantly (P < 0.01) reduced the mutants' ability to adhere to or invade HEK293 cell monolayers, and the functions were restored upon complementation. A 51-aa-long invasin region in the AipA passenger domain was required for this function. E. coli expressing TaaP mediated autoagglutination, and a taaP mutant of P. mirabilis showed significantly (P < 0.05) more reduced aggregation than HI4320. Gly-247 in AipA and Gly-708 in TaaP were indispensable for trimerization and activity. AipA and TaaP individually offered advantages to P. mirabilis in a murine model. This is the first report characterizing trimeric autotransporters in P. mirabilis as afimbrial surface adhesins and autoagglutinins.
Infection and immunity 11/2010; 78(11):4882-94. · 4.21 Impact Factor
