Germán Bou

Complejo Hospitalario Universitario a Coruña (CHUAC), La Corogne, Galicia, Spain

Are you Germán Bou?

Claim your profile

Publications (148)572.45 Total impact

  • [Show abstract] [Hide abstract]
    ABSTRACT: Acinetobacter baumannii is an extracellular opportunistic human pathogen that is becoming increasingly problematic in hospitals. In the present study, we demonstrated that the A. baumannii Omp33-36 KDa protein (Omp33-36) is a porin that acts as a channel for the passage of water. The protein is found on the cell surface and is released along with other porins in the outer membrane vesicles (OMVs). In immune and connective cell tissue, this protein induced apoptosis by activation of caspases and modulation of autophagy with the consequent accumulation of p62/ SQSTM1 (sequestosome 1) and LC3B–II (confirmed by use of autophagy inhibitors). Blockage of autophagy enables the bacterium to persist intracellularly (inside autophagosomes) with the subsequent development of cytotoxicity. Finally, we used animal models to confirm that Omp33-36 is a virulence factor in A. baumannii. Overall, the study findings show that Omp33-36 plays an important role in the pathogenesis of A. baumannii infections
    Infection and Immunity 09/2014; · 4.07 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: During a Spanish surveillance study, two natural variants of DHA β-lactamases, DHA-6 and DHA-7 were found, with the replacements Ala226Thr and Phe322Ser respect to DHA-1, respectively. The enzymes were isolated from Escherichia coli and Enterobacter cloacae clinical isolates, respectively. The aim of the study was the genetic, microbiological and biochemical characterization of the DHA-6 and DHA-7 β-lactamases. The blaDHA-6 andblaDHA-7 genes were located in I1 and HI2 incompatibility group plasmids of 87.3 and 310.4 kb, respectively. The gene context of both blaDHA-6 andblaDHA-7 was similar to that already described for blaDHA-1 gene and included the qnrB4 and aadA genes. The MICs for cephalothin, aztreonam, cefotaxime and ceftazidime were 8 to 30 fold lower for the DHA-6 than for DHA-1 and DHA-7 expressed in the same isogenic E.coli TG1 strain. Interestingly the MIC for cefoxitin was higher in DHA-6 expressing transformant compared to DHA-1 and DHA-7. Biochemical studies with pure β-lactamases revealed a slightly lower catalytic efficiency of DHA-6 against cephalothin, ceftazidime and cefotaxime compared to DHA-1 and DHA-7. To understand this behavior, stability experiments were carried out and showed that the DHA-6 protein displayed a significantly higher stability than DHA-1 and DHA-7 enzymes. The proximity of Thr226 to the N-terminal in the tertiary protein structure in DHA-6 may promote this stabilization and consequently could induce a slight reduction of the dynamic of this enzyme primarily affecting the hydrolysis of some of the bulkiest antibiotics.
    Antimicrobial Agents and Chemotherapy 08/2014; · 4.57 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Acinetobacter baumannii is one of the most important antibiotic-resistant nosocomial bacteria. We investigated changes in the clinical and molecular epidemiology of A. baumannii over a 10-year period. We compared the data from 2 prospective multicenter cohort studies in Spain, one performed in 2000 (183 patients) and one in 2010 (246 patients), which included consecutive patients infected or colonized by A. baumannii. Molecular typing was performed by repetitive extragenic palindromic polymerase chain reaction (REP-PCR), pulsed-field gel electrophoresis (PFGE), and multilocus sequence typing (MLST).The incidence density of A. baumannii colonization or infection increased significantly from 0.14 in 2000 to 0.52 in 2010 in medical services (p < 0.001). The number of non-nosocomial health care-associated cases increased from 1.2% to 14.2%, respectively (p < 0.001). Previous exposure to carbapenems increased in 2010 (16.9% in 2000 vs 27.3% in 2010, p = 0.03). The drugs most frequently used for definitive treatment of patients with infections were carbapenems in 2000 (45%) and colistin in 2010 (50.3%). There was molecular-typing evidence of an increase in the frequency of A. baumannii acquisition in non-intensive care unit wards in 2010 (7.6% in 2000 vs 19.2% in 2010, p = 0.01). By MSLT, the ST2 clonal group predominated and increased in 2010. This epidemic clonal group was more frequently resistant to imipenem and was associated with an increased risk of sepsis, although not with severe sepsis or mortality.Some significant changes were noted in the epidemiology of A. baumannii, which is increasingly affecting patients admitted to conventional wards and is also the cause of non-nosocomial health care-associated infections. Epidemic clones seem to combine antimicrobial resistance and the ability to spread, while maintaining their clinical virulence.
    Medicine. 07/2014; 93(5):202-210.
  • [Show abstract] [Hide abstract]
    ABSTRACT: Bacteria that produce extended-spectrum β-lactamases (ESBLs) are an increasing health care problem and their rapid detection is a challenge that must be overcome in order to optimize antimicrobial treatment and patient care. Matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry (MS) has been used to determine resistance to β-lactams including carbapenems in Enterobacteriaceae, but methodology has not been fully validated as it remains time-consuming. We aimed to assess whether MALDI-TOF can be used to detect ESBL-producing Enterobacteriaceae from positive blood culture bottles in clinical practice. In the assay, 141 blood cultures were tested, 13 out of them were real bacteremias and 128 corresponded to blood culture bottles seeded with bacterial clinical isolates. Bacteremias were analyzed by MALDI-TOF after a positive growth result and the 128 remaining blood cultures 24 hours after the bacterial seeding. β-lactamase activity was determined through the profile of peaks associated to the antibiotics cefotaxime and ceftazidime and its hydrolyzed forms. Clavulanic acid was added to rule out the presence of non-ESBL mechanisms. Overall data show a 99% (103 out of 104) of sensitivity in detecting ESBL in positive blood cultures, respectively. Data were obtained in 90 min (maximum 150 min). Validation of the proposed methodology has a great impact in the early detection of ESBL-producing Enterobacteriaceae from positive blood cultures being a rapid and efficient method and allowing a more appropriate antibiotic therapy administration earlier. This article is protected by copyright. All rights reserved.
    Clinical Microbiology and Infection 06/2014; · 4.58 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: A carbapenem-resistant A. pittii strain carrying an OXA-24-like enzyme was isolated in Northern Spain in 2008. Sequence analysis confirmed the presence of the novel blaOXA-207 gene flanked by the site-specific XerC/XerD-like recombination binding sites and showing a unique Gly222Val substitution compared to OXA-24. Cloning and kinetic analysis showed that OXA-207 presents a reduction in the catalytic efficiency against carbapenems and a noticeably increase for oxacillin.
    Antimicrobial Agents and Chemotherapy 06/2014; · 4.57 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Two natural variants of ADC-type β-lactamases of Acinetobacter spp., ADC-1 and ADC-5, differ by nine mutations in their protein sequence. ADC-5 hydrolyses cefoxitin better than ADC-1 and the opposite is true for ceftazidime. We produced single and combined mutations in ADC-5 and characterized the variants microbiologically and biochemically to determine which amino acid residues are involved in the hydrolysis of β-lactam antibiotics in this family of β-lactamases.
    Journal of Antimicrobial Chemotherapy 05/2014; · 5.34 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Background Cytomegalovirus (CMV)-negative recipients of a graft from a CMV-positive donor (D+/R−) are at high risk of CMV disease. Current preventive strategies include universal prophylaxis (UP) and preemptive therapy (PT). However, the best strategy to prevent CMV disease and achieve better long-term outcomes remains a matter of debate.Methods We analyzed the incidence of CMV disease and long-term outcomes including graft dysfunction and patient mortality at 5 years after transplantation with both preventive strategies. High-risk (D+/R−) kidney and liver transplant recipients from the RESITRA cohort were included.ResultsOf 2410 kidney or liver transplant patients, 195 (8.3%) were D+/R−. The final cohort included 58 liver and 102 kidney recipients. UP was given in 92 patients and 68 received PT; 10.9% and 36.8% developed CMV disease, respectively (P < 0.01). The independent risk factors for CMV disease were PT strategy (hazard ratio [HR], 3.30; 95% confidence interval [CI], 1.6–6.9), kidney transplantation (HR, 3.8; 95% CI, 1.4–9.9), and cyclosporine immunosuppression (HR, 2.4; 95% CI, 1.2–4.7). PT strategy was also a risk factor for CMV disease in both liver transplantation (HR, 11.0; 95% CI, 1.2–98.7) and kidney transplantation (HR, 2.7; 95% CI, 1.3–6.0), independently. The development of CMV replication during the first 2 years after transplantation was a risk factor for graft dysfunction at 5 years after transplantation (odds ratio, 3.4; 95% CI, 1.3–9.0). Nevertheless, no significant differences were seen in either graft dysfunction or mortality between the 2 strategies.Conclusions The study supports the benefit of the UP strategy to prevent CMV disease in D+/R− liver or kidney transplant patients. The development of CMV replication during the first 2 years after transplantation was associated with graft dysfunction at 5 years after transplantation.
    Transplant Infectious Disease 05/2014; · 1.98 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: In a previous prospective multicenter study in Spain, we found that OXA-1 and inhibitor resistant TEM (IRT) β-lactamases constitute the most common plasmid-borne mechanisms of genuine amoxicillin-clavulanate (AMC) resistance in E. coli. In the present study, we investigated the population structure and virulence traits of clinical AMC-resistant E. coli expressing OXA-1 or IRT and compared these traits to those in a control group of clinical AMC-susceptible E. coli. All OXA-1- (n=67) and IRT- (n=45) producing isolates were matched by geographical and temporal origin to the AMC-susceptible control set (n=56). We performed multilocus sequence typing and phylogenetic groups characterization for each isolate and then studied the presence of 49 virulence factors (VF) by PCR and sequencing. The most prevalent clone detected was distinct for each group: C/ST88 was most common in OXA-1 producers, B2/ST131 in IRT producers, and B2/ST73 in AMC-susceptible isolates. The median of isolates per sequence type (ST) were 3.72 in OXA-1 producers, 2.04 in IRT-producers, and 1.69 in AMC-susceptible isolates; the proportions of STs represented by one unique isolate were 19.4%, 31.1%, and 48.2%, respectively. The sum of all VFs detected, calculated as a virulence score, was significantly higher in AMC-susceptible isolates compared with OXA-1and IRT producers (mean, 12.5 versus. 8.3 and 8.2 respectively). Our findings suggest that IRT and OXA-1 producing E. coli isolates resistant to AMC have a different and less diverse population structure than AMC-susceptible clinical E. coli isolates. The AMC-susceptible population also contains more VF than AMC-resistant isolates.
    Antimicrobial Agents and Chemotherapy 04/2014; · 4.57 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: The emergence and spread of carbapenemase-producing Enterobacteriaceae (CPE), as the current paradigm of extensive drug-resistance and multi-drug resistance to antibiotics, is a serious threat to patient health and public health. The increase in OXA-48- and VIM-1-producing Klebsiella pneumoniae isolates represents the greatest impact of CPE in Spain. This evidence has lead the members of a representative panel of the Spanish Study Groups of Nosocomial Infections and Mechanisms of Action and Resistance to Antimicrobials of the Spanish Society of Clinical Microbiology and Infectious Diseases (GEIH/GEMARA-SEIMC) to make a position statement expressing the need for: (i) definitive and coordinated action by all health professionals and authorities involved, and (ii) an adaptation of health systems to facilitate their early control and minimize their impact.
    Enfermedades Infecciosas y Microbiología Clínica 04/2014; · 1.48 Impact Factor
  • Source
    Journal of Antimicrobial Chemotherapy 04/2014; · 5.34 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: In the current study, the Ser/Thr/Tyr phosphoproteomes of two Acinetobacter baumannii strains, reference (ATCC17978) and highly invasive multidrug-resistant clinical isolate (Abh12O-A2) were analyzed using SCX and TiO2 chromatography followed by high resolution mass spectrometry. We detected a total of 201 unique phosphorylation sites (p-sites), and, after manual validation of peptide spectra, 91 high-confidence phosphorylation events (p-events) could be localized to a specific amino acid residue. The percentage distribution of Ser/Thr/Tyr phosphorylation was 68.9% on serine, 24.1% on threonine and 5.2% on tyrosine in ATCC17978, and 70.8% on serine, 25.2% on threonine and 3.8% on tyrosine in AbH12O-A2. Across all identified p-sites, 11 were identified in ATCC17978 only, while 43 were identified in Abh12O-A2 only, and 37 overlapped between the two strains. Here for the first time we describe the phosphoproteome of A. baumanii, and significance of selected phosphorylation sites is discussed in the context of stress/starvation, pathogenicity and drug resistance. It is now well established that protein phosphorylation on Ser/Thr/Tyr residues is an important post-translational modification in bacteria. Herein we employed SCX and TiO2 chromatographic phosphopeptide enrichment combined with LTQ-Orbitrap mass spectrometric analyses to characterize and establish a qualitative comparison between the Ser/Thr/Tyr phosphoproteomes of two Acinetobacter baumannii strains: a reference strain and a highly invasive multidrug-resistant clinical isolate. We highlight the identification of phosphoproteins with a role in pathogenicity and those involved in drug resistance.
    Journal of proteomics 03/2014; · 5.07 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Carbapenem-resistant Acinetobacter baumannii (CRAb) is a major source of nosocomial infections in Spain associated with the production of OXA-58-like or OXA-24/40-like β-lactamase enzymes. We analysed the plasmids carrying the blaOXA-24/40-like gene in CRAb isolates obtained a decade apart.
    Journal of Antimicrobial Chemotherapy 03/2014; · 5.34 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Introduction. Acinetobacter baumannii is one of the most important antibiotic-resistant, nosocomial bacteria. We investigated changes in the clinical and molecular epidemiology of A. baumannii over a 10 year period. Methods. We compared the data from two prospective multicenter cohort studies performed in 2000 (183 patients) and 2010 (246 patients) in Spain, which included consecutive patients infected or colonized by A. baumannii. Molecular typing was performed by REP-PCR, PFGE and MSLT. Results. The incidence density of A. baumannii colonization or infection increased significantly from 0.14 to 0.52 in medical services (p<0.001). The number of non-nosocomial healthcare-associated cases increased from 1.2% to 14.2% (p<0.001). Previous exposure to carbapenems increased in 2010 (16.9 vs 27.3%, p=0.03). The drugs most frequently used for definitive treatment of patients with infections were carbapenems in 2000 (45%) and colistin in 2010 (50.3%). There was molecular-typing evidence of an increase in the frequency of A. baumannii acquisition in non-intensive care unit (ICU) wards in 2010 (7.6% vs 19.2%, p=0.01). By MSLT, the ST2 clonal group predominated and increased in 2010. This epidemic clonal group was more frequently resistant to imipenem and was associated with an increased risk of sepsis, although not with severe sepsis or mortality. Conclusions. Some significant changes were noted in the epidemiology of A. baumannii, which is increasingly affecting patients admitted to conventional wards and is also the cause of non-nosocomial healthcare-associated infections. Epidemic clones seem to combine antimicrobial resistance and the ability to spread, while maintaining their clinical virulence.
    Medicine 02/2014; · 4.35 Impact Factor
  • Germán Bou
    Enfermedades Infecciosas y Microbiología Clínica 12/2013; · 1.48 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: The role of Acinetobacter baumannii ATCC 17978 UmuDC homologs A1S_0636-A1S_0637, A1S_1174-A1S_1173, and A1S_1389 (UmuDAb) in antibiotic resistance acquired through UV-induced mutagenesis was evaluated. Neither the growth rate nor the UV-related survival of any of the three mutants was significantly different from the wild-type parental strain. However, all mutants, and especially the umuDAb mutant, were less able to acquire resistance to rifampin and streptomycin through the activities of their error-prone DNA polymerases. Furthermore, in the A. baumannii mutant defective in the umuDAb gene the spectrum of mutations included a dramatic reduction in the frequency of transition mutations, the mutagenic signature of the DNA polymerase V encoded by umuDC.
    Antimicrobial Agents and Chemotherapy 12/2013; · 4.57 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Carbapenem-resistant Acinetobacter baumannii isolates were obtained from 50 patients between July 2011 and July 2012 at the University Hospital A Coruña (NW Spain). These multidrug-resistant isolates, which belonged to a single clone, remained only susceptible to tigecycline, minocycline, and colistin and produced the carbapenem-hydrolyzing oxacillinase, OXA-23. This is the first reported outbreak of OXA-23-producing A. baumannii isolates in Spain.
    Microbial drug resistance (Larchmont, N.Y.) 12/2013; · 1.99 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Desiccation tolerance contributes to the maintenance of bacterial populations in hospital settings and may partly explain its propensity to cause outbreaks. Identification and relative quantitation of proteins involved in bacterial desiccation tolerance was made using label free quantitation and iTRAQ labelling. Under desiccating conditions, the population of the Acinetobacter baumannii clinical strain AbH12O-A2 decreased in the first week, and thereafter a stable population of 0.5% of the original population was maintained. Using label-free quantitation and iTRAQ labelling, 727 and 765 proteins, respectively, were detected; 584 of them by both methods. Proteins overexpressed under desiccation included membrane and periplasmic proteins. Proteins associated with antimicrobial resistance, efflux pumps and quorum quenching were overexpressed in the samples subjected to desiccation stress. Electron microscopy revealed clear morphological differences between desiccated and control bacteria. We conclude that A. baumannii is able to survive long periods of desiccation through the presence of cells in a dormant state, via mechanisms affecting control of cell cycling, DNA coiling, transcriptional and translational regulation, protein stabilization, antimicrobial resistance and toxin synthesis, and that a few surviving cells embedded in a biofilm matrix are able to resume growth and restore the original population in appropriate environmental conditions following a "bust-and-boom" strategy.
    Journal of Proteome Research 12/2013; · 5.06 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Class C β-lactamases are prevalent among Enterobacteriaceae; however, these enzymes are resistant to inactivation by commercially available β-lactamase inhibitors. In order to find novel scaffolds to inhibit class C β-lactamases, the comparative efficacy of monocyclic β-lactam antibiotics (aztreonam and the siderophore monosulfactam BAL30072), the bridged monobactam β-lactamase inhibitor BAL29880, and carbapenems (imipenem, meropenem, doripenem and ertapenem) were tested in kinetic assays against FOX-4, a plasmid-mediated class C β-lactamase (pmAmpC). The FOX-4 β-lactamase was purified. Steady-state kinetics, electrospray ionization mass spectrometry (ESI-MS) and ultraviolet difference (UVD) spectroscopy were conducted using the β-lactam scaffolds described. The Ki values for the monocyclic β-lactams against FOX-4 β-lactamase were 0.04 ± 0.01 μM (aztreonam) and 0.66 ± 0.03 μM (BAL30072), and the Ki value for the bridged monobactam BAL29880 was 8.9 ± 0.5 μM. For carbapenems, the Ki values ranged from 0.27 ± 0.05 μM (ertapenem) to 2.3 ± 0.3 μM (imipenem). ESI-MS demonstrated the formation of stable covalent adducts when the monocyclic β-lactams and carbapenems were reacted with FOX-4 β-lactamase. UVD spectroscopy suggested the appearance of different chromophoric intermediates. Monocyclic β-lactam and carbapenem antibiotics are effective mechanism-based inhibitors of FOX-4 β-lactamase, a clinically important pmAmpC, and provide stimulus for the development of new inhibitors to inactivate plasmidic and chromosomal class C β-lactamases.
    Journal of Antimicrobial Chemotherapy 11/2013; · 5.34 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Two mechanisms of resistance to colistin have been described in Acinetobacter baumannii. One involves complete loss of LPS, resulting from mutations in lpxA, lpxC or lpxD, and the second is associated with phosphoethanolamine addition to LPS, mediated through mutations in pmrAB. In order to assess the clinical impact of both resistance mechanisms, A. baumannii ATCC19606 and its isogenic derivatives, AL1851 ΔlpxA, AL1852 ΔlpxD, AL1842 ΔlpxC and ATCC 19606 pmrB, were analyzed for in vitro growth rate, in vitro and in vivo competitive growth, infection of A549 respiratory alveolar epithelial cells, virulence in the Caenorhabditis elegans model and virulence in a systemic mouse infection model. The in vitro growth rate of the lpx mutants was clearly diminished; furthermore, in vitro and in vivo competitive growth experiments revealed a reduction in fitness for both mutant types. Infection of A549 cells with ATCC19606 or the pmrB mutant resulted in higher loss of viability than with lpx mutants. Finally, the lpx mutants were highly attenuated in both the C. elegans and mouse infection models while the pmrB mutant was only attenuated in the C. elegans model. In summary, while colistin resistance in A. baumannii confers a clear selective advantage in presence of colistin treatment, it causes a noticeable cost in terms of overall fitness and virulence, with a more striking reduction associated with LPS loss than with phosphoethanolamine addition. Therefore, we hypothesize that colistin resistance mediated by changes in pmrAB will be more likely to arise in clinical settings in patients treated with colistin.
    Antimicrobial Agents and Chemotherapy 11/2013; · 4.57 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were either related to prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuDAb gene specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with a similar palindromic sequence recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the A. baumannii umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic-DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA-damage response in A. baumannii.
    Journal of bacteriology 10/2013; · 3.94 Impact Factor

Publication Stats

2k Citations
572.45 Total Impact Points

Institutions

  • 2008–2014
    • Complejo Hospitalario Universitario a Coruña (CHUAC)
      La Corogne, Galicia, Spain
    • Hospital do Meixoeiro
      Vigo, Galicia, Spain
  • 2012–2013
    • Instituto de Salud Carlos III
      Madrid, Madrid, Spain
    • Hospital General Universitario Gregorio Marañón
      • Servicio de Microbiología
      Madrid, Madrid, Spain
    • Centro De Biología Molecular Severo Ochoa
      Madrid, Madrid, Spain
    • Hospital Universitari Son Espases
      • Department of Microbiology
      Palma, Balearic Islands, Spain
  • 2010–2013
    • Autonomous University of Barcelona
      • Department of Genetics and Microbiology
      Cerdanyola del Vallès, Catalonia, Spain
    • Complexo Hospitalario Universitario A Coruña
      La Corogne, Galicia, Spain
    • Instituto de Investigación Biomédica de A Coruña
      La Corogne, Galicia, Spain
    • Hospital Universitario Marques de Valdecilla
      • Servicio de Microbiología
      Santander, Cantabria, Spain
  • 2004–2013
    • Hospital Universitario Virgen Macarena
      Hispalis, Andalusia, Spain
  • 2004–2012
    • Universidad de Sevilla
      • • Instituto de Biomedicina de Sevilla (IBIS)
      • • Departamento de Microbiología
      Hispalis, Andalusia, Spain
    • Hospital Clínic de Barcelona
      • Servicio de Microbiología
      Barcino, Catalonia, Spain
  • 2011
    • University of the Balearic Islands
      Palma, Balearic Islands, Spain
    • Hospital Universitario 12 de Octubre
      Madrid, Madrid, Spain
    • University of Zaragoza
      • Department of Biochemistry and Molecular and Cellular Biology
      Caesaraugusta, Aragon, Spain
  • 2010–2011
    • Conselleria de Sanidade
      La Corogne, Galicia, Spain
    • Hospital Universitario Virgen del Rocío
      • Servicio de Enfermedades Infecciosas
      Hispalis, Andalusia, Spain
  • 2007–2011
    • University Hospital Vall d'Hebron
      Barcino, Catalonia, Spain
  • 2003–2010
    • University of A Coruña
      La Corogne, Galicia, Spain
  • 2009
    • Universidad Autónoma de Madrid
      Madrid, Madrid, Spain
  • 2001
    • Mayo Foundation for Medical Education and Research
      • Division of Infectious Diseases
      Scottsdale, AZ, United States
    • Hospital Universitari de Bellvitge
      l'Hospitalet de Llobregat, Catalonia, Spain
  • 1999–2001
    • Hospital Universitario Ramón y Cajal
      Madrid, Madrid, Spain