R Uma Shaanker

University of Agricultural Sciences, Dharwad, Hubli, State of Karnataka, India

Are you R Uma Shaanker?

Claim your profile

Publications (64)122.38 Total impact

  • Article: Isolation of endophytic bacteria producing the anti-cancer alkaloid camptothecine from Miquelia dentata Bedd. (Icacinaceae).
    [show abstract] [hide abstract]
    ABSTRACT: Camptothecine (CPT), a quinoline alkaloid, is a potent inhibitor of eukaryotic topoisomerase I. Because of this activity, several semi-synthetic derivatives of CPT are in clinical use against ovarian and small lung cancers. Together with its derivatives, CPT is the third largest anti-cancer drug in the world market. CPT is produced by several plant species belonging to the Asterid clade. In the recent past, several studies have reported the production of CPT by endophytic fungal associates of some of these plant species. In this paper, we report the production of CPT by endophytic bacteria isolated from Miquelia dentata Bedd. (Icacinaceae). Besides CPT, the bacteria also produced 9-methoxy CPT (9-MeO-CPT), in culture, independent of the host tissue. The chemical nature of CPT and 9-MeO-CPT was determined by LC-MS and ESI-MS/MS analysis, and was shown to be similar to that produced by the host tissue. One of the bacterial isolates examined, showed indications of attenuation of CPT production through sub-culture. This is the first report of production of CPT by endophytic bacteria. The identity of the bacteria was ascertained by Gram staining and 16s rRNA sequencing. We discuss the possible mechanisms that might be involved in the synthesis of CPT by endophytic bacteria.
    Phytomedicine: international journal of phytotherapy and phytopharmacology 05/2013; · 2.17 Impact Factor
  • Source
    Article: c Indian Academy of Sciences Changes in genetic diversity parameters in unimproved and improved populations of teak (Tectona grandis L.f.) in Karnataka state, India
    [show abstract] [hide abstract]
    ABSTRACT: 2013 Change in genetic parameters in unimproved and improved populations of teak (Tectona grandis L.f.) in India. J. Genet. 92, xx–xx]
    Journal of Genetics 04/2013; 92. · 1.09 Impact Factor
  • Article: Changes in genetic diversity parameters in unimproved and improved populations of teak (Tectona grandis L.f.) in Karnataka state, India
    [show abstract] [hide abstract]
    ABSTRACT: 2013 Change in genetic parameters in unimproved and improved populations of teak (Tectona grandis L.f.) in India. J. Genet. 92, xx–xx]
    Journal of Genetics 04/2013; 92(1). · 1.09 Impact Factor
  • Article: Changes in genetic diversity parameters in unimproved and improved populations of teak (Tectona grandis L.f.) in Karnataka state, India.
    Journal of Genetics 04/2013; 92(1):141-5. · 1.09 Impact Factor
  • Article: New plant sources of the anti-cancer alkaloid, camptothecine from the Icacinaceae taxa, India.
    [show abstract] [hide abstract]
    ABSTRACT: In this study, the production of camptothecine and its derivatives, in thirteen species of the family Icacinaceae, namely, Apodytes dimidiata, Codiocarpus andamanicus, Gomphandra comosa, Gomphandra coriacea, Gomphandra polymorpha, Gomphandra tetrandra, Iodes cirrhosa, Iodes hookeriana, Miquelia dentata, Miquelia kleinii, Natsiatum herpeticum, Pyrenacantha volubilis and Sarcostigma kleinii is reported. Seeds of M. dentata were found to produce the highest content of camptothecine (1.0-1.4% by dry weight of seeds). Full scan LC-MS and ESI-MS/MS analysis of M. dentata revealed, besides camptothecine, a number of other derivatives, namely, 10-hydroxycamptothecine, 9-methoxycamptothecine, 20-deoxycamptothecine. Crude extract preparations of the seeds of M. dentata were effective against a breast cancer cell line (IC50=3.82μg/ml for MDA MB273 cell lines) and two ovarian cancer cell lines (IC50=2.8μg/ml for NCI/ADR-RES and 4.5μg/ml for SKOV). These results are the first reports of camptothecine and its derivatives in these species and offer rich alternative plant sources for the anticancer compound, camptothecine.
    Phytomedicine: international journal of phytotherapy and phytopharmacology 03/2013; · 2.17 Impact Factor
  • Article: DO ENDOPHYTIC FUNGI POSSESS PATHWAY GENES FOR PLANT SECONDARY METABOLITES?
    Current science 01/2013; · 0.94 Impact Factor
  • Article: Development of eleven microsatellite markers in the red-listed tree species Myristica malabarica
    [show abstract] [hide abstract]
    ABSTRACT: The Myristicaceae family is a primitive angiosperm family and is characterized by species that are highly endemic to the Western Ghats area of India. Myristica malabarica is confined to the evergreen forests of Western Ghats and Sri Lanka. In this paper we describe for the first time the development of eleven polymorhpic microsatellite markers for Myristica malabarica, which had 2–14 alleles per locus. These microsatellite markers could be used to study the population genetic structure of the species. KeywordsMicrosatellite-Conservation genetics- Myristica malabarica -Endangered species-Western Ghats
    Conservation Genetics Resources 04/2012; 2:305-307. · 0.49 Impact Factor
  • Article: Hepatoprotective activity of Indian Phyllanthus.
    [show abstract] [hide abstract]
    ABSTRACT: Phyllanthus (Euphorbiaceae) species are traditionally well-known for their medicinal properties including hepatoprotective activity. The study assessed the hepatoprotective and antioxidant activities of 11 Phyllanthus species, P. amarus Schumach., P. urinaria L., P. debilis Klein ex Willd, P. tenellus Roxb., P. virgatus G. Forst., P. maderaspatensis L., P. reticulatus Poir., P. polyphyllus Willd., P. emblica L., P. indofischerii Bennet. and P. acidus (L.) Skeels. The dried leaves and stems of each plant species were extracted in methanol and successively in water. The extracts were screened for hepatoprotective activity at a concentration of 50 µg/mL against tert-butyl hydroperoxide (t-BH) induced toxicity in HepG2 cells. Seven extracts from five species that showed hepatoprotective activity were assessed for their 50% effective concentration (EC(50)) values and their antioxidant activity using a DPPH assay. Phyllanthin and hypophyllanthin contents were also determined in these Phyllanthus species. The methanol extracts of P. polyphyllus, P. emblica and P. indofischeri showed high levels of hepatoprotective activity with EC(50) values of 12, 19 and 28 µg/mL and IC(50) of 3.77, 3.38 and 5.8 µg/mL for DPPH scavenging activity respectively against an IC(50) of 3.69 µg/mL for ascorbic acid. None of these activities could be attributed to phyllanthin and hypophyllanthin. The hepatoprotective and antioxidant activities of P. indofischeri are demonstrated for the first time in literature. The study also confirms the hepatoprotective and antioxidant activities of leaves of P. emblica and P. polyphyllus. The molecule(s) responsible for the activities is being investigated.
    Pharmaceutical Biology 04/2012; 50(8):948-53. · 0.88 Impact Factor
  • Article: Stylish lengths: mate choice in flowers.
    [show abstract] [hide abstract]
    ABSTRACT: The styles of flowers may represent an arena for pollen competition in the race to fertilize ovules. Accordingly, selection should favour a longer 'race' to better discriminate among variable pollen by increasing style length. Sampling across a taxonomically diverse range of wild and outcrossed species, we found that the distribution of style lengths within plants were skewed towards longer styles, as predicted. In self-pollinated domesticated species, where discrimination among pollen is less important, we found no such pattern. We conclude that style length is under directional selection towards longer styles as a mechanism for mate choice among pollen of variable quality.
    Journal of Biosciences 06/2011; 36(2):229-34. · 1.65 Impact Factor
  • Article: Biodiversity and chemodiversity: future perspectives in bioprospecting.
    [show abstract] [hide abstract]
    ABSTRACT: Biological diversity and its constituent chemical diversity have served as one of the richest sources of bioprospecting leading to the discovery of some of the most important bioactive molecules for mankind. Despite this excellent record, in the recent past, however, bioprospecting of biological resources has met with little success; there has been a perceptible decline in the discovery of novel bioactive compounds. Several arguments have been proposed to explain the current poor success in bioprospecting. Among them, it has been argued that to bioprospect more biodiversity may not necessarily be productive, considering that chemical and functional diversity might not scale with biological diversity. In this paper, we offer a critique on the current perception of biodiversity and chemodiversity and ask to what extent it is relevant in the context of bioprospecting. First, using simple models, we analyze the relation among biodiversity, chemodiversity and functional redundancies in chemical plans of plants and argue that the biological space for exploration might still be wide open. Second, in the context of future bioprospecting, we argue that brute-force high throughput screening approaches alone are insufficient and cost ineffective in realizing bioprospecting success. Therefore, intelligent or non-random approaches to bioprospecting need to be adopted. We review here few examples of such approaches and show how these could be further developed and used in the future to accelerate the pace of discovery.
    Current drug targets 05/2011; 12(11):1515-30. · 3.93 Impact Factor
  • Article: Sequestration of camptothecin, an anticancer alkaloid, by chrysomelid beetles.
    [show abstract] [hide abstract]
    ABSTRACT: Camptothecin (CPT), a monoterpene indole alkaloid, is a potent inhibitor of eukaryotic toposiomerase-I. Several derivatives of CPT are in clinical use against ovarian and lung cancers. CPT has been reported from several plant species belonging to the order Asterids, with the highest concentration in Nothapodytes nimmoniana (family Icacinaceae). In this paper, we report an intriguing observation of chrysomelid beetles (Kanarella unicolor Jacobby) feeding on the leaves of N. nimmoniana without any apparent adverse effect. LC-MS/MS analysis of the beetles indicated that 54.9% of the ingested CPT's was recovered from the wings, followed by lesser amounts in the head and abdomen. LC-HRMS analysis revealed that most of the CPT in the insect body was in the parental form available in the plants without any major metabolizable products, including sulfated and glucuronilated forms. The mechanism by which the beetles are able to tolerate substantially high levels of CPT in their body tissue is under investigation.
    Journal of Chemical Ecology 05/2011; 37(5):533-6. · 2.66 Impact Factor
  • Source
    Article: Sequestration of Camptothecin, an Anticancer Alkaloid, by Chrysomelid Beetles
    [show abstract] [hide abstract]
    ABSTRACT: Camptothecin (CPT), a monoterpene indole alkaloid, is a potent inhibitor of eukaryotic toposiomerase-I. Several derivatives of CPT are in clinical use against ovarian and lung cancers. CPT has been reported from several plant species belonging to the order Asterids, with the highest concentration in Nothapodytes nimmoniana (family Icacinaceae). In this paper, we report an intriguing observation of chrysomelid beetles (Kanarella unicolor Jacobby) feeding on the leaves of N. nimmoniana without any apparent adverse effect. LC-MS/MS analysis of the beetles indicated that 54.9% of the ingested CPT's was recovered from the wings, followed by lesser amounts in the head and abdomen. LC-HRMS analysis revealed that most of the CPT in the insect body was in the parental form available in the plants without any major metabolizable products, including sulfated and glucuronilated forms. The mechanism by which the beetles are able to tolerate substantially high levels of CPT in their body tissue is under investigation.
    Journal of Chemical Ecology 04/2011; · 2.66 Impact Factor
  • Article: Influence of geographic distance and genetic dissimilarity among clones on flowering synchrony in a Teak (Tectona grandis Linn. f) clonal seed orchard By N. LYNGDOH, R. P. GUNAGA, GEETA JOSHI, R.VASUDEVA, G. RAVIKANTHand R. UMA SHAANKER
    [show abstract] [hide abstract]
    ABSTRACT: Influence of genetic dissimilarity among teak (Tectona grandis Linn. f.) clones on flowering synchrony was studied in a Clonal Seed Orchard (CSO) of teak in Karnataka, Southern India. Flowering phenology was monitored for all the 24 teak clones of the CSO and flowering synchrony between clones was assessed adopting a novel ‘overlap index’. Genetic dissimilarity among these clones was assessed adopting DNA based ISSR (Inter Simple Sequence Repeats) analysis. Large variation in the time of ‘flower initiation’ and of ‘peak flowering initiation’ was observed among the clones belonging to diverse sources, suggesting large asynchronous flowering. Cluster analysis based on ISSR marker indicated that the clones originating from a same source clustered together and there was a clear segregation based on their origin. Correlation analysis revealed a significant negative association between the average Jaccards’s dissimilarity index between pairs of clones and average peak flowering overlap index. Clones from geographically diverse regions had high genetic dissimilarity and also showed high flowering asynchrony within them.
    Silvae Genetica 01/2011; 61(1 & 2). · 0.78 Impact Factor
  • Article: Influence of levels of genetic diversity on fruit quality in teak (Tectona grandis L.f.)
    [show abstract] [hide abstract]
    ABSTRACT: The study on the influence of genetic diversity on the fruit emptiness and seed germination (as a measure of fruit quality) of teak populations was carried out. The populations comprised three unimproved plantations, three seed-production areas and a clonal seed orchard within Karnataka. Significant variation between the populations was observed for fruit emptiness, seed germination and Jaccard's dissimilarity index of the parent population. Genetic dissimilarity of popula-tions was positively correlated to fruit emptiness and negatively correlated to seed germination. It is in-ferred that higher genetic dissimilarity of individuals within the population results in higher flower asyn-chrony and close-related mating, thereby leading to higher inbreeding depression manifested in the form of higher emptiness and low germination percentage.
    Current science 01/2011; · 0.94 Impact Factor
  • Chapter: Genetic Resources of Phyllanthus in Southern India: Identification of Geographic and Genetic Hot Spots and Its Implication for Conservation
    01/2011: pages 393; , ISBN: 9781439821442
  • Source
    Article: The Spatial Distribution of Mistletoe in a Southern Indian Tropical Forest at Multiple Scales
    Lucy Rist, R. Uma Shaanker, Jaboury Ghazoul
    [show abstract] [hide abstract]
    ABSTRACT: Taxillus tomentosus is a mistletoe of significant management concern in southern India. This mistletoe affects the productivity of several nontimber forest products, most significantly Amla (Phyllanthus emblica and Phyllanthus indofischeri), whose fruits provide an important source of income for indigenous forest communities. Management interventions are required to secure the continued viability of Amla and thereby its role in livelihoods. To enhance the scientific basis for management, we characterized the distribution of T. tomentosus at three scales, examined potential mechanisms underlying this distribution, and compared both with those documented in other habitats. Mistletoes were aggregated at all three scales: on individual trees, within forest plots of 500 m2, and at scales of 3–4 km. Seed deposition patterns provide an initial distribution ‘template’ that largely determines patterns at tree and plot scales. This initial pattern is subsequently altered as variation in host suitability and mistletoe mortality from forest fires influence establishment success and postestablishment survival. Local prevalence of infection contributed most to infection spread, and areas of high infection prevalence are highlighted as appropriate foci for management intervention. Although novel underlying mechanisms and variation in the scale of aggregation have been identified, mistletoe distribution in a tropical forest appears to be shaped by similar forces as those documented previously in temperate systems.
    Biotropica 12/2010; 43(1):50 - 57. · 2.23 Impact Factor
  • Source
    Article: Floral resources, pollinators and fruiting in a threatened tropical deciduous tree
    [show abstract] [hide abstract]
    ABSTRACT: Aims Nothapodytes nimmoniana (Family Icacinaceae) is a deciduous tree species distributed in Asia facing severe population decline. Wood chips from the tree are a source of camptothecin, a globally soughtafter alkaloid with cancer-treating properties, and are harvested unsustainably in natural forests. We studied the pollination ecology of the species and asked if there are constraints in pollination and fruiting success in its natural populations.We also discuss the potential effects of wood extraction on pollinators and reproductive success in the population. Methods The study was carried out during the flowering season in two populations with varying exploitation levels, both located in the Protected Area Network in the Western Ghats of Karnataka State. We assessed floral resource availability and measured pollinator diversity and activity in the canopy from the perspective of the biology of the species. We quantified pollinator abundance and percent fruit set as a function of population density. Important Findings Flowers belong to the fly pollination syndrome and are open to visits by generalists such as Apis dorsata and Trigona iridipennis. Fruiting success did not vary between exploited and unexploited sites, but there was a significant difference in pollinator assemblage. In a lean male flowering year, fruit set was low, suggesting pollen limitation in the population. No fruiting was recorded in the second year at the site where trees were felled soon after the flowering period. We argue that when male floral resources are altered in exploited populations, pollinators of generalist nature may show a shift in foraging pattern. Also, generalist plants may be as susceptible to pollination loss as are specialist plants. The need for outcrossing in the species would probably exacerbate this vulnerability.
    Journal of Plant Ecology 11/2010; · 1.91 Impact Factor
  • Source
    Article: Functional dioecy in Nothapodytes nimmoniana, a distylous species in the Western Ghats
    [show abstract] [hide abstract]
    ABSTRACT: Nothapodytes nimmoniana (Icacinaceae) is a sub-canopy tree species, commercially exploited for its wood chips that yield an anti-tumour alkaloid. The species displays intriguing sexual variation. Apart from the flowers which are comparable to typical thrum and pin morphs of distylous species, some flow-ers show intermediate features. We studied functional gender of the different flower types to assess the sexu-ality of individual plants in two populations in the Biligiri Rangan Hills Wildlife Sanctuary, Western Ghats, India. The species shows functional/cryptic dioecy. Thrum flowers are functionally males, pin flowers are females and intermediate flowers are bisexual with functional pollen and stigma. Apart from male and female plants, a small proportion of plants which are essentially males produces a small number of female and bisexual flowers. We refer to the sexual system in Nothapodytes as subdioecy and it appears to be a transitory stage in the evolution of dioecy from heterostyly.
    Current science 11/2010; 99(10):1444-1448. · 0.94 Impact Factor
  • Source
    Article: Permanent Genetic Resources added to Molecular Ecology Resources Database 1 April 2010 - 31 May 2010.
    [show abstract] [hide abstract]
    ABSTRACT: This article documents the addition of 396 microsatellite marker loci to the Molecular Ecology Resources Database. Loci were developed for the following species: Anthocidaris crassispina, Aphis glycines, Argyrosomus regius, Astrocaryum sciophilum, Dasypus novemcinctus, Delomys sublineatus, Dermatemys mawii, Fundulus heteroclitus, Homalaspis plana, Jumellea rossii, Khaya senegalensis, Mugil cephalus, Neoceratitis cyanescens, Phalacrocorax aristotelis, Phytophthora infestans, Piper cordulatum, Pterocarpus indicus, Rana dalmatina, Rosa pulverulenta, Saxifraga oppositifolia, Scomber colias, Semecarpus kathalekanensis, Stichopus monotuberculatus, Striga hermonthica, Tarentola boettgeri and Thermophis baileyi. These loci were cross-tested on the following species: Aphis gossypii, Sooretamys angouya, Euryoryzomys russatus, Fundulus notatus, Fundulus olivaceus, Fundulus catenatus, Fundulus majalis, Jumellea fragrans, Jumellea triquetra Jumellea recta, Jumellea stenophylla, Liza richardsonii, Piper marginatum, Piper aequale, Piper darienensis, Piper dilatatum, Rana temporaria, Rana iberica, Rana pyrenaica, Semecarpus anacardium, Semecarpus auriculata, Semecarpus travancorica, Spondias acuminata, Holigarna grahamii, Holigarna beddomii, Mangifera indica, Anacardium occidentale, Tarentola delalandii, Tarentola caboverdianus and Thermophis zhaoermii.
    Molecular Ecology Resources 11/2010; 10(6):1098-1105. · 3.06 Impact Factor
  • Article: Assessing species admixtures in raw drug trade of Phyllanthus, a hepato-protective plant using molecular tools.
    [show abstract] [hide abstract]
    ABSTRACT: Phyllanthus (Euphorbiaceae) species are well known for their hepato-protective activity and are used in several ethno-medicines in indigenous health care systems in India. To assess species admixtures in raw drug trade of Phyllanthus using morphological and DNA barcoding tools. Samples of Phyllanthus used in raw drug trade were obtained from 25 shops in southern India. Species admixtures in the samples were assessed by identifying species using morpho-taxonomic keys. These identities were further validated by developing species specific DNA barcode signatures using the chloroplast DNA region, psbA-trnH. DNA from the market samples were extracted and amplified using the forward (psbAF - GTTATGCATGAACGTAATGCTC) and reverse primer (trnHR - CGCGCATGGTGGATTCACAAATC). The amplified products were sequenced at Chromous Biotech India, Bangalore. The sequences were manually edited using Chromas Lite. Species identities were established by constructing a neighbor-joining tree using MEGA V 4.0. Morphological analysis of market samples revealed six different species of Phyllanthus in the trade samples. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different species of Phyllanthus namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus maderaspatensis, and Phyllanthus kozhikodianus. All identities, except those for Phyllanthus fraternus, were further confirmed by the species specific DNA barcode using chloroplast region psbA-trnH. Our results show that market samples of Phyllanthus sold in southern India contain at least six different species, though among them, Phyllanthus amarus is predominant. DNA barcode, psbA-trnH region of the chloroplast can effectively discriminate Phyllanthus species and hence can be used to resolve species admixtures in the raw drug trade of Phyllanthus.
    Journal of ethnopharmacology 05/2010; 130(2):208-15. · 2.32 Impact Factor

Institutions

  • 1996–2013
    • University of Agricultural Sciences, Dharwad
      Hubli, State of Karnataka, India
  • 1984–2012
    • University of Agricultural Sciences, Bangalore
      • • Department of Crop Physiology
      • • Department of Genetics and Plant Breeding
      Bengalore, State of Karnataka, India
  • 2005–2011
    • Ashoka Trust for Research in Ecology and the Environment
      Bengalore, State of Karnataka, India
  • 2010
    • Sveriges Lantbruksuniversitet
      • Institutionen för ekologi
      Uppsala, Uppsala, Sweden
  • 2007
    • University of Florida
      Lake Alfred, FL, USA