Amanda J Watson

The University of Manchester, Manchester, ENG, United Kingdom

Are you Amanda J Watson?

Claim your profile

Publications (22)152.06 Total impact

  • Article: Topographical study of O(6)-alkylguanine DNA alkyltransferase repair activity and N7-methylguanine levels in resected lung tissue.
    [show abstract] [hide abstract]
    ABSTRACT: BACKGROUND: Tobacco specific nitrosamines such as 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) are genotoxic alkylating agents found within cigarette smoke that induce lung adenocarcinomas in animal models. In humans, adenocarcinomas originate most frequently in the lung periphery. The aim of this study was to determine whether peripheral lung has increased susceptibility to the genotoxic effects of alkylating agents by comparing DNA alkylation damage (N7-methylguanine: N7-meG) and repair (O(6)-alkylguanine DNA alkyltransferase: MGMT) in peripheral relative to central lung tissue. METHODS: Macroscopically normal lung tissue, resected from patients undergoing surgery for lung cancer, was sampled at equidistant points from central to peripheral lung along a bronchus. N7-meG levels were determined using an immunoslotblot technique and MGMT activity with a [32P]-labelled oligodeoxynucleotide cleavage assay. RESULTS: A total of 20 subjects were recruited, 12 males and 8 females with a mean age of 68.7± 5.8 years. There were 14 former and 6 current smokers with a mean smoking exposure of 34.0±18.3 packyears. N7-meG (mean 0.75±0.57/10(6)dG, n = 65 samples from 14 patients) and MGMT repair (geometric mean 9.57±1.62 fmole/μgDNA, n = 79 samples from 16 patients) were detected in all samples assayed. MGMT activity increased towards the lung periphery (r = 0.28, p=0.023; n=16) with a highly significant association in current (r = 0.53, p=0.008; n=6) but not former smokers (r = 0.13; p=0.41; n=10). No correlation was seen with N7-meG levels and lung position (r = -0.18; p=0.21; n=14). N7-meG levels were higher in current compared to former smokers reaching significance in two lung positions including peripheral lung (p=0.047). CONCLUSIONS: The findings in this study do not support the hypothesis that peripheral tissue is more susceptible to the genotoxic effects of alkylating agents than central lung tissue. In addition exposure to cigarette smoke reduced the level of MGMT in central bronchial tissue possibly through increased alkylating agent exposure.
    Chemico-biological interactions 05/2013; · 2.46 Impact Factor
  • Source
    Dataset: nar-02976-d-2012-File006
  • Source
    Article: The nitrosated bile acid DNA lesion O6-carboxymethylguanine is a substrate for the human DNA repair protein O6-methylguanine-DNA methyltransferase.
    [show abstract] [hide abstract]
    ABSTRACT: The consumption of red meat is a risk factor in human colorectal cancer (CRC). One hypothesis is that red meat facilitates the nitrosation of bile acid conjugates and amino acids, which rapidly convert to DNA-damaging carcinogens. Indeed, the toxic and mutagenic DNA adduct O(6)-carboxymethylguanine (O(6)-CMG) is frequently present in human DNA, increases in abundance in people with high levels of dietary red meat and may therefore be a causative factor in CRC. Previous reports suggested that O(6)-CMG is not a substrate for the human version of the DNA damage reversal protein O(6)-methylguanine-DNA methyltransferase (MGMT), which protects against the genotoxic effects of other O(6)-alkylguanine lesions by removing alkyl groups from the O(6)-position. We now show that synthetic oligodeoxyribonucleotides containing the known MGMT substrate O(6)-methylguanine (O(6)-MeG) or O(6)-CMG effectively inactivate MGMT in vitro (IC(50) 0.93 and 1.8 nM, respectively). Inactivation involves the removal of the O(6)-alkyl group and its transfer to the active-site cysteine residue of MGMT. O(6)-CMG is therefore an MGMT substrate, and hence MGMT is likely to be a protective factor in CRC under conditions where O(6)-CMG is a potential causative agent.
    Nucleic Acids Research 01/2013; · 8.03 Impact Factor
  • Article: Alkyltransferase-like protein (Atl1) distinguishes alkylated guanines for DNA repair using cation-π interactions.
    [show abstract] [hide abstract]
    ABSTRACT: Alkyltransferase-like (ATL) proteins in Schizosaccharomyces pombe (Atl1) and Thermus thermophilus (TTHA1564) protect against the adverse effects of DNA alkylation damage by flagging O(6)-alkylguanine lesions for nucleotide excision repair (NER). We show that both ATL proteins bind with high affinity to oligodeoxyribonucleotides containing O(6)-alkylguanines differing in size, polarity, and charge of the alkyl group. However, Atl1 shows a greater ability than TTHA1564 to distinguish between O(6)-alkylguanine and guanine and in an unprecedented mechanism uses Arg69 to probe the electrostatic potential surface of O(6)-alkylguanine, as determined using molecular mechanics calculations. An unexpected consequence of this feature is the recognition of 2,6-diaminopurine and 2-aminopurine, as confirmed in crystal structures of respective Atl1-DNA complexes. O(6)-Alkylguanine and guanine discrimination is diminished for Atl1 R69A and R69F mutants, and S. pombe R69A and R69F mutants are more sensitive toward alkylating agent toxicity, revealing the key role of Arg69 in identifying O(6)-alkylguanines critical for NER recognition.
    Proceedings of the National Academy of Sciences 10/2012; · 9.68 Impact Factor
  • Article: Atl1 regulates choice between global genome and transcription-coupled repair of O(6)-alkylguanines.
    [show abstract] [hide abstract]
    ABSTRACT: Nucleotide excision repair (NER) has long been known to remove DNA lesions induced by chemical carcinogens, and the molecular mechanism has been partially elucidated. Here we demonstrate that in Schizosaccharomyces pombe a DNA recognition protein, alkyltransferase-like 1 (Atl1), can play a pivotal role in selecting a specific NER pathway, depending on the nature of the DNA modification. The relative ease of dissociation of Atl1 from DNA containing small O(6)-alkylguanines allows accurate completion of global genome repair (GGR), whereas strong Atl1 binding to bulky O(6)-alkylguanines blocks GGR, stalls the transcription machinery, and diverts the damage to transcription-coupled repair. Our findings redraw the initial stages of the NER process in those organisms that express an alkyltransferase-like gene and raise the question of whether or not O(6)-alkylguanine lesions that are poor substrates for the alkyltransferase proteins in higher eukaryotes might, by analogy, signal such lesions for repair by NER.
    Molecular cell 05/2012; 47(1):50-60. · 14.61 Impact Factor
  • Article: Convenient and efficient syntheses of oligodeoxyribonucleotides containing O(6)-(carboxymethyl)guanine and O(6)-(4-oxo-4-(3-pyridyl)butyl)guanine.
    [show abstract] [hide abstract]
    ABSTRACT: O(6)-(carboxymethyl)guanine (O(6)-CMG) and O(6)-(4-oxo-4-(3-pyridyl)butyl)guanine (O(6)-pobG) are toxic lesions formed in DNA following exposure to alkylating agents. O(6)-CMG results from exposure to nitrosated glycine or nitrosated bile acid conjugates and may be associated with diets rich in red meat. O(6)-pobG lesions are derived from alkylating agents found in tobacco smoke. Efficient syntheses of oligodeoxyribonucleotides (ODNs) containing O(6)-CMG and O(6)-pobG are described that involve nucleophilic displacement by the appropriate alcohol on a common synthetic ODN containing the reactive base 2-amino-6-methylsulfonylpurine. ODNs containing O(6)-pobG and O (6)-CMG were found to be good substrates for the S. pombe alkyltransferase-like protein Atl1.
    Nucleosides Nucleotides &amp Nucleic Acids 04/2012; 31(4):328-38. · 0.90 Impact Factor
  • Article: Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer.
    [show abstract] [hide abstract]
    ABSTRACT: Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n=51) and cancer free controls (n=88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [(32)P]-based oligonucleotide cleavage assay (MPG substrate 5'-CCGCTɛAGCGGGTACCGAGCTCGAAT; ɛA=ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21±1.67fmol/μg DNA/h vs 3.47±1.35fmol/μg DNA/h, p=0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.
    Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 01/2012; 732(1-2):43-6. · 2.85 Impact Factor
  • Article: Obesity and hepatosteatosis in mice with enhanced oxidative DNA damage processing in mitochondria.
    [show abstract] [hide abstract]
    ABSTRACT: Mitochondria play critical roles in oxidative phosphorylation and energy metabolism. Increasing evidence supports that mitochondrial DNA (mtDNA) damage and dysfunction play vital roles in the development of many mitochondria-related diseases, such as obesity, diabetes mellitus, infertility, neurodegenerative disorders, and malignant tumors in humans. Human 8-oxoguanine-DNA glycosylase 1 (hOGG1) transgenic (TG) mice were produced by nuclear microinjection. Transgene integration was analyzed by PCR. Transgene expression was measured by RT-PCR and Western blot analysis. Mitochondrial DNA damage was analyzed by mutational analyses and measurement of mtDNA copy number. Total fat content was measured by a whole-body scan using dual-energy X-ray absorptiometry. The hOGG1 overexpression in mitochondria increased the abundance of intracellular free radicals and major deletions in mtDNA. Obesity in hOGG1 TG mice resulted from increased fat content in tissues, produced by hyperphagia. The molecular mechanisms of obesity involved overexpression of genes in the central orexigenic (appetite-stimulating) pathway, peripheral lipogenesis, down-regulation of genes in the central anorexigenic (appetite-suppressing) pathway, peripheral adaptive thermogenesis, and fatty acid oxidation. Diffuse hepatosteatosis, female infertility, and increased frequency of malignant lymphoma were also seen in these hOGG1 TG mice. High levels of hOGG1 expression in mitochondria, resulting in enhanced oxidative DNA damage processing, may be an important factor in human metabolic syndrome, infertility, and malignancy.
    American Journal Of Pathology 04/2011; 178(4):1715-27. · 4.89 Impact Factor
  • Article: Tumor O(6)-methylguanine-DNA methyltransferase inactivation by oral lomeguatrib.
    [show abstract] [hide abstract]
    ABSTRACT: A major mechanism of resistance to chlorethylnitrosureas and methylating agents involves the DNA repair protein O(6)-methylguanine-DNA methyltransferase (MGMT). We sought to determine the dose of oral 6-(4-bromo-2-thienyl) methoxy purin-2-amine (lomeguatrib), a pseudosubstrate inactivator of MGMT, required to render active protein undetectable 12 hours after dosing in prostate, primary central nervous system (CNS), and colorectal cancer patients. Lomeguatrib was administered orally as a single dose (20-160 mg) approximately 12 hours before tumor resection. Dose escalation was projected to continue until grade 2 toxicity or until complete inactivation of tumor MGMT was encountered. Total MGMT protein levels were quantified by ELISA, and active protein levels were quantified by biochemical assay. MGMT promoter methylation was determined in glioblastoma DNA by methylation-specific PCR. Thirty-seven patients were dosed with lomeguatrib, and 32 informative tumor samples were obtained. Mean total MGMT level varied between tumor types: 554 +/- 404 fmol/mg protein (+/-SD) for prostate cancer, 87.4 +/- 40.3 fmol/mg protein for CNS tumors, and 244 +/- 181 fmol/mg protein for colorectal cancer. MGMT promoter hypermethylation did not correlate with total protein expression. Consistent total MGMT inactivation required 120 mg of lomeguatrib in prostate and colorectal cancers. Complete consistent inactivation in CNS tumors was observed only at the highest dose of lomeguatrib (160 mg). Total MGMT inactivation can be achieved in prostate, primary CNS, and colorectal cancers with a single administration of 120 or 160 mg lomeguatrib. The dose needed did not correlate with mean total MGMT protein concentrations. One hundred twenty to 160 mg/d of lomeguatrib should be administered to achieve total MGMT inactivation in future studies.
    Clinical Cancer Research 01/2010; 16(2):743-9. · 7.74 Impact Factor
  • Article: Folate deficiency alters hepatic and colon MGMT and OGG-1 DNA repair protein expression in rats but has no effect on genome-wide DNA methylation.
    [show abstract] [hide abstract]
    ABSTRACT: Folate deficiency is implicated in human colon cancer. The effects of feeding rats a folate-deficient diet for 24 weeks on DNA damage (8-oxo-7,8-dihydroguanine), DNA repair [O(6)-methylguanine-DNA methyltransferase (MGMT) and 8-oxoguanine-DNA glycosylase (OGG-1) activity], and epigenetic parameters (genome-wide cytosine methylation and indices of cellular methylation status) were investigated. Relative to control diet, the folate-deficient diet resulted in significantly reduced levels of serum ( approximately 80%; P < 0.0001), whole blood ( approximately 40%; P < 0.0001), and tissue folate (between 25% and 60% depending on the tissue sampled; P < 0.05); increased plasma total homocysteine ( approximately 35%; P < 0.05); and decreased S-adenosylmethionine to S-adenosylhomocysteine concentrations ( approximately 11%; P < 0.05). There was no significant change in the levels of 5-methyldeoxycytidine in liver or colon DNA, nor in the activity of liver DNA cytosine methyltransferase. However, there were significant increases in 8-oxo-7,8-dihydroguanine (P < 0.001) in lymphocyte DNA and in levels of the DNA repair proteins OGG-1 ( approximately 27%; P < 0.03) and MGMT ( approximately 25%; P < 0.003) in the liver, but not in the colon. This may reflect the ability of the liver, but not the colon, to upregulate DNA repair enzymes in response to either elevated DNA damage or an imbalance in the nucleotide precursor pool. These results show that folate deficiency can significantly modulate DNA damage and DNA repair, providing mechanisms by which it plays a role in the etiology of human cancer. We speculate that the inability of colon tissue to respond to folate deficiency occurs in humans and may increase the potential for malignant transformation.
    Cancer Prevention Research 01/2010; 3(1):92-100. · 4.91 Impact Factor
  • Article: Flipping of alkylated DNA damage bridges base and nucleotide excision repair
    [show abstract] [hide abstract]
    ABSTRACT: Alkyltransferase-like proteins (ATLs) share functional motifs with the cancer chemotherapy target O 6-alkylguanine-DNA alkyltransferase (AGT) and paradoxically protect cells from the biological effects of DNA alkylation damage, despite lacking the reactive cysteine and alkyltransferase activity of AGT. Here we determine Schizosaccharomyces pombe ATL structures without and with damaged DNA containing the endogenous lesion O 6-methylguanine or cigarette-smoke-derived O 6-4-(3-pyridyl)-4-oxobutylguanine. These results reveal non-enzymatic DNA nucleotide flipping plus increased DNA distortion and binding pocket size compared to AGT. Our analysis of lesion-binding site conservation identifies new ATLs in sea anemone and ancestral archaea, indicating that ATL interactions are ancestral to present-day repair pathways in all domains of life. Genetic connections to mammalian XPG (also known as ERCC5) and ERCC1 in S. pombe homologues Rad13 and Swi10 and biochemical interactions with Escherichia coli UvrA and UvrC combined with structural results reveal that ATLs sculpt alkylated DNA to create a genetic and structural intersection of base damage processing with nucleotide excision repair.
    Nature 06/2009; 459(7248):808-813. · 36.28 Impact Factor
  • Chapter: O6-Alkylguanine-DNA Alkyltransferase Assay
    Amanda J. Watson, Geoffrey P. Margison
    [show abstract] [hide abstract]
    ABSTRACT: Alkylating agents exert a wide range of biological effects in both pro- and eukaryotes and there is ever increasing evidence that these effects are mediated via alkylation at the O 6position of guanine in DNA (1–4). Repair of such adducts can be mediated by O 6-alkylguanine-DNA alkyltransferase (ATase) (3,4). Both pro- and eukaryote ATases transfer alkyl groups from the O 6-position of guanine in alkylated DNA (or from other low molecular weight substrates); (5) to a cysteine residue located at the active site of the protein: the reaction is stoichiometric and the protein is autoinactivated (6). This mechanism has been exploited in the design of several different radioactivity-based assays for the enzyme. These involve either measurement of methyl group transfer to protein or the analysis (e.g., by HPLC) of methylated substrate DNA before and after exposure to cell or tissue extracts or restriction endonuclease (RE) site deprotection of synthetic oligonucleotide substrates containing O 6-methylguanine.
    01/2008: pages 167-178;
  • Article: Alkyltransferase-like proteins.
    [show abstract] [hide abstract]
    ABSTRACT: Recent in silico analysis has revealed the presence of a group of proteins in pro and lower eukaryotes, but not in Man, that show extensive amino acid sequence similarity to known O(6)-alkylguanine-DNA alkyltransferases, but where the cysteine at the putative active site is replaced by another residue, usually tryptophan. Here we review recent work on these proteins, which we designate as alkyltransferase-like (ATL) proteins, and consider their mechanism of action and role in protecting the host organisms against the biological effects of O(6)-alkylating agents, and their evolution. ATL proteins from Escherichia coli (eAtl, transcribed from the ybaz open reading frame) and Schizosaccharomyces pombe (Atl1) are able to bind to a range of O(6)-alkylguanine residues in DNA and to reversibly inhibit the action of the human alkyltransferase (MGMT) upon these substrates. Isolated proteins were not able to remove the methyl group in O(6)-methylguanine-containing DNA or oligonucleotides, neither did they display glycosylase or endonuclease activity. S. pombe does not contain a functional alkyltransferase and atl1 inactivation sensitises this organism to a variety of alkylating agents, suggesting that Atl1 acts by binding to O(6)-alkylguanine lesions and signalling them for processing by other DNA repair pathways. Currently we cannot exclude the possibility that ATL proteins arose through independent mutation of the alkyltransferase gene in different organisms. However, analyses of the proteins from E. coli and S. pombe, are consistent with a common function.
    DNA Repair 09/2007; 6(8):1222-8. · 4.14 Impact Factor
  • Article: Targeting human 8-oxoguanine DNA glycosylase (hOGG1) to mitochondria enhances cisplatin cytotoxicity in hepatoma cells.
    [show abstract] [hide abstract]
    ABSTRACT: Many chemoradiation therapies cause DNA damage through oxidative stress. An important cellular mechanism that protects cells against oxidative stress involves DNA repair. One of the primary DNA repair mechanisms for oxidative DNA damage is base excision repair (BER). BER involves the tightly coordinated function of four enzymes (glycosylase, apurinic/apyrimidinic endonuclease, polymerase and ligase), in which 8-oxoguanine DNA glycosylase 1 initiates the cycle. An imbalance in the production of any one of these enzymes may result in the generation of more DNA damage and increased cell killing. In this study, we targeted mitochondrial DNA to enhance cancer chemotherapy by over-expressing a human 8-oxoguanine DNA glycosylase 1 (hOGG1) gene in the mitochondria of human hepatoma cells. Increased hOGG1 transgene expression was achieved at RNA, protein and enzyme activity levels. In parallel, we observed enhanced mitochondrial DNA damage, increased mitochondrial respiration rate, increased membrane potential and elevated free radical production. A greater proportion of the hOGG1-over-expressing hepatoma cells experienced apoptosis. Following exposure to a commonly used chemotherapeutic agent, cisplatin, cancer cells over-expressing hOGG1 displayed much shortened long-term survival when compared with control cells. Our results suggest that over-expression of hOGG1 in mitochondria may promote mitochondrial DNA damage by creating an imbalance in the BER pathway and sensitize cancer cells to cisplatin. These findings support further evaluation of hOGG1 over-expression strategies for cancer therapy.
    Carcinogenesis 08/2007; 28(8):1629-37. · 5.70 Impact Factor
  • Article: Randomized trial of the combination of lomeguatrib and temozolomide compared with temozolomide alone in chemotherapy naive patients with metastatic cutaneous melanoma.
    [show abstract] [hide abstract]
    ABSTRACT: To evaluate tumor response, pharmacodynamic effects, and safety of a combination of lomeguatrib (LM), an O6-methylguanine DNA-methyltransferase (MGMT) inactivator, and temozolomide (TMZ), TMZ alone, and LM/TMZ after disease progression on TMZ alone in patients with advanced melanoma. Patients with unresectable stage III or IV cutaneous melanoma who had no prior systemic chemotherapy were randomly assigned to receive either 40 to 80 mg LM and 125 mg/m2 TMZ or 200 mg/m2 TMZ on days 1 through 5 of each 28-day treatment cycle. Drugs were administered orally for up to six cycles of treatment. Patients on TMZ alone were offered LM/TMZ at progression, if fit enough to receive treatment. One hundred four patients were enrolled, with 52 in each trial arm. Twenty-seven TMZ-treated patients received LM/TMZ after progression on TMZ. Unexpectedly, analysis of tumor biopsies showed rapid recovery of MGMT after LM/TMZ with 40 mg/d LM. Therefore, doses of LM were escalated to 60 then 80 mg/d. Tumor response rates were 13.5% with LM/TMZ and 17.3% with TMZ alone. No patient responded to LM/TMZ having progressed through TMZ. Median time to disease progression was 65.5 days for LM/TMZ and 68 days for TMZ. All treatments were well tolerated, although hematologic and gastrointestinal adverse events were common. A higher incidence of hematological adverse events was observed in the LM/TMZ combination arm. The efficacy of LM and TMZ in the current dosing schedule is similar to that of TMZ alone. To maintain MGMT depletion in tumor dosing of LM needs to be continued beyond that of TMZ.
    Journal of Clinical Oncology 07/2007; 25(18):2540-5. · 18.37 Impact Factor
  • Article: Tissue‐specific expression and induction of human O6‐alkylguanine‐dna alkyltransferase in transgenic mice
    [show abstract] [hide abstract]
    ABSTRACT: O6-Alkylguanine-DNA alkyltransferase (ATase) activity was determined in crude sonicates of tissues obtained from the F2 offspring of human ATase transgenic founder mice. In certain cases, samples were analyzed both before and after administration of zinc sulfate in the drinking water for 2 wk to upregulate the mouse metallothionein-1 promoter that controls the expression of the transgene. In liver samples obtained by partial hepatectomy, the ATase activities of nontransgenic mice ranged from 63 to 139 fmol/mg total protein (mean of 10 mice, 95.3 ± 23 fmol/mg), whereas in positive transgenic mice, the range was from 503 to 2119 fmol/mg (mean of 10 mice, 963 ± 475 fmol/mg). The difference between the mean ATase values for these two groups of mice is highly significant (P < 0.001). All positive mice expressed ATase and in those examined using the human ATase coding sequence as a probe, isoschizomeric-restriction endonuclease digestion showed no evidence of cytosine methylation in the transgene. After zinc sulfate induction, the ATase levels in residual liver tissue were for the controls 84–191 fmol/mg (mean of 10 mice, 123 ± 31.5 fmol/mg) and for positive mice 908–3273 fmol/mg (mean of 10 mice, 1960 ± 724 fmol/mg). Induction thus caused a 1.4- to 3.2-fold increase in ATase activity in the tissues of individual transgenic mice (mean, 1.8-fold; P < 0.003), with the greatest increase generally occurring in those mice that had the lowest preinduction levels. Hepatic ATase levels were thus increased up to 28 times higher in transgenic mice than in nontransgenic mice. When data from other groups of transgenic and nontransgenic mice (eight of each) was included and analyzed in an independent rather than paired fashion, the mean values for zinc-treated controls and transgenic mice, respectively, were 106 fmol/mg and 1415 fmol/mg, still a highly significant (P < 0.001) difference. In two mice given a single intraperitoneal dose of cadmium chloride, hepatic ATase increased 2.1- and 4.9-fold, respectively. The effect of partial hepatectomy alone was also considered: for transgenic mice the mean ATase level increased from 453 to 661 fmol/mg protein after 48 h. In other offspring subjected to either unilateral nephrectomy or orchidectomy, induction of ATase activity by zinc sulfate was also seen in kidney (5.7- and 8.4-fold) and testis (1.7- and 3.1-fold), although these observations were made with small numbers of mice. Northern and slot-blot analyses showed that the induction of ATase activity in liver and testis was accompanied by increases in the abundance of human ATase message in total RNA, but there was not a close correlation. In a follow-up experiment, a comparison of ATase levels in zinc-induced transgenic tissues with tissue from nontransgenic littermates (eight of each) showed a statistically significant enhancement of human ATase expression in transgenic kidney and testis as well as in brain, stomach, spleen, and thymus. Lung was the only tissue analyzed that did not show expression of the transgene. The small intestine in particular was shown to have ATase levels ranging from 1086 to 2097 fmol/mg (greater than 16 times normal mouse levels). In xeroderma pigmentosum fibroblasts transfected with the human ATase metallothionein chimeric vector and exposed to zinc sulfate in the culture medium (100 mM), ATase expression was increased somewhat more than in transgenic liver (i.e., 4.4-fold). © 1992 Wiley-Liss, Inc.
    Molecular Carcinogenesis 07/2006; 6(1):26 - 31. · 3.16 Impact Factor
  • Article: 669. Drug Selection of Hematopoietic Cells by Regulated MGMT Activity
    [show abstract] [hide abstract]
    ABSTRACT: Molecular Therapy (2006) 13, S258|[ndash]|S258; doi: 10.1016/j.ymthe.2006.08.746 669. Drug Selection of Hematopoietic Cells by Regulated MGMT Activity Barbara Verbeek1, Thomas D. Southgate1, Michael D. Milsom1, Amanda J. Watson2, Lorna B. Woolford1, Geoff P. Margison2 and Leslie J. Fairbairn11Gene Therapy Group, Paterson Institute for Cancer Research, Manchester, United Kingdom2Carcinogenesis Group, Paterson, Institute for Cancer Research, Manchester, United Kingdom
    Molecular Therapy 04/2006; · 6.87 Impact Factor
  • Source
    Article: A novel DNA damage recognition protein in Schizosaccharomyces pombe.
    [show abstract] [hide abstract]
    ABSTRACT: Toxic and mutagenic O6-alkylguanine adducts in DNA are repaired by O6-alkylguanine-DNA alkyltransferases (MGMT) by transfer of the alkyl group to a cysteine residue in the active site. Comparisons in silico of prokaryotes and lower eukaryotes reveal the presence of a group of proteins [alkyltransferase-like (ATL) proteins] showing amino acid sequence similarity to MGMT, but where the cysteine at the putative active site is replaced by tryptophan. To examine whether ATL proteins play a role in the biological effects of alkylating agents, we inactivated the gene, referred to as atl1+, in Schizosaccharomyces pombe, an organism that does not possess a functional MGMT homologue. The mutants are substantially more susceptible to the toxic effects of the methylating agents, N-methyl-N-nitrosourea, N-methyl-N'nitro-N-nitrosoguanidine and methyl methanesulfonate and longer chain alkylating agents including N-ethyl-N-nitrosourea, ethyl methanesulfonate, N-propyl-N-nitrosourea and N-butyl-N-nitrosourea. Purified Atl1 protein does not transfer methyl groups from O6-methylguanine in [3H]-methylated DNA but reversibly inhibits methyl transfer by human MGMT. Atl1 binds to short single-stranded oligonucleotides containing O6-methyl, -benzyl, -4-bromothenyl or -hydroxyethyl-guanine but does not remove the alkyl group or base and does not cleave the oligonucleotide in the region of the lesion. This suggests that Atl1 acts by binding to O6-alkylguanine lesions and signalling them for processing by other DNA repair pathways. This is the first report describing an activity that protects S.pombe against the toxic effects of O6-alkylguanine adducts and the biological function of a family of proteins that is widely found in prokaryotes and lower eukaryotes.
    Nucleic Acids Research 02/2006; 34(8):2347-54. · 8.03 Impact Factor
  • Article: Quantitative trait locus analysis reveals two intragenic sites that influence O6-alkylguanine-DNA alkyltransferase activity in peripheral blood mononuclear cells.
    [show abstract] [hide abstract]
    ABSTRACT: The repair of specific types of DNA alkylation damage by O6-alkylguanine-DNA alkyltransferase (MGMT) is a major mechanism of resistance to the carcinogenic and chemotherapeutic effects of certain alkylating agents. MGMT expression levels vary widely between individuals but the underlying causes of this variability are not known. To address this, we used an expressed single nucleotide polymorphism (SNP) and demonstrated that the MGMT alleles are frequently expressed at different levels in peripheral blood mononuclear cells (PBMC). This suggests that there is a genetic component of inter-allelic variation of MGMT levels that maps close to or within the MGMT locus. We then used quantitative trait locus (QTL) analysis using intragenic SNPs and found that there are at least two sites influencing inter-individual variation in PBMC MGMT activity. One is characterized by an SNP at the 3' end of the first intron and the second by two SNPs in the last exon. The latter are in perfect disequilibrium and both result in amino acid substitutions-one of them, Ile143Val, affecting an amino acid close to the Cys145 residue at the active site of MGMT. Using in vitro assays, we further showed that while the Val143 variant did not affect the activity of the protein on methylated DNA substrate, it was more resistant to inactivation by the MGMT pseudosubstrate, O6-(4-bromothenyl)guanine. These findings suggest that further investigations of the potential epidemiological and clinical significance of inherited differences in MGMT expression and activity are warranted.
    Carcinogenesis 09/2005; 26(8):1473-80. · 5.70 Impact Factor
  • Article: Temozolomide pharmacodynamics in patients with metastatic melanoma: dna damage and activity of repair enzymes O6-alkylguanine alkyltransferase and poly(ADP-ribose) polymerase-1.
    [show abstract] [hide abstract]
    ABSTRACT: Temozolomide, a DNA methylating agent used to treat melanoma, induces DNA damage, which is repaired by O6-alkylguanine alkyltransferase (ATase) and poly(ADP-ribose) polymerase-1 (PARP-1)-dependent base excision repair. The current study was done to define the effect of temozolomide on DNA integrity and relevant repair enzymes as a prelude to a phase I trial of the combination of temozolomide with a PARP inhibitor. Temozolomide (200 mg/m2 oral administration) was given to 12 patients with metastatic malignant melanoma. Peripheral blood lymphocytes (PBL) were analyzed for PARP activity, DNA single-strand breakage, ATase levels, and DNA methylation. PARP activity was also measured in tumor biopsies from 9 of 12 patients and in PBLs from healthy volunteers. Temozolomide pharmacokinetics were consistent with previous reports. Temozolomide therapy caused a substantial and sustained elevation of N7-methylguanine levels, a modest and sustained reduction in ATase activity, and a modest and transient increase in DNA strand breaks and PARP activity in PBLs. PARP-1 activity in tumor homogenates was variable (828 +/- 599 pmol PAR monomer/mg protein) and was not consistently affected by temozolomide treatment. The effect of temozolomide reported here are consistent with those documented in previous studies with temozolomide and similar drug, dacarbazine, demonstrating that a representative patient population was investigated. Furthermore, PARP activity was not inhibited by temozolomide treatment and this newly validated pharmacodynamic assay is therefore suitable for use in a proof-of-principle phase I trial a PARP-1 inhibitor in combination with temozolomide.
    Clinical Cancer Research 06/2005; 11(9):3402-9. · 7.74 Impact Factor