-
[show abstract]
[hide abstract]
ABSTRACT: Stearoyl-CoA desaturase-1 (SCD-1) plays a pivotal role in an increase of triglyceride by an excess of dietary carbohydrate intake. Dietary carbohydrates increase SCD-1 gene expression in liver by sterol response element binding protein (SREBP)-1c-dependent and SREBP-1c -independent pathways. Previous report demonstrated that thyroid hormone (TH) negatively regulates mouse SCD-1 gene promoter before SREBP-1c was revealed. We reported that TH negatively regulates SREBP-1c recently. Therefore, in the current study, we examined whether and how TH regulates human SCD-1 gene expression and evaluated SREBP-1c effect on the negative regulation. Luciferase assays revealed that TH suppresses both mouse and human SCD-1 gene promoter activity. In SREBP-1 knockdown HepG2 cells, TH still suppresses SCD-1 gene promoter activity, and it also exerted the negative regulation under cotransfection of a small amount of SREBP-1c. These data indicated that SREBP-1c does not play the decisive role for the negative regulation by TH. The responsible region for the negative regulation in human SCD-1 gene promoter turned out to be between -124 and -92 bp, referred to as site A. Chromatin immunoprecipitation assays demonstrated that TH receptor-β is recruited to the region upon T(3) administration, although TR-β does not bind directly to site A. In conclusion, TH negatively regulates human SCD-1 gene expression in without direct binding of the TH receptor to the SCD-1 gene promoter.
Endocrinology 12/2012; · 4.46 Impact Factor
-
Nihon Naika Gakkai Zasshi 07/2011; 100(7):1959-62.
-
Koshi Hashimoto,
Shunichi Matsumoto,
Emi Ishida,
Atsuko Miura,
Kazuhiko Horiguchi,
Atsushi Ozawa,
Nobuyuki Shibusawa, Teturou Satoh,
Masanobu Yamada,
Shozo Yamada,
Masatomo Mori
[show abstract]
[hide abstract]
ABSTRACT: The liver X receptors (LXR-α and -β) are nuclear oxysterol receptors that play pivotal roles in regulating the expression of genes involved in cholesterol transport and metabolism. Recently, several groups have reported that the LXRs also regulate adrenal steroidogenesis. In the previous report, we demonstrated that LXR-α is dominantly expressed in the pituitary and that LXR-α positively regulates the proopiomelanocortin (POMC) gene promoter at the transcriptional level. In this report, we evaluated the expression levels of LXR-α and -β gene in the human pituitary tumor. Even though LXR-α mRNA levels are not significantly increased in ACTH-secreting adenomas, LXR-α/β expression ratio is significantly higher than other pituitary tumors including normal pituitaries. Furthermore, in At-T20 cells, which express POMC gene, overexpression of LXR-β decreased POMC gene promoter activities. Thus, we concluded that LXR-α/β gene expression ratio is a critical factor to activate POMC gene expression in ACTH-secreting pituitary adenomas.
Neuroscience Letters 02/2011; 494(1):34-7. · 2.11 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: We reported a novel mutation of thyroid hormone receptor (TR)-beta, F455S, in a patient with pituitary resistance to thyroid hormone (RTH), who showed impaired release of nuclear receptor corepressor and abnormal histone deacetylation. In the present study, we further analyzed the histone modifications and the dynamics of TR and RNA polymerase II on the TRH gene. The lysine residues 9 (H3K9) and 14 (K14) of the histone H3 were acetylated in the absence of thyroid hormone (TH), and addition of TH caused a temporary deacetylation of both residues. Although H3K4 was di- and trimethylated in the absence of T(3), no methylation of H3K9 or K27 was detected. Long-term incubation with T(3) decreased the level of trimethylated H3K4, the amount of TR, and the level of phosphorylated RNA polymerase II but not dimethylated H3K4. Treatment with an inhibitor for H3K4 methyltransferase, 5'-deoxy-5'-methylthioadenosine, decreased basal promoter activity but did not affect the repression by TH. Conversely, overexpression of MLL, an H3K4-specific methyltransferase, caused an increase in basal activity. In the presence of F455S, methylation of H3K4 and the dynamics of TR were intact, but both H3K9 and H3K14 were hyperacetylated, and T(3)-induced deacetylation was impaired, resulting in a high transcriptional level. These findings demonstrated that 1) negative regulation of the TRH gene by TH involves both the acetylation and methylation of specific residues of histone tails and changing the amount of TR, and 2) the major impairment to histone modifications in F455S was hyperacetylation of the specific histone tails.
Endocrinology 04/2009; 150(7):3425-32. · 4.46 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: The molecular mechanism of thyroid hormone (TH) effects to fatty acid metabolism in liver is yet to be clear. The carbohydrate response element-binding protein (ChREBP) as well as sterol response element-binding protein (SREBP)-1c plays a pivotal role in hepatic lipogenesis. Both SREBP-1c and ChREBP are target genes of liver X receptors (LXRs). Because LXRs and TH receptors (TRs) cross talk mutually in many aspects of transcription, we examined whether TRs regulate the mouse ChREBP gene expression. In the current study, we demonstrated that TH up-regulated mouse ChREBP mRNA and protein expression in liver. Run-on and luciferase assays showed that TH and TR-beta1 positively regulated the ChREBP gene transcription. The mouse ChREBP gene promoter contains two direct repeat-4 sites (LXRE1 and LXRE2) and EMSAs demonstrated that LXR-alpha and TR-beta1 prefer to bind LXRE1 and LXRE2, respectively. The direct repeat-4 deletion and LXRE2 mutants of the promoter deteriorate the positive regulation by TR-beta1, indicating that LXRE2 is functionally important for the regulation. We also showed that human ChREBP gene expression and promoter activities were up-regulated by TH. These data suggest that ChREBP mRNA expression is positively regulated by TR-beta1 and TH at the transcriptional level in mammals. This novel observation indicates that TH fine-tunes hepatic lipogenesis via regulating SREBP-1c and ChREBP gene expression reciprocally.
Endocrinology 04/2009; 150(7):3417-24. · 4.46 Impact Factor
-
Shinichi Okamura,
Yoshie Sawada, Teturou Satoh,
Hironosuke Sakamoto,
Yuichiro Saito,
Hiroyuki Sumino,
Takako Takizawa,
Toshiaki Kogure,
Chiayo Chaichantipyuth,
Yoshihiro Higuchi,
Tsutomu Ishikawa,
Tetsuo Sakamaki
[show abstract]
[hide abstract]
ABSTRACT: Impaired lipid metabolism is an important health problem in postmenopausal women with insufficient estrogens, because dyslipidemia is a risk factor for development of atherosclerosis and the incidence of cardiovascular disease markedly increases after menopause. Pueraria mirifica (PM), a Thai herb, has been noticed as a source of phytoestrogens, estrogen-mimicking plant compounds. However, the clinical effects of PM on lipid metabolism and the underlying molecular mechanisms remain undetermined. Therefore, we examined the effects of PM on serum lipid parameters in a randomized, double-blind, placebo-controlled clinical trial. Nineteen postmenopausal women were randomly assigned to receive oral administration of PM powder or placebo. After 2 months of treatment, the PM group showed a significant increase in serum concentrations of high-density lipoprotein (HDL) cholesterol and apolipoprotein (apo) A-1 (34% and 40%, respectively), and a significant decrease in low-density lipoprotein (LDL) cholesterol and apo B (17% and 9%, respectively), compared with baseline measurements. Moreover, significant decreases were observed in the ratios of LDL cholesterol to HDL cholesterol (37%) and apo B to apo A-1 (35%). Next, we determined the effects of PM phytoestrogens on the activation of estrogen receptor (ER)-mediated transactivation by transient expression assays of a reporter gene in cultured cells. Among PM phytoestrogens, miroestrol and coumestrol enhanced both ERalpha- and ERbeta-mediated transactivation, whereas other phytoestrogens, including daidzein and genistein, preferentially enhanced ERbeta-mediated transactivation. In conclusion, PM has a beneficial effect on lipid metabolism in postmenopausal women, which may result from the activation of gene transcription through selective binding of phytoestrogens to ERalpha and ERbeta.
The Tohoku Journal of Experimental Medicine 01/2009; 216(4):341-51. · 1.24 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: The liver X receptors (LXR-alpha and -beta) are nuclear oxysterol receptors that play pivotal roles in regulating the expression of genes involved in cholesterol transport and metabolism. Recently, several groups have reported that the LXRs also regulate adrenal steroidogenesis. However, the roles of LXRs in the hypothalami-pituitary-adrenal axis, especially whether they regulate proopiomelanocortin (POMC) gene expression in the pituitary, remain to be elucidated. In this report, we demonstrate that LXR mRNA is expressed in the pituitary and that at the protein level, LXR-alpha is dominantly expressed. Next, we show that the LXR agonist TO901317 (TO) increased POMC mRNA levels and the number of cells immunostained with anti-ACTH antibody in the mouse pituitary. We also confirmed that TO elevated plasma ACTH and serum corticosterone levels in vivo and increased the total tissue content of immunoreactive ACTH in the pituitary. TO activated the rat POMC gene promoter (-706/+64 bp) in GH3 and AtT-20 cells. Silencing of LXR-alpha mRNA expression in GH3 cells with small interfering RNA specific to LXR-alpha caused a loss of promoter activity induced by the LXR ligand, suggesting that LXR-alpha directly regulates the POMC gene promoter. EMSAs also demonstrated that the retinoid X receptor-alpha/LXR-alpha heterodimer bound to the region between -73 and -52 bp in the rat POMC gene promoter, and this site was responsible for the induction by TO, as confirmed by chromatin immunoprecipitation assays using AtT-20 cells. Our findings provide the first evidence that LXR-alpha positively regulates the POMC gene promoter at the transcriptional level and suggest LXR-alpha to be a coordinator for cross talk between lipid metabolism and neuroendocrinology.
Molecular Endocrinology 12/2008; 23(1):47-60. · 4.54 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Hachimi-jio-gan is widely used to improve several disorders associated with diabetes, but its mechanism remains poorly understood. In an attempt to clarify the mechanism of Hachimi-jio-gan, we investigated the effects of this herbal medicine and its components in transfection studies of CV1 cells, especially nuclear receptor-mediated actions. One half (0.5) mg/ml of Hachimi-jio-gan activated peroxisome proliferator-activated receptor (PPARalpha), mediating the activation by 3.1-fold on DR1 response elements; however, it did not affect PPARgamma, thyroid hormone receptor, androgen receptor, estrogen receptor or RXR. In addition, this activation was observed in a dose-dependent manner. Next, to determine which components of Hachimi-jio-gan activate PPARalpha-mediated transcription, 8 of its components (rehmanniae radix, orni fructus, dioscoreae rhizoma, alismatis rhizoma, hoelen, moutan cortex, cinnamomi cortex, aconiti) were tested. Only cinnamomi cortex (1.0 mg/ml) increased PPARalpha-mediated transcription by 4.1-fold, and this activation was specific for PPAR alpha, and not for other nuclear receptors. Moreover, this PPARalpha-related activation by cinnamomi cortex is specifically observed in renal cells. Taken together, these findings indicate that Hachimi-jio-gan and cinnamomi cortex may have a pharmacological effect through the target site for PPARalpha.
Endocrine Journal 08/2008; 55(3):529-33. · 2.03 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: We cloned a novel splicing variant for nuclear coactivator p120(alpha), designated as p120beta and studied its function and expression in several human prostate diseases. Transfection assays demonstrated that p120beta functions as a strong coactivator for androgen receptor (AR), but weakly for other nuclear receptors. GST-pull down assay showed that a glutamine-rich region of the p120 bound to the ligand-binding domain of AR. Interestingly, p120beta mRNAs were expressed predominantly in the normal prostate, androgen-responsive prostate cancers and an androgen-sensitive prostate cancer cell line, LNCaP, but weakly in recurrent cancers and the androgen-insensitive prostate cancer cell lines PC3 and DU145. Furthermore, knockdown of p120alpha by siRNA abolished coactivator activity on thyroid hormone receptors (TR) and PPARgamma, but did not affect that of ARs in PC3 cells. In addition, competitive assay with other nuclear receptors demonstrated that TR and PPARgamma did not inhibit p120beta-induced stimulation. These findings suggested that while p120alpha was essential for ligand-dependent stimulation of TRs and PPARgamma, p120beta acted as a coactivating protein predominantly for AR.
Endocrine Journal 07/2008; 55(4):657-65. · 2.03 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: We report a 54-year-old Japanese woman with enlargement of her hands and feet, and tachycardia over the previous 3 years. She had a TSH- and GH-producing pituitary adenoma 3.5 × 3.0 × 2.0 cm. A bromocriptine test was performed. Bromocriptine was slightly effective for GH inhibition, but, she complained of headaches, nausea, and impaired vision 24 hours after bromocriptine administration. MRI examination showed heterogeneous mixed intensity lesions in the pituitary adenoma, compatible with pituitary apoplexy. The tumor was removed by the transsphenoidal approach 24 hours later, and histologic examination confirmed the diagnosis of pituitary apoplexy. Although pituitary apoplexy associated with bromocriptine is very rare, this case suggests a casual relationship is possible in some instances.
The Endocrinologist 02/2008; 18(2):65-67. · 0.09 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: The nuclear oxysterol receptors, liver X receptors (LXRs), and thyroid hormone receptors (TRs) cross talk mutually in many aspects of transcription, sharing the same DNA binding site (direct repeat-4) with identical geometry and polarity. In the current study, we demonstrated that thyroid hormone (T(3)) up-regulated mouse LXR-alpha, but not LXR-beta, mRNA expression in the liver and that cholesterol administration did not affect the LXR-alpha mRNA levels. Recently, several groups have reported that human LXR-alpha autoregulates its own gene promoter through binding to the LXR response element. Therefore, we examined whether TRs regulate the mouse LXR-alpha gene promoter activity. Luciferase assays showed that TR-beta1 positively regulated the mouse LXR-alpha gene transcription. Analysis of serial deletion mutants of the promoter demonstrated that the positive regulation by TR-beta1 was not observed in the -1240/+30-bp construct. EMSA(s) demonstrated that TR-beta1 or retinoid X receptor-alpha did not bind to the region from -1300 to -1240 bp (site A), whereas chromatin-immunoprecipitation assays revealed that TR-beta1 and retinoid X receptor-alpha were recruited to the site A, indicating the presence of intermediating protein between the nuclear receptors and DNA site. We also showed that human LXR-alpha gene expression and promoter activities were up-regulated by thyroid hormone. These data suggest that LXR-alpha mRNA expression is positively regulated by TR-beta1 and thyroid hormone at the transcriptional level in mammals. This novel insight that thyroid hormone regulates LXR-alpha mRNA levels and promoter activity should shed light on a cross talk between LXR-alpha and TR-beta1 as a new therapeutic target against dyslipidemia and atherosclerosis.
Endocrinology 11/2007; 148(10):4667-75. · 4.46 Impact Factor
-
Nippon rinsho. Japanese journal of clinical medicine 10/2006; Suppl 3:343-7.
-
[show abstract]
[hide abstract]
ABSTRACT: Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1-6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (-574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-alpha/thyroid hormone receptor-beta heterodimer bound to Site2, but retinoid X receptor-alpha/liver X receptor- heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-beta recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3 in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.
Endocrinology 10/2006; 147(9):4292-302. · 4.46 Impact Factor
-
Tsuyoshi Monden,
Yasuyo Nakajima,
Tetsu Hashida,
Sumiyasu Ishii,
Takuya Tomaru,
Nobuyuki Shibusawa,
Koshi Hashimoto, Teturou Satoh,
Masanobu Yamada,
Masatomo Mori,
Kikuo Kasai
[show abstract]
[hide abstract]
ABSTRACT: The role of thyroid hormone (T3) in the regulation of growth and development of the central nervous system including the cerebellum has been well established. However, the effects of thyroid hormone on malignant tumors derived from the cerebellum remain poorly understood. Our analysis mainly focused on expression levels of TR isoforms and the effects of thyroid hormone in human medulloblastoma HTB-185 cells. Northern blot analysis revealed TRalpha2 mRNA but not TRalpha1, beta1 or beta2 mRNA in the cell. The TRalpha1 and TRbeta1 mRNAs were detected only by RT-PCR method and TRbeta2 was not expressed. Incubation of T3 for 24 h decreased TRalpha1, TRalpha2 and TRbeta1 mRNA. Addition of actinomycin D caused an acute increase in the basal TR mRNA levels and the rate of decrease of all kinds of TR isoform mRNA was accelerated in the T3-treated groups compared to controls, indicating that the stability of TR mRNA was affected by T3. Incubation with cycloheximide also blocked a decrease in TR mRNA levels in the T3-treated HTB-185 cells suggesting that down-regulation of TR mRNA required the synthesis of new protein. Our data provide novel evidence for the expression of TRs down-regulated by T3 in HTB-185 cells, suggesting that TR expression is post-transcriptionally regulated by T3 at the level of RNA stability.
Endocrine Journal 05/2006; 53(2):181-7. · 2.03 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Using the DNA-binding domain (DBD) and hinge region of human peroxisome proliferator-activated receptor (PPAR)-gamma as bait in yeast two-hybrid screen, we isolated partial cDNA identical with that of the C terminal of KIAA1769. KIAA1769 encodes a 2080-amino acid protein (molecular mass, 231 kDa) that was recently identified to interact with PPARalpha and termed PPARalpha-interacting cofactor 285 (here referred to as PPARgamma-DBD-interacting protein 1 (PDIP1)-alpha). PDIP1 mRNA was expressed in 3T3-L1 adipocytes and THP-1 macrophages. We also identified the expression of the N terminal extended form of PDIP1alpha (referred to as PDIP1beta) consisting of 2649 amino acids (295 kDa) in human cultured cell lines by RT-PCR, and 5' rapid amplification of cDNA ends. Ribonuclease protection assay revealed that PDIP1beta mRNA was expressed more abundantly than PDIP1alpha mRNA. The C-terminal region of PDIP1 directly binds DBD of PPARgamma, and multiple LXXLL motifs in PDIP1 were not required for the interaction. PDIP1alpha and -beta similarly enhanced PPARgamma-mediated transactivation in transfection assays and short interfering RNA targeting PDIP1 mRNA significantly reduced transactivation by PPARgamma. No potent intrinsic activation domain was identified in either PDIP1 isoforms in mammalian one-hybrid assays, and mutation of all LXXLL motifs did not affect enhancement of PPARgamma-mediated transactivation. PDIP1alpha and -beta similarly augmented transactivation by PPARalpha, PPARdelta, thyroid hormone receptor (TR)-alpha1, TRbeta1, and retinoid X receptor-alpha. PDIP1alpha also enhanced estrogen receptoralpha- and androgen receptor-mediated transactivation, whereas PDIP1beta did not. PDIP1alpha showed receptor-specific synergism with activation function-2-interacting coactivators in PPARgamma- and TRbeta1-mediated transactivation. Together, PDIP1 might function as a transcriptional cofactor for a broad range of nuclear receptors, possibly in collaboration with specific activation function-2 interacting coactivators.
Endocrinology 02/2006; 147(1):377-88. · 4.46 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Hypercholesterolemia is found in patients with hypothyroidism and resistance to thyroid hormone. In this study, we examined cholesterol metabolism in a thyroid hormone receptor beta (TR-beta) mutant mouse model of resistance to thyroid hormone. Whereas studies of cholesterol metabolism have been reported in TR-beta knock-out mice, generalized expression of a non-ligand binding TR-beta protein in this knock-in model more fully recapitulates the hypothyroid state, because the hypothyroid effect of TRs is mediated by the unliganded receptor. In the hypothyroid state, a high cholesterol diet increased serum cholesterol levels in wild-type animals (WT) but either did not change or reduced levels in mutant (MUT) mice relative to hypothyroidism alone. 7alpha-Hydroxylase (CYP7A1) is the rate-limiting enzyme in cholesterol metabolism and mRNA levels were undetectable in the hypothyroid state in all animals. triiodothyronine replacement restored CYP7A1 mRNA levels in WT mice but had minimal effect in MUT mice. In contrast, a high cholesterol diet markedly induced CYP7A1 levels in MUT but not WT mice in the hypothyroid state. Elevation of CYP7A1 mRNA levels and reduced hepatic cholesterol content in MUT animals are likely because of cross-talk between TR-beta and liver X receptor alpha (LXR-alpha), which both bind to a direct repeat + 4 (DR+4) element in the CYP7A1 promoter. In transfection studies, WT but not MUT TR-beta antagonized induction of this promoter by LXR-alpha. Electromobility shift analysis revealed that LXR/RXR heterodimers bound to the DR+4 element in the presence of MUT but not WT TR-beta. A mechanism for cross-talk, and potential antagonism, between TR-beta and LXR-alpha is proposed.
Journal of Biological Chemistry 02/2006; 281(1):295-302. · 4.77 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: P-Lim (Lhx3a) is a LIM homeodomain transcription factor essential for pituitary development and motor neuron specification in mice. The Lhx3 gene encodes two isoforms, which differ in their amino (N) termini, Lhx3a and 3b. The P-Lim DNA binding site on the glycoprotein hormone alpha subunit (alpha-GSU) gene promoter is conserved in mammals. P-Lim plays a pivotal role in mediating thyrotropin-releasing hormone (TRH) signaling by binding CREB binding protein (CBP), as we have reported previously. Here, we demonstrate that P-Lim (Lhx3a) but not Lhx3b can mediate TRH signaling and bind to CBP. Moreover, TRH specifically induces P-Lim-CBP binding through the N-termini of P-Lim. We also found that the protein kinase C (PKC) phosphorylation site within the N-terminus of P-Lim is responsible for the P-Lim-CBP binding suggesting that the TRH signaling pathway phosphorylates P-Lim. These studies have elucidated the molecular mechanism by which TRH stimulates alpha-GSU gene expression.
Molecular and Cellular Endocrinology 02/2005; 229(1-2):11-20. · 4.19 Impact Factor
-
Tsuyoshi Monden,
Masanobu Yamada,
Yasuyo Nihei,
Mikiko Kishi,
Takuya Tomaru,
Sumiyasu Ishii,
Tetsu Hashida,
Nobuyuki Shibusawa,
Koshi Hashimoto, Teturou Satoh,
Kikuo Kasai,
Masatomo Mori
[show abstract]
[hide abstract]
ABSTRACT: Troglitazone (TZ), a thiazolidinedione derivative, is a specific ligand for the peroxisome proliferator-activated receptor (PPAR) gamma and improves insulin sensitivity. PPARgamma regulates the expression of genes by binding to PPAR response element in promoter regions of regulator genes as heterodimers with a retinoid X receptor (RXR). We report here that PPARgamma activation by TZ depends on the expression levels of RXR. A transient transfection study in CV-1 cells revealed that the activation by TZ was suppressed by increasing amounts of expression of RXR, but not PPARgamma. Northern blot analysis revealed that PPARgamma and RXR were not expressed in CV-1 cells, and TZ did not induce PPARgamma or RXR mRNA in CV-1 cells indicating that RXR suppression is not related to these endogenous receptor expressions. Electrophoretic mobility shift assay revealed that the increasing amount of RXR did not compete with the DNA binding of the PPARgamma/RXR heterodimer in the presence or absence of TZ. Transfected co-activators enhanced the TZ-dependent gene transcription, and this activation was inhibited by excessive amounts of RXR, indicating that unliganded RXR may recruit the specific coactivators from the PPARgamma/RXR heterodimer.
Life Sciences 01/2005; 76(7):731-41. · 2.53 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: A 24-year-old woman was admitted to our department for further examination of hypercalcemia, a high level of intact parathyroid hormone (PTH) and a right parathyroid tumor. She complained of bone pain throughout her body and was unable to walk due to systemic cystic osteofibrosis, including a brown tumor of the left lower extremities. Neck ultrasonography (US) and magnetic resonance imaging (MRI) revealed a tumor 2 cm in diameter in the upper side of the right thyroid lobe. 99mTc sestamibi (99mTc-MIBI) imaging and F-18 fluorodeoxyglucose positron emission tomography (FDG-PET) were performed to diagnose primary hyperparathyroidism and examination of other parathyroid glands. However, neither imaging modality detected the parathyroid tumor. To confirm the diagnosis, we performed selective venous sampling around the parathyroid and the patient was diagnosed with primary hyperparathyroidism due to a right parathyroid tumor. Resection of the right parathyroid tumor was performed and the pathological diagnosis was parathyroid adenoma. To date, both 99mTc-MIBI and FDG-PET are useful to localize parathyroid tumors. In this case, however, neither modality detected the tumor. Although recent studies state that expression of P-glycoprotein (P-gp) in parathyroid tumors plays an important role in the false-negative results of both 99mTc-MIBI scans and FDG-PET, immunohistological study detected no P-gp expression in the parathyroid tumor in the current case.
Internal Medicine 10/2004; 43(9):816-23. · 0.94 Impact Factor
-
Nihon Naika Gakkai Zasshi 01/2004; 92(12):2420-2.