A Samuelson

Stockholm University, Stockholm, Stockholm, Sweden

Are you A Samuelson?

Claim your profile

Publications (21)46.47 Total impact

  • Article: Impact of IgG replacement therapy and antibiotic treatment on the colonization of non-encapsulated Haemophilus influenzae in the nasopharynx in patients with hypogammaglobulinaemia.
    [show abstract] [hide abstract]
    ABSTRACT: Non-typable Haemophilus influenzae (NTHI) and Streptococcus pneumoniae are regarded as the main pathogens in patients with humoral immunodeficiency. These patients have been given IgG replacement therapy since the 1950s. However, a number of individuals still suffer from recurrent episodes of respiratory tract infections. Nasopharyngeal cultures were obtained on a regular basis over a 3-6-month period from 11 patients with common variable immunodeficiency disease in 1989 and 1998. The proportion of cultures positive for NTHI decreased from 56% in 1989-90 to 16% in 1998-99 (p < 0.003). After 9 y of IgG therapy, 7 of the 11 patients were free from NTHI in the nasopharynx. Specific NTHI strains were analysed by pulsed-field gel electrophoresis and compared, with regard to genetic relatedness, on an intra-individual basis. In 1 patient the same NTHI strain was found in both 1989 and 1999. The apparent absence of NTHI from the nasopharynx in most of the patients was assumed to be due to subcutaneous IgG treatment, as well as adequate antibiotic treatment.
    Scandinavian Journal of Infectious Diseases 02/2001; 33(12):904-8. · 1.72 Impact Factor
  • Article: Children with recurrent episodes of acute otitis media: the effect of local administration of immunoglobulin G on acute otitis media, colonization and turnover of non-encapsulated Haemophilus influenzae in the nasopharynx.
    [show abstract] [hide abstract]
    ABSTRACT: In most children with recurrent episodes of acute otitis media (AOM), tube treatment is successful, but there are those who nevertheless suffer from middle ear infections. The aim of the present study was to ascertain whether local administration of immunoglobulin could reduce the number of episodes of otorrhoea in otitis-prone infants <2 years old who were treated with tubes, or whether it could affect the nasopharyngeal colonization and turnover of bacterial pathogens in the nasopharynx. IgG or placebo were also administered intranasally daily for 6 months to 50 infants, randomized in a double-blind study. An arbitrarily primed polymerase chain reaction (AP-PCR) was used to characterize the different isolates of NTHI (non-encapsulated, non-typable Haemophilus influenzae). Three infants in the IgG group and six infants in the control group suffered from > or =3 episodes of acute otitis media. No effect on the nasopharyngeal colonization or the turnover of non-encapsulated H. influenzae in the nasopharynx could be detected in either group.
    Clinical Otolaryngology 04/2000; 25(2):161-8. · 2.39 Impact Factor
  • Article: Detection of JC virus in cerebrospinal fluid (CSF) samples from patients with progressive multifocal leukoencephalopathy but not in CSF samples from patients with herpes simplex encephalitis, enteroviral meningitis, or multiple sclerosis.
    [show abstract] [hide abstract]
    ABSTRACT: JC virus (JCV) DNA was detected in cerebrospinal fluid (CSF) samples from patients with progressive multifocal leukoencephalopathy (PML) but not in CSF samples from patients with herpes simplex encephalitis, enteroviral meningitis, or multiple sclerosis. This suggests that inflammatory processes in the brain do not necessarily reactivate JCV, which further supports the proposal that the presence of JCV DNA in the CSF is diagnostic for PML.
    Journal of Clinical Microbiology 04/1998; 36(4):1137-8. · 4.15 Impact Factor
  • Source
    Article: Persistence of nontypeable Haemophilus influenzae in adenoid macrophages: a putative colonization mechanism.
    [show abstract] [hide abstract]
    ABSTRACT: That nontypeable H. influenzae (NTHI) can reside intracellularly in human adenoid tissue has been suggested by use of in situ hybridization of a fluorescein labelled 16S rRNA-targeted oligonucleotide probe (FISH). Adenoid tissues from 43 children operated on in a clinically infection-free interval were investigated. FISH revealed H. influenzae in macrophage-like cells, located subepithelially in the crypts in all 43 adenoids. Furthermore, H. influenzae was detected in 22/22 adenoids using immunohistochemistry with the monoclonal antibody MAHI-3 recognizing a conserved H. influenzae LPS inner-core region. FISH and staining with monoclonal antibodies against immunophenotypic markers were performed simultaneously in order to characterize the cellular interrelations in this microenvironment. The findings of widespread presence of H. influenzae in cells of which some strongly expressed the CD14 marker of the monocyte/macrophage lineage may correspond to an important aspect of the colonization mechanisms whereby NTHI persists in the nasopharynx of children.
    Acta Oto-Laryngologica 10/1996; 116(5):766-73. · 1.08 Impact Factor
  • Article: No findings of enteroviruses in Swedish patients with chronic fatigue syndrome.
    [show abstract] [hide abstract]
    ABSTRACT: Enteroviruses have been proposed to cause an immune complex disease in the chronic fatigue syndrome. Altogether 34 patients with the chronic fatigue syndrome, according to criteria of the Centers for Disease Control, USA, were studied evenly over the seasons for the possible presence of a chronic enterovirus infection. In 11 patients, 1-5 faecal samples were collected at about 6 month intervals for virus isolation before and after acid treatment, followed by ultracetrifugation at pH 3 to dissolve possible enterovirus-antibody complexes. Another 14 fecal samples were subjected to routine virus isolation alone. Seven pairs of serum-cerebrospinal fluid samples were analysed for cross-reactive IgG antibody activity to enteroviruses. In 29 patients a muscle biopsy was collected for enterovirus polymerase chain reaction (PCR). We were unable to identify enteroviruses in any of these samples by any of these techniques. Our study does not confirm evidence for persistent enterovirus infection in the chronic fatigue syndrome.
    Scandinavian Journal of Infectious Diseases 02/1996; 28(3):305-7. · 1.72 Impact Factor
  • Article: Turnover of nonencapsulated Haemophilus influenzae in the nasopharynges of otitis-prone children.
    [show abstract] [hide abstract]
    ABSTRACT: Restriction enzyme analysis of total genomic DNA was applied to study the epidemiology of nontypeable Haemophilus influenzae (NTHI) isolated from the nasopharynges of children with recurrent acute otitis media (AOM). The turnover of strains, as judged from genetic fingerprinting of a total of 213 H. influenzae isolates collected prospectively during a 2-year study period from 38 children under 3 years of age, was examined in relation to episodes of AOM as well as to courses of antibiotic treatment. The children were selected if they had had at least one episode of AOM before 1 year of age and if more than two nasopharyngeal isolates of H. influenzae were recovered. The 213 H. influenzae isolates (90% NTHI) recovered corresponded to 128 different DNA fingerprints. Fifty-eight percent of the fingerprints were observed only once, whereas 42% appeared on two or more occasions in isolates from the same individual or in close relatives, i.e., brothers and sisters. Sixty-seven percent of these strains had a minimum colonization period of 2 months or less. Intermittent nasopharyngeal colonization periods longer than 5 months could be demonstrated for 13% of the strains. The present data suggest that intermittent colonization is due to endogenous reinfections. Genetically identical NTHI strains from unrelated individuals were never identified. As expected from the observation of a relatively high proportion of persistent colonizations, no correlation was found between episodes of AOM and the acquisition of new strains of H. influenzae, nor was any direct relation between antimicrobial therapy and the elimination of nasopharyngeal colonization with a particular strain of H. influenzae observed.
    Journal of Clinical Microbiology 09/1995; 33(8):2027-31. · 4.15 Impact Factor
  • Source
    Article: Characterization of the recognition site and diagnostic potential of an enterovirus group-reactive monoclonal antibody.
    A Samuelson, M Forsgren, M Sällberg
    [show abstract] [hide abstract]
    ABSTRACT: The epitope for a monoclonal antibody reactive against different enteroviruses was characterized. The epitope could be located to residues 40 to 48 of VP1, and the most-essential residues for monoclonal antibody binding coincided with those conserved among the majority of known enteroviruses, indicating a high diagnostic potential.
    Clinical and Diagnostic Laboratory Immunology 06/1995; 2(3):385-6. · 2.51 Impact Factor
  • Source
    Article: Characterization of Haemophilus influenzae isolates from the respiratory tract of patients with primary antibody deficiencies: evidence for persistent colonizations.
    [show abstract] [hide abstract]
    ABSTRACT: A total of 117 consecutive patients with primary antibody deficiencies were followed for up to 5 years with regard to acute respiratory tract infections. Nontypeable Haemophilus influenzae (NTHI) was the sole pathogen in 61% (202/330) of the samples from which a potential pathogen was recovered. Common variable immunodeficiency (CVI) was the most prevalent condition (27/39 patients) in the group where H. influenzae was isolated. In patients where H. influenzae was not found only 9/78 patients had CVI. 49 of these 78 patients had isolated IgG3 or IgA deficiency. Both of these entities seemed to be associated with a lower prevalence of NTHI infections. 13 of 18 patients with at least 2 isolates of NTHI were colonized with the same strain from 3 to 43 months as shown by total genomic DNA-fingerprinting. Recurrent symptomatic infections occurred in these patients despite substitution therapy with gammaglobulins and repeated antibiotic treatments. All but 2 of the 224 H. influenzae isolates were beta-lactamase negative and sensitive to ampicillin. The use of 10 lipopolysaccharide-specific monoclonal antibodies in a whole cell ELISA showed that the LPS-epitopes on the 224 H. influenzae isolates from the hypogammaglobulinemic group were very similar to 499 NTHI isolates from immunocompetent patients with respiratory infections. One may therefore conclude that i) patients with CVI, were prone to be permanently colonized with NTHI, and ii) the colonizing bacteria were ordinary strains showing the same LPS-phenotypes as those strains that cause acute respiratory tract infections in immunocompetent individuals.
    Scandinavian Journal of Infectious Diseases 02/1995; 27(4):303-13. · 1.72 Impact Factor
  • Article: Sequence analysis of echoviruses in a major antigenic region eliciting enteroviral cross-reactive antibodies.
    A Samuelson, B Johansson, M Forsgren
    [show abstract] [hide abstract]
    ABSTRACT: The amino acid sequence of an antigenic region known to elicit cross-reactive enteroviral IgG antibodies in VP1 is known for poliovirus and cox-sackievirus A and B. However, no corresponding data has been available for prevalent echovirus serotypes with great clinical impact. Such information was obtained by amplification of this region of the echovirus genome by PCR using biotinylated primers. The amplicon was subjected to solid phase sequencing using the dideoxy chain-termination method. Translated amino acid sequences for residues 26-55 of VP1 of the echoviruses revealed that the known cross-reactive region is highly conserved also in the echovirus serotypes.
    Archives of Virology 02/1995; 140(11):2085-91. · 2.11 Impact Factor
  • Source
    Article: Molecular basis for serological cross-reactivity between enteroviruses.
    [show abstract] [hide abstract]
    ABSTRACT: The recognition sites for human antibodies which are cross-reactive between different types of enteroviruses were determined and characterized. Serum samples obtained from 58 patients with culture-confirmed enteroviral infections were analyzed in enzyme immunoassays against two sets of overlapping synthetic peptides covering residues 31 to 96 of poliovirus 1 VP1 (Mahoney strain) and residues 31 to 148 of coxsackievirus B1 VP1 (position based on alignment with poliovirus 1 VP1, Mahoney strain). A major antigenic region eliciting cross-reactive antibodies could be located to residues 37 to 51 of VP1. Furthermore, a single peptide covering residues 42 to 55 almost completely inhibited the binding of human antibodies to heat-inactivated enteroviruses, indicating that residues 42 to 55 of VP1 contain a major region eliciting cross-reactive antibodies. By using peptide analogs in which each residue within positions 42 to 55 of VP1 was sequentially substituted by Ala or Gly, we were able to determine the most essential residues for human antibody binding in 38 of the convalescent-phase patient serum samples. In a majority of the serum samples, the most essential residues for antibody binding were found to be Pro-42, Ala-43, Leu-44, Thr-45, Ala-46, Glu-48, Thr-49, and Gly-50. All of these residues are conserved, according to known enterovirus sequences, with the divergent echovirus 22 excepted. In conclusion, we could demonstrate that the essential residues for binding of cross-reactive antibodies are well conserved within the enterovirus family. These findings provide a molecular basis for the observed antibody cross-reactivity within the enterovirus group.
    Clinical and Diagnostic Laboratory Immunology 06/1994; 1(3):336-41. · 2.51 Impact Factor
  • Source
    Article: Haemophilus influenzae resides and multiplies intracellularly in human adenoid tissue as demonstrated by in situ hybridization and bacterial viability assay.
    [show abstract] [hide abstract]
    ABSTRACT: The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCACTTTCATCTTCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H. influenzae in sections of adenoid tissue from 10 children who were clinically infection free but were having their adenoids removed because of nasal obstruction. In some cases, the reticular crypt epithelium was focally infiltrated by H. influenzae. The reservoir for these bacterial colonizations, in all likelihood long standing, seemed to be macrophage-like cells found in the subepithelial layers in all 10 cases. These mononuclear cells contained up to 200 intracellular H. influenzae cells. In the transmission electron macroscope, macrophage-like cells with intracellular bacteria with coccoid morphology, at least some of which were dividing, were seen. Adenoid cell suspensions, enriched for macrophages by use of paramagnetic beads coated with monoclonal antibodies against the CD14 marker, yielded up to 1,100 CFU of nontypeable H. influenzae per 10(5) cells after killing of extracellular bacteria with gentamicin followed by mechanical lysis of the cells.
    Infection and Immunity 03/1994; 62(2):673-9. · 4.16 Impact Factor
  • Article: Quantitative bacterial culture from adenoid lymphatic tissue with special reference to Haemophilus [corrected].
    [show abstract] [hide abstract]
    ABSTRACT: Homogenized adenoid tissue from 55 children (28-153 months) undergoing adenoidectomy because of nasopharyngeal obstruction was investigated by means of quantitative aerobic bacterial culture. The children were divided into two groups, the hypertrophy alone group--AH (n = 29)--and the hypertrophy with longstanding secretory otitis media group--SOM (n = 26). A nasopharyngeal culture was obtained preoperatively from 38 of the cases. Non-typeable H. influenzae (NTHI) was found in twice as many cases in the AH group as in the SOM group, 21/29 (72%) compared to 11/26 (42%) (p < 0.05) and in a significantly higher mean concentrations, 5.7 x 10(5) CFU/g compared to 1.9 x 10(5) CFU/g (p = 0.02). For the other aerobic potentially pathogenic bacteria no such difference was found. The bulk of the NTHI-positive cases and the cases with the highest concentrations were found in the children below the age of 6 years. In the nasopharyngeal cultures NTHI alone or together with S. pneumoniae and/or B. catarrhalis was found in 29% of the cases in both the AH group and SOM group. NTHI was found in only 50% of the nasopharyngeal cultures corresponding to a positive quantitative culture (10/20). These findings suggest that NTHI is harboured within the adenoid and could thereby chronically stimulate the local immune defense. However, the present study indicates that there is no aerobic bacterial overload in the adenoid tissue in children with SOM compared to children without middle-ear disease.
    Acta Oto-Laryngologica 10/1993; 113(5):668-72. · 1.08 Impact Factor
  • Article: Diagnosis of enteroviral meningitis with IgG-EIA using heat-treated virions and synthetic peptides as antigens.
    [show abstract] [hide abstract]
    ABSTRACT: Two recently developed enzyme immunosorbent assays (EIA) for the detection of significant titre increases in enteroviral IgG-antibodies were evaluated as diagnostic tools in 127 etiologically well-characterized patients with aseptic meningitis. One assay was based on heat-treated virions (H-EIA) and one on synthetic peptides (P-EIA) as antigens. The sensitivities, with virus isolation as reference method, were 0.67 by H-EIA and 0.62 by P-EIA, which were higher than by a routinely used complement fixation test (CFT, 0.51) but somewhat lower than the sensitivities found by two previously presented IgM-assays, mu-capture EIA, and solid-phase reverse immunosorbent test (SPRIST). The specificities of the two IgG-EIA techniques and CFT were apparently high, whereas the two IgM-assays showed positive reactions in some non-enteroviral cases. A relatively rapid increase in enteroviral IgG-antibodies was apparent using H-EIA and P-EIA. The two IgG-EIA tests contributed with considerable additional etiological information since significant IgG-rises were obtained in 13 patients by H-EIA and in 19 by P-EIA, respectively, out of the 56 individuals in whom enterovirus isolation was negative and a non-enteroviral diagnosis was not found. Thus, detection of enteroviral IgG-antibodies by H-EIA and P-EIA seems to be a valuable alternative to CFT for the routine diagnosis of enteroviral meningitis. The IgM-assays, mu-capture EIA, and SPRIST, may allow a relatively rapid report of an enteroviral infection. However, since both the IgM-tests are hampered by incomplete specificities, a confirmation of positive results by an IgG-assay should be carried out.
    Journal of Medical Virology 09/1993; 40(4):271-7. · 2.82 Impact Factor
  • Source
    Article: Identification of group-common linear epitopes in structural and nonstructural proteins of enteroviruses by using synthetic peptides.
    [show abstract] [hide abstract]
    ABSTRACT: Synthetic peptides were employed in enzyme-linked immunosorbent assays to identify group-common linear epitopes in the structural and nonstructural proteins of enteroviruses. Nine linear epitopes were recognized by using sera from patients with heterotypic immunoglobulin G antibody responses to enterovirus infections. The most-reactive peptides were derived from conserved regions of the amino-terminal part of VP1, whereas peptides representing sequences from other conserved regions of VP1, as well as VP2, VP3, and VP4, and from a nonstructural region showed no or poor reactivity. These findings may be useful in the development of serological tests for the diagnosis of infections caused by a broad range of enteroviruses.
    Journal of Clinical Microbiology 05/1993; 31(4):911-6. · 4.15 Impact Factor
  • Article: Failure to demonstrate enterovirus aetiology in Swedish patients with dilated cardiomyopathy.
    [show abstract] [hide abstract]
    ABSTRACT: Attempts were made to establish a possible relationship between enterovirus infection and dilated cardiomyopathy (DCM) by use of serology, virus isolation from faecal samples, and detection of enteroviral RNA in endomyocardial biopsies (EMB) by the polymerase chain reaction (PCR). Sera from 63 patients with DCM and matched controls were examined for enterovirus infection by mu-capture IgM and indirect IgG ELISA. Thirty-six patients were further tested for the presence of enterovirus group-specific antigen (VP1) in an immunoassay system. The results were consistently negative. Faecal samples from 35 of these patients were negative by enterovirus isolation both when samples were cultured directly and after acid treatment. EMB from 35 patients were examined for enteroviral RNA by PCR; none of the samples was reactive. In conclusion, the results fail to indicate involvement of enteroviruses in the aetiology of DCM.
    Journal of Medical Virology 02/1993; 39(1):6-10. · 2.82 Impact Factor
  • Article: Nasal administration of IgA to individuals with hypogammaglobulinemia.
    [show abstract] [hide abstract]
    ABSTRACT: Many immunodeficient patients constantly carry non-typable Hemophilus influenzae (NTHI) in the nasopharynx, despite seemingly adequate antibiotic therapy. We have studied the effect of nasal administration of IgA on nasopharyngeal colonization in 5 patients with hypogammaglobulinemia, with a productive cough, especially in the mornings, who were constant carriers of NTHI in the nasopharynx, and had IgA, 1 ml 6 times/day, given nasally for 14 days. Nasopharyngeal cultures were obtained on days 0, 7, 14 and 28. Two of the patients became culture-negative during the treatment, and the cough was alleviated in all patients.
    Scandinavian Journal of Infectious Diseases 02/1993; 25(3):395-7. · 1.72 Impact Factor
  • Article: Early diagnosis of enteroviral meningitis by detection of specific IgM antibodies with a solid-phase reverse immunosorbent test (SPRIST) and mu-capture EIA.
    [show abstract] [hide abstract]
    ABSTRACT: A solid-phase reverse immunosorbent test (SPRIST) and a mu-capture enzyme immunosorbent assay (EIA) for detection of enterovirus-specific IgM antibodies were evaluated for enterovirus diagnosis of aseptic meningitis in 160 consecutive patients from whom enterovirus (11 different serotypes) were isolated in 64. In patients with an enterovirus isolate and/or four-fold titre rise in the complement fixation test (CFT) for enterovirus, specific enterovirus IgM antibodies were detected on the day of admission to hospital in 48% by SPRIST and in 50% by EIA and 4-6 days after onset of symptoms in 71% by SPRIST and 79% by EIA. A significant increase in titre was observed between serum sampled on the day of admission and 2 days later in 38% by SPRIST and in 41% by EIA. These results indicate that the IgM antibody response appears early in the course of aseptic meningitis. Since both SPRIST and EIA provide rapid results the tests may be of differential diagnostic value and the IgM antibody kinetics may be utilized for diagnosis during the acute phase of aseptic meningitis. With optimized serum sampling the positive outcome was 76% in SPRIST and 82% in EIA among patients with positive virus isolation and/or CFT for enterovirus. In 67 patients virus isolation and CFT for enterovirus yielded negative results as well as all non-enteroviral diagnostic tests. Thirty-eight of these patients were positive by SPRIST and/or EIA and in half of these 38 a significant titre rise and/or fall in SPRIST and/or EIA was recorded. The majority of these IgM-positive patients became ill in the late summer or autumn, i.e., the "enterovirus season."(ABSTRACT TRUNCATED AT 250 WORDS)
    Journal of Medical Virology 04/1992; 36(3):193-201. · 2.82 Impact Factor
  • Article: Intrauterine fetal death due to echovirus 11.
    [show abstract] [hide abstract]
    ABSTRACT: In a case of intrauterine fetal death in the 29th week of gestation, echovirus 11 could be isolated from the umbilical cord of the fetus. The mother had no apparent signs of infection but serological evidence of current echovirus 11 infection. Enterovirus PCR performed on paraffin-embedded specimens of various tissues (myocardium, lung, liver and placenta) from the fetus yielded positive results in all cases. These findings, together with supporting serological and epidemiological findings--e.g. proven echovirus 11 infection 3 weeks before in the 18-month-old son of the woman--constituted strong evidence that echovirus 11 infection was responsible for the fetal death.
    Scandinavian Journal of Infectious Diseases 02/1992; 24(3):381-5. · 1.72 Impact Factor
  • Article: Immunological and bacteriological studies on mucosa-associated lymphatic tissue in children with SOM.
    Advances in oto-rhino-laryngology 02/1992; 47:120-3.
  • Article: Treatment failure in otitis-prone children with prophylactic tympanostomy tubes is correlated with nasopharyngeal Haemophilus influenzae colonization.
    A Samuelson, A Freijd, B Rynnel-Dagöö
    [show abstract] [hide abstract]
    ABSTRACT: Tympanostomy tubes are used to prevent recurrent otitis media among otitis-prone children. However, not all children benefit from this treatment. In the present study 28 children (19 boys, 9 girls) were given bilateral tympanostomy tubes at age 9-22 months (mean 14 months). They were observed 6 months before and after tube insertion. The treatment was considered successful for 20 children. Among these, 16 completely lacked or had one episode of middle ear discharge and 4 had otorrhea on two occasions. A total of 8 children suffered from three or more episodes of otorrhea and were considered as treatment failures. In the failure group, the nasopharyngeal average carrier rate of H. influenzae 6 months before and after tube insertion was 64% vs. 29% in the group responding well to the treatment (p less than 0.001). Nonencapsulated forms of H. influenzae were in a great majority. In the failure group 7 out of 8 presented middle ear discharge as soon as within 2 weeks after tube insertion whereas this occurred in only 3 out of 20 in the responding group. IgG, IgG1 and IgG2 antibody response to pneumococcal polysaccharide (6A, 19F) were equally distributed in the two groups. The present data suggest that one reason for an unsatisfactory response to treatment with prophylactic tympanostomy tubes is nasopharyngeal colonization and subsequent middle ear infections caused by H. influenzae.
    Acta Oto-Laryngologica 02/1991; 111(6):1090-6. · 1.08 Impact Factor

Institutions

  • 2001
    • Stockholm University
      Stockholm, Stockholm, Sweden
  • 1991–2000
    • Karolinska Institutet
      • • Institutionen för kliniska vetenskaper, Danderyds sjukhus
      • • Institutionen för medicin, Huddinge
      Solna, Stockholm, Sweden
  • 1995–1996
    • Karolinska Institute
      Stockholm, Stockholm, Sweden
  • 1993
    • Stockholm County Council
      Stockholm, Stockholm, Sweden