Publications (21)85.13 Total impact
-
Article: Thermodynamics of the multi-stage DNA lesion recognition and repair by formamidopyrimidine-DNA glycosylase using pyrrolocytosine fluorescence--stopped-flow pre-steady-state kinetics.
[show abstract] [hide abstract]
ABSTRACT: Formamidopyrimidine-DNA glycosylase, Fpg protein from Escherichia coli, initiates base excision repair in DNA by removing a wide variety of oxidized lesions. In this study, we perform thermodynamic analysis of the multi-stage interaction of Fpg with specific DNA-substrates containing 7,8-dihydro-8-oxoguanosine (oxoG), or tetrahydrofuran (THF, an uncleavable abasic site analog) and non-specific (G) DNA-ligand based on stopped-flow kinetic data. Pyrrolocytosine, highly fluorescent analog of the natural nucleobase cytosine, is used to record multi-stage DNA lesion recognition and repair kinetics over a temperature range (10-30°C). The kinetic data were used to obtain the standard Gibbs energy, enthalpy and entropy of the specific stages using van't Hoff approach. The data suggest that not only enthalpy-driven exothermic oxoG recognition, but also the desolvation-accompanied entropy-driven enzyme-substrate complex adjustment into the catalytically active state play equally important roles in the overall process.Nucleic Acids Research 05/2012; 40(15):7384-92. · 8.03 Impact Factor -
Article: Conformational dynamics of abasic DNA upon interactions with AP endonuclease 1 revealed by stopped-flow fluorescence analysis.
[show abstract] [hide abstract]
ABSTRACT: Apurinic/apyrimidinic (AP) sites are abundant DNA lesions arising from exposure to UV light, ionizing radiation, alkylating agents, and oxygen radicals. In human cells, AP endonuclease 1 (APE1) recognizes this mutagenic lesion and initiates its repair via a specific incision of the phosphodiester backbone 5' to the AP site. We have investigated a detailed mechanism of APE1 functioning using fluorescently labeled DNA substrates. A fluorescent adenine analogue, 2-aminopurine, was introduced into DNA substrates adjacent to the abasic site to serve as an on-site reporter of conformational transitions in DNA during the catalytic cycle. Application of a pre-steady-state stopped-flow technique allows us to observe changes in the fluorescence intensity corresponding to different stages of the process in real time. We also detected an intrinsic Trp fluorescence of the enzyme during interactions with 2-aPu-containing substrates. Our data have revealed a conformational flexibility of the abasic DNA being processed by APE1. Quantitative analysis of fluorescent traces has yielded a minimal kinetic scheme and appropriate rate constants consisting of four steps. The results obtained from stopped-flow data have shown a substantial influence of the 2-aPu base location on completion of certain reaction steps. Using detailed molecular dynamics simulations of the DNA substrates, we have attributed structural distortions of AP-DNA to realization of specific binding, effective locking, and incision of the damaged DNA. The findings allowed us to accurately discern the step that corresponds to insertion of specific APE1 amino acid residues into the abasic DNA void in the course of stabilization of the precatalytic complex.Biochemistry 02/2012; 51(6):1306-21. · 3.42 Impact Factor -
Article: Highly mutagenic exocyclic DNA adducts are substrates for the human nucleotide incision repair pathway.
[show abstract] [hide abstract]
ABSTRACT: Oxygen free radicals induce lipid peroxidation (LPO) that damages and breaks polyunsaturated fatty acids in cell membranes. LPO-derived aldehydes and hydroxyalkenals react with DNA leading to the formation of etheno(ε)-bases including 1,N(6)-ethenoadenine (εA) and 3,N(4)-ethenocytosine (εC). The εA and εC residues are highly mutagenic in mammalian cells and eliminated in the base excision repair (BER) pathway and/or by AlkB family proteins in the direct damage reversal process. BER initiated by DNA glycosylases is thought to be the major pathway for the removal of non-bulky endogenous base damage. Alternatively, in the nucleotide incision repair (NIR) pathway, the apurinic/apyrimidinic (AP) endonucleases can directly incise DNA duplex 5' to a damaged base in a DNA glycosylase-independent manner. Here we have characterized the substrate specificity of human major AP endonuclease 1, APE1, towards εA, εC, thymine glycol (Tg) and 7,8-dihydro-8-oxoguanine (8oxoG) residues when present in duplex DNA. APE1 cleaves oligonucleotide duplexes containing εA, εC and Tg, but not those containing 8oxoG. Activity depends strongly on sequence context. The apparent kinetic parameters of the reactions suggest that APE1 has a high affinity for DNA containing ε-bases but cleaves DNA duplexes at an extremely slow rate. Consistent with this observation, oligonucleotide duplexes containing an ε-base strongly inhibit AP site nicking activity of APE1 with IC(50) values in the range of 5-10 nM. MALDI-TOF MS analysis of the reaction products demonstrated that APE1-catalyzed cleavage of εA•T and εC•G duplexes generates, as expected, DNA fragments containing 5'-terminal ε-base residue. The fact that ε-bases and Tg in duplex DNA are recognized and cleaved by APE1 in vitro, suggests that NIR may act as a backup pathway to BER to remove a large variety of genotoxic base lesions in human cells.PLoS ONE 01/2012; 7(12):e51776. · 4.09 Impact Factor -
Article: Lys98 substitution in human AP endonuclease 1 affects the kinetic mechanism of enzyme action in base excision and nucleotide incision repair pathways.
[show abstract] [hide abstract]
ABSTRACT: Human apurinic/apyrimidinic endonuclease 1 (APE1) is a key enzyme in the base excision repair (BER) and nucleotide incision repair (NIR) pathways. We recently analyzed the conformational dynamics and kinetic mechanism of wild-type (wt) protein, in a stopped-flow fluorescence study. In this study, we investigated the mutant enzyme APE1K98A using the same approach. Lys98 was known to hydrogen bond to the carboxyl group of Asp70, a residue implicated in binding the divalent metal ion. Our data suggested that the conformational selection and induced fit occur during the enzyme action. We expanded upon the evidence that APE1 can pre-exist in two conformations. The isomerization of an enzyme-product complex in the BER process and the additional isomerization stage of enzyme-substrate complex in the NIR process were established for APE1K98A. These stages had not been registered for the wtAPE1. We found that the K98A substitution resulted in a 12-fold reduction of catalytic constant of 5'-phosphodiester bond hydrolysis in (3-hydroxytetrahydrofuran-2-yl)methyl phosphate (F, tetrahydrofuran) containing substrate, and in 200-fold reduction in 5,6-dihydrouridine (DHU) containing substrate. Thus, the K98A substitution influenced NIR more than BER. We demonstrated that the K98A mutation influenced the formation of primary unspecific enzyme-substrate complex in a complicated manner, depending on the Mg(2+) concentration and pH. This mutation obstructed the induced fit of enzyme in the complex with undamaged DNA and F-containing DNA and appreciably decreased the stability of primary complex upon interaction of enzyme with DNA, containing the natural apurinic/apyrimidinic (AP) site. Furthermore, it significantly delayed the activation of the less active form of enzyme during NIR and slowed down the conformational conversion of the complex of enzyme with the cleavage product of DHU-substrate. Our data revealed that APE1 uses the same active site to catalyze the cleavage of DHU- and AP-substrates.PLoS ONE 01/2011; 6(9):e24063. · 4.09 Impact Factor -
Article: Conformational transitions in human AP endonuclease 1 and its active site mutant during abasic site repair.
[show abstract] [hide abstract]
ABSTRACT: AP endonuclease 1 (APE1) is a crucial enzyme of the base excision repair pathway (BER) in human cells. APE1 recognizes apurinic/apyrimidinic (AP) sites and makes a nick in the phosphodiester backbone 5' to them. The conformational dynamics and presteady-state kinetics of wild-type APE1 and its active site mutant, Y171F-P173L-N174K, have been studied. To observe conformational transitions occurring in the APE1 molecule during the catalytic cycle, we detected intrinsic tryptophan fluorescence of the enzyme under single turnover conditions. DNA duplexes containing a natural AP site, its tetrahydrofuran analogue, or a 2'-deoxyguanosine residue in the same position were used as specific substrates or ligands. The stopped-flow experiments have revealed high flexibility of the APE1 molecule and the complexity of the catalytic process. The fluorescent traces indicate that wild-type APE1 undergoes at least four conformational transitions during the processing of abasic sites in DNA. In contrast, nonspecific interactions of APE1 with undamaged DNA can be described by a two-step kinetic scheme. Rate and equilibrium constants were extracted from the stopped-flow and fluorescence titration data for all substrates, ligands, and products. A replacement of three residues at the enzymatic active site including the replacement of tyrosine 171 with phenylalanine in the enzyme active site resulted in a 2 x 10(4)-fold decrease in the reaction rate and reduced binding affinity. Our data indicate the important role of conformational changes in APE1 for substrate recognition and catalysis.Biochemistry 08/2010; 49(30):6451-61. · 3.42 Impact Factor -
Article: Biophysical and X-ray crystallographic analysis of Mps1 kinase inhibitor complexes.
[show abstract] [hide abstract]
ABSTRACT: The dual-specificity protein kinase monopolar spindle 1 (Mps1) is a central component of the mitotic spindle assembly checkpoint (SAC), a sensing mechanism that prevents anaphase until all chromosomes are bioriented on the metaphase plate. Partial depletion of Mps1 protein levels sensitizes transformed, but not untransformed, human cells to therapeutic doses of the anticancer agent Taxol, making it an attractive novel therapeutic cancer target. We have previously determined the X-ray structure of the catalytic domain of human Mps1 in complex with the anthrapyrazolone kinase inhibitor SP600125. In order to validate distinct inhibitors that target this enzyme and improve our understanding of nucleotide binding site architecture, we now report a biophysical and structural evaluation of the Mps1 catalytic domain in the presence of ATP and the aspecific model kinase inhibitor staurosporine. Collective in silico, enzymatic, and fluorescent screens also identified several new lead quinazoline Mps1 inhibitors, including a low-affinity compound termed Compound 4 (Cpd 4), whose interaction with the Mps1 kinase domain was further characterized by X-ray crystallography. A novel biophysical analysis demonstrated that the intrinsic fluorescence of SP600125 changed markedly upon Mps1 binding, allowing spectrophotometric displacement analysis and determination of dissociation constants for ATP-competitive Mps1 inhibitors. By illuminating the structure of the Mps1 ATP-binding site our results provide novel biophysical insights into Mps1-ligand interactions that will be useful for the development of specific Mps1 inhibitors, including those employing a therapeutically validated quinazoline template.Biochemistry 03/2010; 49(8):1689-701. · 3.42 Impact Factor -
Article: Genetic and biochemical characterization of human AP endonuclease 1 mutants deficient in nucleotide incision repair activity.
[show abstract] [hide abstract]
ABSTRACT: Human apurinic/apyrimidinic endonuclease 1 (APE1) is a key DNA repair enzyme involved in both base excision repair (BER) and nucleotide incision repair (NIR) pathways. In the BER pathway, APE1 cleaves DNA at AP sites and 3'-blocking moieties generated by DNA glycosylases. In the NIR pathway, APE1 incises DNA 5' to a number of oxidatively damaged bases. At present, physiological relevance of the NIR pathway is fairly well established in E. coli, but has yet to be elucidated in human cells. We identified amino acid residues in the APE1 protein that affect its function in either the BER or NIR pathway. Biochemical characterization of APE1 carrying single K98A, R185A, D308A and double K98A/R185A amino acid substitutions revealed that all mutants exhibited greatly reduced NIR and 3'-->5' exonuclease activities, but were capable of performing BER functions to some extent. Expression of the APE1 mutants deficient in the NIR and exonuclease activities reduced the sensitivity of AP endonuclease-deficient E. coli xth nfo strain to an alkylating agent, methylmethanesulfonate, suggesting that our APE1 mutants are able to repair AP sites. Finally, the human NIR pathway was fully reconstituted in vitro using the purified APE1, human flap endonuclease 1, DNA polymerase beta and DNA ligase I proteins, thus establishing the minimal set of proteins required for a functional NIR pathway in human cells. Taken together, these data further substantiate the role of NIR as a distinct and separable function of APE1 that is essential for processing of potentially lethal oxidative DNA lesions.PLoS ONE 01/2010; 5(8):e12241. · 4.09 Impact Factor -
Article: Reversible chemical step and rate-limiting enzyme regeneration in the reaction catalyzed by formamidopyrimidine-DNA glycosylase.
[show abstract] [hide abstract]
ABSTRACT: Formamidopyrimidine-DNA N-glycosylase (Fpg) operates in the base excision repair pathway in bacteria by removing oxidized guanine bases from DNA and can also cleave the nascent or preformed abasic DNA by beta,delta-elimination. In this work, we have used the quench-flow technique (i) to show that the kinetics of processing of 7,8-dihydro-8-oxoguanine and abasic site lesions by Fpg from Escherichia coli involves a burst phase and a stationary phase, (ii) to establish the reaction kinetic scheme, and (iii) to calculate the rate constants for the reaction steps. A comparison of the quench-flow results with the data from earlier stopped-flow kinetics with tryptophan and 2-aminopurine fluorescence detection reveals that the cleaved product formation is initially reversible; it is followed by conformational changes in the enzyme and DNA molecules that represent the postchemical irreversible rate-limiting steps. We have applied mass spectrometry with electrospray ionization to follow the appearance and disappearance of transient covalent intermediates between Fpg and the substrate DNA. The overall rate-limiting step of the enzymatic reaction seems to be the release of Fpg from its adduct with the 4-oxo-2-pentenal remnant of the deoxyribose moiety formed as a result of DNA strand cleavage by beta,delta-elmination.Biochemistry 11/2009; 48(48):11335-43. · 3.42 Impact Factor -
Article: Real-time studies of conformational dynamics of the repair enzyme E. coli formamidopyrimidine-DNA glycosylase and its DNA complexes during catalytic cycle.
[show abstract] [hide abstract]
ABSTRACT: Fpg protein from Escherichia coli belongs to the class of DNA glycosylases/abasic site lyases excising several oxidatively damaged purines in the base excision repair pathway. In this review, we summarize the results of our studies of Fpg protein from E. coli, elucidating the intrinsic mechanism of recognition and excision of damaged bases in DNA.Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 09/2009; 685(1-2):3-10. · 2.85 Impact Factor -
Article: PELDOR study of conformations of double-spin-labeled single- and double-stranded DNA with non-nucleotide inserts.
[show abstract] [hide abstract]
ABSTRACT: DNA fragments were synthesized consisting of 12 nucleotides and containing non-nucleotide inserts of different length in the middle. Two nitroxide spin labels 4-amino-2,2,6,6-tetramethylpiperidine-1-oxyl were attached at the two ends of the molecules. Single-stranded DNAs and double-stranded DNAs (DNA duplexes) in frozen at 77 K glassy water/glycerol solutions were studied using pulsed electron-electron double resonance (PELDOR). The distance distributions between two spin labels in molecules were obtained from PELDOR data using Tikhonov regularization algorithm, and were found to be close to the Gaussian functions. Experimental PELDOR data were fitted by adjusting precisely the maximum position and the width of these functions. The obtained results show that duplexes possess a substantially narrower distribution, as compared to the single-stranded DNAs. Introduction of a non-nucleotide insert 2-hydroxymethyl-3-hydroxy-tetrahydrofuran leads to a slight but nevertheless detectable decrease of the mean distance between two spin labels. This decrease may be attributed to bending of the molecule around the insert site, by an angle of approximately 20 degrees . An introduction of a non-nucleotide insert bis-(di-ethyleneglycol)-phosphate results in a remarkable broadening of the distance distribution. The results evidence that PELDOR of spin-labeled DNA molecules may be used as a "molecular ruler" for studying the influence of local damages on the DNA conformations.Physical Chemistry Chemical Physics 09/2009; 11(31):6826-32. · 3.57 Impact Factor -
Article: Substrate Recognition of Anthrax Lethal Factor Examined by Combinatorial and Pre-steady-state Kinetic Approaches
[show abstract] [hide abstract]
ABSTRACT: Lethal factor (LF), a zinc-dependent protease of high specificity produced by Bacillus anthracis, is the effector component of the binary toxin that causes death in anthrax. New therapeutics targeting the toxin are required to reduce systemic anthrax-related fatalities. In particular, new insights into the LF catalytic mechanism will be useful for the development of LF inhibitors. We evaluated the minimal length required for formation of bona fide LF substrates using substrate phage display. Phage-based selection yielded a substrate that is cleaved seven times more efficiently by LF than the peptide targeted in the protein kinase MKK6. Site-directed mutagenesis within the metal-binding site in the LF active center and within phage-selected substrates revealed a complex pattern of LF-substrate interactions. The elementary steps of LF-mediated proteolysis were resolved by the stopped-flow technique. Pre-steady-state kinetics of LF proteolysis followed a four-step mechanism as follows: initial substrate binding, rearrangement of the enzyme-substrate complex, a rate-limiting cleavage step, and product release. Examination of LF interactions with metal ions revealed an unexpected activation of the protease by Ca2+ and Mn2+. Based on the available structural and kinetic data, we propose a model for LF-substrate interaction. Resolution of the kinetic and structural parameters governing LF activity may be exploited to design new LF inhibitors.Journal of Biological Chemistry 07/2009; 284(27):17902-17913. · 4.77 Impact Factor -
Article: Fe(II) phthalocyanine catalyzed oxidation of dGMP by molecular oxygen.
[show abstract] [hide abstract]
ABSTRACT: We show that iron(II)-phthalocyanines are able to catalyze guanosine oxidation by molecular oxygen in the presence of reducing agents such as ascorbic acid and 2-mercaptoethanol. The products of 5'-monophosphate-2'-deoxyguanosine (dGMP) oxidation were directly analyzed using the HPLC-ESI/MS method. The main oxidation products were 5'-phospho-2'-deoxy-8-oxo-7,8-dihydroguanine and the 1,N2-glyoxal adduct of the 5'-monophosphate-2'-deoxyguanosine.Bioorganic & medicinal chemistry letters 06/2009; 19(15):4335-8. · 2.65 Impact Factor -
Article: Substrate recognition of anthrax lethal factor examined by combinatorial and pre-steady-state kinetic approaches.
[show abstract] [hide abstract]
ABSTRACT: Lethal factor (LF), a zinc-dependent protease of high specificity produced by Bacillus anthracis, is the effector component of the binary toxin that causes death in anthrax. New therapeutics targeting the toxin are required to reduce systemic anthrax-related fatalities. In particular, new insights into the LF catalytic mechanism will be useful for the development of LF inhibitors. We evaluated the minimal length required for formation of bona fide LF substrates using substrate phage display. Phage-based selection yielded a substrate that is cleaved seven times more efficiently by LF than the peptide targeted in the protein kinase MKK6. Site-directed mutagenesis within the metal-binding site in the LF active center and within phage-selected substrates revealed a complex pattern of LF-substrate interactions. The elementary steps of LF-mediated proteolysis were resolved by the stopped-flow technique. Pre-steady-state kinetics of LF proteolysis followed a four-step mechanism as follows: initial substrate binding, rearrangement of the enzyme-substrate complex, a rate-limiting cleavage step, and product release. Examination of LF interactions with metal ions revealed an unexpected activation of the protease by Ca(2+) and Mn(2+). Based on the available structural and kinetic data, we propose a model for LF-substrate interaction. Resolution of the kinetic and structural parameters governing LF activity may be exploited to design new LF inhibitors.Journal of Biological Chemistry 05/2009; 284(27):17902-13. · 4.77 Impact Factor -
Article: Pre-steady-state kinetic study of substrate specificity of Escherichia coli formamidopyrimidine--DNA glycosylase.
[show abstract] [hide abstract]
ABSTRACT: Formamidopyrimidine-DNA glycosylase (Fpg) is responsible for removal of 8-oxoguanine (8-oxoG) and other oxidized purine lesions from DNA and can also excise some oxidatively modified pyrimidines [such as dihydrouracil (DHU)]. Fpg is also specific for a base opposite the lesion, efficiently excising 8-oxoG paired with C but not with A. We have applied stopped-flow kinetics using intrinsic tryptophan fluorescence of the enzyme and fluorescence of 2-aminopurine-labeled DNA to analyze the conformational dynamics of Escherichia coli Fpg during processing of good substrates (8-oxoG.C), poor substrates (8-oxoG.A), and substrates of unclear specificity (such as DHU and 8-oxoG opposite T or G). The analysis of fluorescence traces allows us to conclude that when the enzyme encounters its true substrate, 8-oxoG.C, the complex enters the productive catalytic reaction after approximately 50 ms, partitioning the substrate away from the competing dissociation process, while poor substrates linger in the initial encounter complex for longer. Several intermediate ES complexes were attributed to different structures that exist along the reaction pathway. A likely sequence of events is that the damaged base is first destabilized by the enzyme binding and then everted from DNA, followed by insertion of several amino acid residues into DNA and isomerization of the enzyme into a pre-excision complex. We conclude that rejection of the incorrect substrates occurs mostly at the early stage of formation of the pre-eversion recognition complex, supporting the role of indirect readout in damage recognition.Biochemistry 02/2007; 46(2):424-35. · 3.42 Impact Factor -
Article: Kinetic conformational analysis of human 8-oxoguanine-DNA glycosylase.
[show abstract] [hide abstract]
ABSTRACT: 7,8-dihydro-8-oxoguanine (8-oxoG) is one of the major DNA lesions formed by reactive oxygen species that can result in transversion mutations following replication if left unrepaired. In human cells, the effects of 8-oxoG are counteracted by OGG1, a DNA glycosylase that catalyzes excision of 8-oxoguanine base followed by a much slower beta-elimination reaction at the 3'-side of the resulting abasic site. Many features of OGG1 mechanism, including its low beta-elimination activity and high specificity for a cytosine base opposite the lesion, remain poorly explained despite the availability of structural information. In this study, we analyzed the substrate specificity and the catalytic mechanism of OGG1 acting on various DNA substrates using stopped-flow kinetics with fluorescence detection. Combining data on intrinsic tryptophan fluorescence to detect conformational transitions in the enzyme molecule and 2-aminopurine reporter fluorescence to follow DNA dynamics, we defined three pre-excision steps and assigned them to the processes of (i) initial encounter with eversion of the damaged base, (ii) insertion of several enzyme residues into DNA, and (iii) enzyme isomerization to the catalytically competent form. The individual rate constants were derived for all reaction stages. Of all conformational changes, we identified the insertion step as mostly responsible for the opposite base specificity of OGG1 toward 8-oxoG:C as compared with 8-oxoG:T, 8-oxoG:G, and 8-oxoG:A. We also investigated the kinetic mechanism of OGG1 stimulation by 8-bromoguanine and showed that this compound affects the rate of beta-elimination rather than pre-excision dynamics of DNA and the enzyme.Journal of Biological Chemistry 02/2007; 282(2):1029-38. · 4.77 Impact Factor -
Article: Kinetic study of DNA modification by phthalocyanine derivative of the oligonucleotide.
[show abstract] [hide abstract]
ABSTRACT: Design of chemically modified oligonucleotides for regulation of gene expression has attracted considerable attention over the last decades. One actively pursued approach involves antisense or antigene constructs carrying reactive groups, many of these based on transition metal complexes. The complexes of Co(II) with phthalocyanines are extremely good catalysts of oxidation of organic compounds with molecular oxygen and hydrogen peroxide. In this study, we have investigated the kinetics and thermodynamics of sequence-specific modification of DNA with deoxyribooligonucleotide linked to Co(II)-tetracarboxyphthalocyanine (PtcCo(II)) in the presence of H(2)O(2).Bioinorganic Chemistry and Applications 02/2006; · 0.72 Impact Factor -
Article: Conjugates of phthalocyanines with oligonucleotides as reagents for sensitized or catalytic DNA modification.
[show abstract] [hide abstract]
ABSTRACT: Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen (1)O(2), while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species ((.)O(2) (-), H(2)O(2), OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O(2) and 2-mercaptoethanol or in the presence of H(2)O(2). Under both sensitized and catalyzed conditions, the nucleotides G(13)-G(15) were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer.Bioinorganic Chemistry and Applications 01/2006; · 0.72 Impact Factor -
Article: Kinetics of substrate recognition and cleavage by human 8-oxoguanine-DNA glycosylase.
[show abstract] [hide abstract]
ABSTRACT: Human 8-oxoguanine-DNA glycosylase (hOgg1) excises 8-oxo-7,8-dihydroguanine (8-oxoG) from damaged DNA. We report a pre-steady-state kinetic analysis of hOgg1 mechanism using stopped-flow and enzyme fluorescence monitoring. The kinetic scheme for hOgg1 processing an 8-oxoG:C-containing substrate was found to include at least three fast equilibrium steps followed by two slow, irreversible steps and another equilibrium step. The second irreversible step was rate-limiting overall. By comparing data from Ogg1 intrinsic fluorescence traces and from accumulation of products of different types, the irreversible steps were attributed to two main chemical steps of the Ogg1-catalyzed reaction: cleavage of the N-glycosidic bond of the damaged nucleotide and beta-elimination of its 3'-phosphate. The fast equilibrium steps were attributed to enzyme conformational changes during the recognition of 8-oxoG, and the final equilibrium, to binding of the reaction product by the enzyme. hOgg1 interacted with a substrate containing an aldehydic AP site very slowly, but the addition of 8-bromoguanine (8-BrG) greatly accelerated the reaction, which was best described by two initial equilibrium steps followed by one irreversible chemical step and a final product release equilibrium step. The irreversible step may correspond to beta-elimination since it is the very step facilitated by 8-BrG.Nucleic Acids Research 02/2005; 33(12):3919-31. · 8.03 Impact Factor -
Article: Pre-steady-state kinetics shows differences in processing of various DNA lesions by Escherichia coli formamidopyrimidine-DNA glycosylase.
[show abstract] [hide abstract]
ABSTRACT: Formamidopyrimidine-DNA-glycosylase (Fpg protein, MutM) catalyses excision of 8-oxoguanine (8-oxoG) and other oxidatively damaged purines from DNA in a glycosylase/apurinic/apyrimidinic-lyase reaction. We report pre-steady-state kinetic analysis of Fpg action on oligonucleotide duplexes containing 8-oxo-2'-deoxyguanosine, natural abasic site or tetrahydrofuran (an uncleavable abasic site analogue). Monitoring Fpg intrinsic tryptophan fluorescence in stopped-flow experiments reveals multiple conformational transitions in the protein molecule during the catalytic cycle. At least four and five conformational transitions occur in Fpg during the interaction with abasic and 8-oxoG-containing substrates, respectively, within 2 ms to 10 s time range. These transitions reflect the stages of enzyme binding to DNA and lesion recognition with the mutual adjustment of DNA and enzyme structures to achieve catalytically competent conformation. Unlike these well-defined binding steps, catalytic stages are not associated with discernible fluorescence events. Only a single conformational change is detected for the cleavable substrates at times exceeding 10 s. The data obtained provide evidence that several fast sequential conformational changes occur in Fpg after binding to its substrate, converting the protein into a catalytically active conformation.Nucleic Acids Research 02/2004; 32(3):926-35. · 8.03 Impact Factor -
Article: Thermodynamic, kinetic, and structural basis for recognition and repair of 8-oxoguanine in DNA by Fpg protein from Escherichia coli.
[show abstract] [hide abstract]
ABSTRACT: X-ray analysis does not provide quantitative estimates of the relative importance of the molecular contacts it reveals or of the relative contributions of specific and nonspecific interactions to the total affinity of specific DNA to enzymes. Stepwise increase of DNA ligand complexity has been used to estimate the relative contributions of virtually every nucleotide unit of 8-oxoguanine-containing DNA to its total affinity for Escherichia coli 8-oxoguanine DNA glycosylase (Fpg protein). Fpg protein can interact with up to 13 nucleotide units or base pairs of single- and double-stranded ribo- and deoxyribo-oligonucleotides of different lengths and sequences through weak additive contacts with their internucleotide phosphate groups. Bindings of both single-stranded and double-stranded oligonucleotides follow similar algorithms, with additive contributions to the free energy of binding of the structural components (phosphate, sugar, and base). Thermodynamic models are provided for both specific and nonspecific DNA sequences with Fpg protein. Fpg protein interacts nonspecifically with virtually all of the base-pair units within its DNA-binding cleft: this provides approximately 7 orders of magnitude of affinity (Delta G degrees approximately equal to -9.8 kcal/mol) for DNA. In contrast, the relative contribution of the 8-oxoguanine unit of the substrate (Delta G degrees approximately equal to -0.90 kcal/mol) together with other specific interactions is <2 orders of magnitude (Delta G degrees approximately equal to -2.8 kcal/mol). Michaelis complex formation of Fpg protein with DNA containing 8-oxoguanine cannot of itself provide the major part of the enzyme specificity, which lies in the k(cat) term; the rate is increased by 6-8 orders of magnitude on going from nonspecific to specific oligodeoxynucleotides.Biochemistry 07/2002; 41(24):7540-8. · 3.42 Impact Factor
Top co-authors
Top Journals
- Biochemistry (4)
- Biochemistry (3)
- Nucleic Acids Research (3)
- PLoS ONE (3)
- Journal of Biological Chemistry (2)
Institutions
-
2004–2012
-
Sobolev Institute of Mathematics of the Siberian Branch of the Russian Academy of Sciences
Novosibirsk, Novosibirskaya Oblast', Russia
-
-
2009
-
Institute of Chemical Biology and Fundamental Medicine
Novosibirsk, Novosibirskaya Oblast', Russia
-
-
2007–2009
-
Novosibirsk State University
Novosibirsk, Novosibirskaya Oblast', Russia
-
